Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Osteocalcin”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 181 records · Page 10Linked to original sources
PubMed2002

Hypercorticism blunts circadian variations of osteocalcin regardless of nutritional status.

Anorexia nervosa (AN) and Cushing's syndrome (CS) are both responsible for osteoporosis. The mechanisms leading to osteoporosis in AN include hypogonadism, nutritional depletion, and in some cases hypercorticism. Osteocalcin circulating level is a serum marker of osteoblastic activity that follows a circadian rhythm (OCR). Serum osteocalcin is decreased in both CS and AN and can be increased with treatment. In this study we analyzed the influence of combined cortisol and nutritional status on osteocalcin levels and its circadian rhythm in these two different models of hypercorticism, one nutritionally replete (CS) and one nutritionally deplete (AN), and we evaