Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Quinolinium Compounds”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 181 records · Page 10Linked to original sources
PubMed1986

Comparative study of the configuration and the cleanliness level of root canals prepared with the aid of sodium hypochlorite and bis-dequalinium-acetate solutions.

Bis-dequalinium acetate (BDA), a quaternary ammonium compound, was introduced as a bactericidal and chemotherapeutic agent for endodontic use. This study was undertaken to compare the efficacy of this compound to 5.25% sodium hypochlorite in the cleansing and shaping of root canals. One hundred twenty freshly extracted teeth were divided into three groups. Each group was treated with the aid of the test material; saline solution was used as a control. After completion of the endodontic preparation, a silicone imprint of the canals was performed and the teeth were decalcified. The imprints were examined three-dimensionally to determine the amount of debris and canal configuration due to defective preparation and anatomic variation. No significant difference could be observed between the tested materials with respect to cleanliness and the shape of the canals. At the apical third, however, the BDA-treated canals showed more favorable results with respect to cleanliness. On the basis of the present and previous findings, it was concluded that BDA might be a favorable replacement for sodium hypochlorite as an irrigation solution.

Dental Pulp Cavity↗
PubMed1975

Studies of the neuromuscular blocking effects of BW 403C65 in frog and cat muscle.

BW 403C65, an isoquinolinium bisquaternary compound, was investigated for its neuromuscular blocking properties. In vitro in from preparations, low concentrations induced an increase in miniature endplate potentials (m.e.p.p.) frequency without altering their amplitude. With increasing concentrations m.e.p.p. frequency returned to control value and amplitude started to decrease concomitantly with the decreased sensitivity of the endplate to iontophoretically applied acetylcholine and depression of the twitch tension. Acetylcholine released at the neuromuscular junction was also decreased. In vivo in the cat preparation the intra-arterial injection of low doses of the drug produced an increase in the strength of the muscle twitch, and the development of contracture, as well as the appearance of post-drug repetition at the ventral roots. Greater doses produced a progressive decline in post-tetanic potentiation with prolonged return to control.

Acetylcholine↗
PubMed2000

Antagonist effects on human P2X(7) receptor-mediated cellular accumulation of YO-PRO-1.

We have examined the interaction of P2 antagonists with the human P2X(7) receptor by studying their effect on 2' and 3'-O-benzoyl-benzoyl-ATP (DbATP) stimulated cellular accumulation of the fluorescent, DNA binding dye, YO-PRO-1 (MW=375Da). In suspensions of HEK293 cells expressing human recombinant P2X(7) receptors, DbATP produced time and concentration-dependent increases in YO-PRO-1 fluorescence. This response presumably reflects YO-PRO-1 entry through P2X(7) receptor channels and binding to nucleic acids. When studies were performed in a NaCl-free, sucrose-containing buffer, full concentration-effect curves to DbATP could be constructed. The P2 antagonists, pyridoxalphosphate-6-azophenyl-2', 4'-disulphonic acid (PPADS) and periodate oxidized ATP (oATP), reduced the potency of DbATP and decreased its maximum response. 1-[N,O-bis(1, 5-isoquinolinesulphonyl)-N-methyl-L-tyrosyl]-4-phenylpiperazine (KN62) and its analogue, KN04, reduced the potency of DbATP. Schild slopes for KN62 and KN04 were shallow and exhibited a plateau at concentrations of compound greater than 1 microM, indicating that these compounds were not competitive antagonists. Calmidazolium and a monoclonal antibody to human P2X(7) receptors attenuated DbATP-stimulated YO-PRO-1 accumulation but they were not competitive antagonists and only produced 2 - 3 fold decreases in the potency of DbATP. The effects of PPADS and KN62 were partially reversible whereas those of oATP were not. PPADS protected cells against the irreversible antagonist effects of oATP suggesting a common site of action. In contrast KN62 was not effective suggesting that it may bind at a different site to oATP and PPADS. This study has demonstrated that P2X(7) receptor function can be quantified by measuring DbATP stimulated YO-PRO-1 accumulation and has provided additional information about the interaction of P2 receptor antagonists with the human P2X(7) receptor.

1-(5-Isoquinolinesulfonyl)-2-Methylpiperazine↗
PubMed2001

Complexities of measuring antagonist potency at P2X(7) receptor orthologs.

The ability of P2 antagonists to affect agonist-stimulated fluorescent dye accumulation in cells expressing human, rat, or mouse P2X(7) receptors was examined. Several compounds, including pyridoxalphosphate-6-azophenyl-2',4'-disulfonic acid (PPADS), which was previously thought to be a weak P2X(7) receptor antagonist, possessed high potency (nanomolar IC(50)) at human and rat P2X(7) receptors. However, there were species differences in antagonist potency with PPADS, pyridoxal 5'-phosphate (P5P), and periodate-oxidized ATP (OxATP) exhibiting 20- to 500-fold higher potency for human than for mouse P2X(7) receptors. HMA (5-(N,N-hexamethylene)amiloride) was also selective for human over rat P2X(7) receptors but potentiated responses at mouse P2X(7) receptors. Coomassie Brilliant Blue G (CBB) was a nonselective antagonist with high potency at mouse P2X(7) receptors (IC(50) approximately 100 nM). All compounds were noncompetitive antagonists, and potency could only be quantified by measuring IC(50) values. These values were similar when determined against EC(50) concentrations of ATP or 2'- and 3'-O-4(-benzoylbenzoyl)-ATP and, for most compounds, only slightly (3- to 5-fold) affected by agonist concentration. However, IC(50) values for KN62 (1-[N,O-bis(5-isoquinolinesulfonyl)-N-methyl-L-tyrosyl]-4-phenylpiperazine) and suramin, varied up to 25-fold depending upon agonist concentration. Furthermore, IC(50) values for KN62 and OxATP were 10-fold lower at 22 degrees C than at 37 degrees C, whereas IC(50) values for PPADS, P5P, suramin, and OxATP were up to 20-fold lower in NaCl than in sucrose buffer. Potency estimates for CBB and PPADS decreased 5-fold in the presence of bovine serum albumin, possibly due to protein binding. Given the species differences, and the effects of assay conditions on antagonist potency, caution must be exercised when interpreting results obtained with the available antagonists.

1-(5-Isoquinolinesulfonyl)-2-Methylpiperazine↗
PubMed2005

Synthesis and evaluation of the bis-nor-anachelin chromophore as potential cyanobacterial ligand.

The cyanobacterial metabolite anachelin, postulated to serve as a biological ligand to Fe (siderophore), is composed of a fascinating blend of polyketide, peptide, and alkaloid building blocks. In particular, the latter consists of a N,N-dimethyltetrahydroquinolinium fragment, of which the biosynthesis is unknown. To investigate the role of this permanently positively charged fragment, we developed a synthesis of both the anachelin chromophore and its bis-nor derivative lacking the N,N-dimethyl groups starting from suitably protected nitro-DOPA in six and five steps, respectively, and in 50-64% overall yield. Both compounds were then compared for their chemical behavior toward oxidation. It was found that the bis-nor-anachelin chromophore is readily oxidized in solution in the presence of air, with a clear dependence of the rate of oxidation on the pH value. In addition, we could demonstrate that the enzyme tyrosinase, postulated to serve as key catechol oxidase in the biosynthesis of anachelin, also oxidized the bis-nor-hydroquinonamine derivative. Last, Fe(III) was shown to be an effective oxidant for the bis-nor-anachelin chromophore, resulting in all cases in the corresponding aminoquinone. In stark contrast, the anachelin chromophore resisted oxidation under various conditions surveyed (i.e., mediated by air, by tyrosinase, and by Fe(III)). In particular, Fe(III) was readily complexed by the anachelin chromophore, and the resulting complexes were characterized. In conclusion, these experiments demonstrate that the bis-nor-anachelin chromophore is unlikely to serve as cyanobacterial ligand, due to its instability toward oxidation. Moreover, the permanent quaternary ammonium group in anachelin renders the alkaloid chromophore much more stable against oxidation and thus results in its use as ligand for Fe(III).

Amination↗
PubMed2003

Detection of viral infection in the respiratory tract of virus antibody free mice: advantages of high-resolution imaging for respiratory toxicology.

Using a highly sensitive membrane permeability assay, a viral infection was discovered in the lungs of virus antibody free (VAF) Swiss-Webster mice purchased for respiratory toxicology studies. The assay is based on the uptake of a charged fluorescent compound by cells lacking an intact plasma membrane. Lungs from 74% of the untreated animals from a single vendor tested positive for injury in this assay. High-resolution histopathologic analysis of 1-microm epoxy resin sections from affected animals identified increased peribronchiolar lymphocytic infiltration and markers of epithelial cell injury. Viral particles were directly observed to be budding from the membranes of infiltrating lymphocytic cells by transmission electron microscopy. Standard histological analysis of paraffin-embedded tissues from lungs of the same mice failed to detect obvious pathology. Serological analyses failed to detect the presence of a virus in the affected mice. Therefore, we conclude that (1) a pathogenic condition was present in the respiratory systems of mice judged pathogen free by standard methodologies, (2) the observed condition produced a pattern of injury comparable to those caused by pulmonary toxicants, (3) high-resolution histopathology and advanced imaging techniques can increase the potential for detection of pathological conditions, and (4) apparently healthy animals can have unrecognized infections with the potential for confounding respiratory toxicology studies.

Animals↗
PubMed1990

Inhibition of rodent protein kinase C by the anticarcinoma agent dequalinium.

Dequalinium has previously been shown to be an anticarcinoma agent (M. J. Weiss et al., Proc. Natl. Acad. Sci. USA, 84: 5444-5448, 1987). The present study demonstrates that it can inhibit protein kinase C-beta 1 isolated from an overproducing cell line with a 50% inhibitory concentration of 8-15 microM. Further examination of the inhibition by using structural analogues of dequalinium reveals that the length of the methylene bridge between the two quinaldinium moieties, the presence of the ring substituents, and the bipartite character of the compound each contributes to the inhibitory potency. Related studies show that the analogues display the same rank order of inhibitory potency when tested with the trypsin-generated catalytic fragment of the enzyme, indicating that dequalinium inhibits kinase activity through an interaction with the catalytic subunit. Further studies argue that the ability of a given analogue to inhibit phosphotransferase activity correlates with its ability to compete with [3H]phorbol-12,13-dibutyrate binding on the intact enzyme (50% inhibitory concentration of 2-5 microM). This suggests that the inhibitor is either binding directly to the regulatory subunit as well, or that due to its interaction with the catalytic subunit, dequalinium produces an indirect effect on sites defined by phorbol ester binding. Kinetic analysis revealed that inhibition is noncompetitive with respect to ATP or phosphatidylserine. Studies conducted with types I, II, and III rat brain isozymes, resolved by hydroxylapatite chromatography, demonstrate that dequalinium inhibits each of them with similar potency (50% inhibitory concentration of 11 microM) and imply that the site of contact on the enzyme is a highly conserved region. Morphology studies with dequalinium in intact cells demonstrate that the inhibitor can protect control cells against phorbol ester-induced morphology changes but cannot protect protein kinase C-overproducing cells, suggesting that an elevation in protein kinase C levels alone is sufficient to overturn the protection conferred by dequalinium. On the basis of these results, we propose that protein kinase C could be a critical in vivo target of dequalinium.

Animals↗
PubMed1978

Differentiation of two types of endocrine cells which take up amine precursors using their capacity to take up the fluorescent dihydroisoquinoline derivative of dopamine.

A study was made of the accumulation of the strongly fluorescent 2-carboxymethyl-6,7-dihydroxy-3,4-dihydroisoquinolinium compound (2-Carb. Me-DIQ) derived from the condensation reaction of dopamine with glyoxylic acid in endocrine cells possessing the capacity to take up and store biogenic monoamine precursors. Thin-layer chromatographic studies of urine showed that 2-Carb. Me-DIQ was metabolized into two strongly fluorescent metabolites, possessing at least one hydroxyl group in the phenol moiety of the molecule, which were excreted in urine together with the parent compound. Histochemical observations, however, indicated that the tissue fluorescence showing maximal emission at 480 nm was due to 2-Carb. Me-DIQ. Generally, the injection of 2-Carb. Me-DIQ induced a strong fluorescence in those tissue components possessing the extraneuronal uptake mechanism of catecholamines. In the endocrine cells strong fluorescence was seen in the pineal glandular cells and in some cells of the pars distalis of the hypophysis, of which some cells also took up DL-5-HTP, as was seen following formaldehyde vapour treatment. No accumulation of 2-Carb. Me-DIQ was observed in the pancreatic islet cells, the C cells of the thyroid gland or the tracheal enterochromaffin-like cells. These findings lead to the conclusion that biogenic monoamines in the cells of the pars distalis of the hypophysis might use the phenolic moiety of the molecule to bind to some intracellular receptor. Thus, the pars distalis cells may have an intracellular binding mechanism for biogenic monoamines that is different from other endocrine cells showing the uptake and storage of biogenic monoamines. On the other hand, the findings gave further support to the suggestion that in the pancreatic islet cells, the thyroidal C cells and the tracheal enterochromaffin-like cells biogenic monoamines are stored by a mechanism in which the basic, positively charged amino group of biogenic monoamines is bound electrostatically to the anionic, negatively charged carboxyl group of a hormone storage granule. The pars distalis cells and the pineal glandular cells seemed to take up amines and amine derivatives in a similar manner. This suggests that in the pars distalis cells, too, biogenic monoamines have an active metabolism and possibly some regulative role in hormone synthesis and/or secretion.

5-Hydroxytryptophan↗
PubMed1988

Prostaglandin-independent inhibition of ocular vascular permeability by a platelet-activating factor antagonist.

Platelet-activating factor (PAF), a lipid mediator of inflammation, may markedly increase vascular permeability. We assessed the ability of the PAF antagonist SRI 63-441 to inhibit ocular vascular permeability induced by the intravenous injection of endotoxin or anterior chamber paracentesis. The PAF antagonist SRI 63-441 significantly blocked ocular vascular permeability following either intravenous endotoxin or anterior chamber paracentesis as determined by the reduction in accumulation of 70,000-molecular-weight fluorescein isothiocyanate-conjugated dextran or serum proteins into the anterior chamber. SRI 63-441 did not reduce increases in aqueous humor prostaglandin E2 levels. The efficacy of the PAF antagonist was additive in combination with either topical indomethacin or topical corticosteroid. Combined therapy almost completely prevented increases in ocular vascular permeability. These data support the conclusion that multiple mediators contribute to ocular vascular permeability and that combinations of pharmacologic agents may be superior to a single drug.

Animals↗
PubMed1999

Single-molecule manipulation of double-stranded DNA using optical tweezers: interaction studies of DNA with RecA and YOYO-1.

By using optical tweezers and a specially designed flow cell with an integrated glass micropipette, we constructed a setup similar to that of Smith et al. (Science 271:795-799, 1996) in which an individual double-stranded DNA (dsDNA) molecule can be captured between two polystyrene beads. The first bead is immobilized by the optical tweezers and the second by the micropipette. Movement of the micropipette allows manipulation and stretching of the DNA molecule, and the force exerted on it can be monitored simultaneously with the optical tweezers. We used this setup to study elongation of dsDNA by RecA protein and YOYO-1 dye molecules. We found that the stability of the different DNA-ligand complexes and their binding kinetics were quite different. The length of the DNA molecule was extended by 45% when RecA protein was added. Interestingly, the speed of elongation was dependent on the external force applied to the DNA molecule. In experiments in which YOYO-1 was added, a 10-20% extension of the DNA molecule length was observed. Moreover, these experiments showed that a change in the applied external force results in a time-dependent structural change of the DNA-YOYO-1 complex, with a time constant of approximately 35 s (1/e2). Because the setup provides an oriented DNA molecule, we determined the orientation of the transition dipole moment of YOYO-1 within DNA by using fluorescence polarization. The angle of the transition dipole moment with respect to the helical axis of the DNA molecule was 69 degrees +/- 3.

Bacteriophage lambda↗
PubMed1999

Orientation of the chromophore dipoles in the TOTO-DNA system.

BACKGROUND: Flow cytometry has been applied successfully to the sizing of medium to large-sized DNA molecules, thanks to the excellent staining properties of cyanine chromophores such as TOTO (homodimer of thiazole orange) (Petty et al.: Anal Chem 67:1755-1761, 1995). The hydrodynamic flow, used to focus the sample molecules in a small laser-illuminated volume, is also responsible for their alignment, thereby allowing the determination of the TOTO-dipole orientation with respect to the DNA axis (Agronskaia et al.: Appl Opt 38:714-719, 1999). METHODS: We present model calculations of the fluorescence yield of TOTO-stained DNA measured in a flow-cytometric setup with high numerical aperture. The models consider different orientations of the chromophore dipoles. RESULTS: Comparison of measurement and calculation suggests that the absorption dipoles of the TOTO molecule make a mean angle of 61 degrees with the helix axis of the DNA molecule. This mean angle can be the consequence of two binding modes. CONCLUSIONS: Our results indicate that any model with a significant contribution of perpendicularly-oriented chromophores fails to reproduce the experimental results.

Bacteriophage lambda↗
PubMed2000

Polarization of scatter and fluorescence signals in flow cytometry.

BACKGROUND: The pulses of light scatter and fluorescence measured in flow cytometers exhibit varying degrees of polarization. Flow cytometers are heterogeneously sensitive to this polarization, depending on the light source(s), the optical layout, and the types of mirrors and filters used. Therefore, fluorescence polarization can affect apparent intensity ratios between particles and interfere with schemes for interlaboratory standardization. METHODS: We investigate the degree to which polarization affects common flow cytometry measurements. Our technique for determining polarization differs from previous methods because complete distributions of intensity versus polarization angle are measured, rather than intensities at just two orthogonal polarization angles. Theoretical models for scatter and fluorescence are presented and verified by making polarization measurements of calibration beads. RESULTS: Measurements of cells stained with a variety of dyes illustrate that fluorescence polarization occurs frequently in flow cytometry. CONCLUSIONS: Consequences for quantitative cytometry are discussed, and the use of the "magic angle" to make a flow cytometer insensitive to fluorescence polarization is proposed.

Animals↗
PubMed1996

Calcium regulated chloride permeabilities in primary cultures of rabbit colonocytes.

To determine if calcium-dependent secretagogues directly act on epithelial cells to elicit Cl- secretion, their effects on Cl- transport and intracellular Ca(2+) concentrations ([Ca2+]i) were determined in primary cultures of rabbit distal colonic crypt cells. The Cl- sensitive fluorescent probe, 6-methoxyquinolyl acetoethyl ester, MQAE and the Ca(2+)-sensitive fluorescent probe, fura-2AM were used to assess Cl- transport and [Ca2+]i, respectively. Basal Cl- transport (0.274 +/- 0.09 mM/sec) was inhibited significantly by the Cl- channel blocker diphenylamine-2-carboxylate (DPC, 50 microM, 0.068 +/- 0.02 mM/sec; P < 0.001) and the Na+/K+/ 2Cl- cotransport inhibitor furosemide (1 microM, 0.137 +/- 0.04 mM/sec; P < 0.01). Ion substitution studies using different halides revealed the basal influx to be l- > F- > or = Cl- > Br-. DPC inhibited l- influx by approximately 50%, F- influx by 80%, Cl-influx by 85%, and Br- influx by 90%. Furosemide significantly inhibited influx of Br- (84%) and Cl- (81%) but not of F- and l-. The effects of agents known to alter biological response by increasing [Ca2+]i in other epithelial systems were used to stimulate Cl- transport. Cl- influx in mM/second was stimulated by 1 microM histamine (0.58 +/- 0.05), 10 microM neurotensin (2.07 +/- 0.32), 1 microM serotonin (1.63 +/- 0.28), and 0.1 microM of the Ca2+ ionophore A23187 (2.05 +/- 0.40). The Cl- permeability stimulated by neurotensin, serotonin, and A23187 was partially blocked by DPC or furosemide added alone or in combination. Histamine-induced Cl- influx was significantly inhibited by only furosemide. Indomethacin blocked histamine-stimulated Cl- permeability but had no effect on the actions of the other agents. These studies, focusing on isolated colonocytes without the contribution of submucosal elements, reveal that (1) histamine stimulates Cl- transport by activating the Na+/K+/2Cl- cotransporter via a cyclooxygenase-dependent pathway; (2) neurotensin, serotonin, and A23187 activate both Cl- channels and the cotransporter, and their actions are cyclooxygenase-independent.

Animals↗
PubMedDate not supplied

Sequence-specific interactions of minor groove binders with restriction fragments of cDNAs for H tau 40 protein and MAP kinase 2. A qualitative and quantitative footprinting study.

A series of DNA minor groove binders comprising netropsin, distamycin, the bisquaternary ammonium heterocycles SN 6999 and SN 6570, cis-diammine platinum(II)-bridged bis-netropsin, cis-diammine platinum(II)-bridged bis-distamycin and bis-glycine-linked bis-distamycin were investigated for sequence-specific interactions. The oligonucleotides used were the 154 base pair HindIII-RsaI restriction fragment of cDNA of h tau 40 protein and the 113 base pair NcoI-PvuII restriction fragment of cDNA of MAP kinase 2. Both proteins are believed to be involved in the pathology of Alzheimer's disease. For all these ligands, binding sites were localised at positions 1134-1139 (5'AATCTT3'), 1152-1156 (5'ATATT3') and 1178-1194 (5'TTTCAATCTTTTTATTT3') for the former and 720-726 (5'TATTCTT3'), 751-771 (5'AATTGTATAATAAATTTAAAA3') and 781-785 (5'TATTT3') for the latter. The AT-preference of ligand binding was obvious and footprint titration experiments were applied to estimate binding constants (Ka) for each individual binding site mentioned above. The binding strength decreases in the order netropsin > distamycin > SN 6999 approximately SN 6570>platinum-bridged netropsin or distamycin approximately bis-glycine-bridged distamycin and was found independently of the binding sites examined. GC-base pairs interspersed in short AT-tracts reduced the Ka-values by as much as two orders of magnitudes. The dependence of extended bidentate as well as of monodentate binding of netropsin and distamycin derivatives on the length of AT-stretches has been discussed.

Cisplatin↗
PubMed2001

Indirect micromanipulation of single molecules in water-in-oil emulsion.

Based on real-time observation and micromanipulation, analytical methods for single DNA molecules have been under development for some time. Precise manipulation, however, is still difficult because single molecules are too small for conventional techniques. We have developed a chemical reaction system that uses water droplets in oil as containers of materials. The water droplets can be manipulated by optical force. The manipulation of the water droplets permits the fusion of two selected droplets. This process corresponds to mixing of different samples. We designate this system as "w/o (water-in-oil emulsion) microreactor system", and each droplet can be thought of as a "microreactor". In this system, single molecules can be manipulated readily, as a molecule can be contained in a microm-sized microreactor. The microreactor utilizes extremely small quantities of samples, therefore, reactions are rapid, as diffusion times in the microreactor are very short. The manipulation technique of the microreactors based on optical force has been applied to induce fusion between microreactors loaded with DNA and YOYO, a fluorescent dye that binds to DNA. This fusion induced a rapid binding of YOYO.

Benzoxazoles↗
PubMed2001

Electrophoresis in microfabricated devices using photopolymerized polyacrylamide gels and electrode-defined sample injection.

Microfabrication techniques have become increasingly popular in the development of the next generation of DNA analysis systems. While significant progress has been reported by many researchers, complete microfabricated integrated DNA analysis devices are still in the earliest stages of development. Most miniaturized analysis systems have incorporated noncross-linked polymer solutions as the separation medium of choice and the operation of these systems necessitates the use of high electric fields and long separation lengths. In this paper, we present two techniques that may help alleviate this problem and accelerate the development of the so-called 'lab-on-a-chip' systems. We present the use of photodefinable polyacrylamide gels as a sieving medium for DNA electrophoresis. These gels offer the significant advantages of faster curing times, locally controlled gel interface, and simpler handling over chemically polymerized gels. We also introduce an electrode-defined sample compaction and injection technique. This technique helps achieve sample compaction without migration into the gel and offers significant control over the size and application of the sample plug. The use of these technologies for double-stranded DNA separations in microfabricated separation systems is demonstrated.

Acrylic Resins↗
PubMed2001

Single-molecule immunoassay and DNA diagnosis.

Many assays relevant to disease diagnosis are based on electrophoresis, where the migration velocity is used for distinguishing molecules of different size or charge. However, standard gel electrophoresis is not only slow but also insensitive. We describe a single-molecule imaging procedure to measure the electrophoretic mobilities of up to 100000 distinct molecules every second. The results correlate well with capillary electrophoresis (CE) experiments and afford confident discrimination between normal (16.5 kbp) and abnormal (6.1 kbp) mitochondrial DNA fragments, or beta-phycoerythrin-labeled digoxigenin (BP-D) and its immunocomplex (anti-D-BP-D). This demonstrates that virtually all electrophoresis diagnostic protocols from slab gels to CE should be adaptable to single-molecule detection. This opens up the prossibility of screening single copies of DNA or proteins within single biological cells for disease markers without performing polymerase chain reaction (PCR) or other biological amplification.

Antigen-Antibody Complex↗
PubMed2001

Diffusion coefficient of DNA molecules during free solution electrophoresis.

The free-draining properties of DNA normally make it impossible to separate nucleic acids by free-flow electrophoresis. However, little is known, either theoretically or experimentally, about the diffusion coefficient of DNA molecules during free-flow electrophoresis. In fact, many authors simply assume that the Nernst-Einstein relation between the mobility and the diffusion coefficient still holds under such conditions. In this paper, we present an experimental study of the diffusion coefficient of both ssDNA and dsDNA molecules during free-flow electrophoresis. Our results unequivocally show that a simplistic use of Nernst-Einstein's relation fails, and that the electric field actually has no effect on the thermal diffusion process. Finally, we compare the dependence of the diffusion coefficient upon DNA molecular size to results obtained previously by other groups and to Zimm's theory.

Algorithms↗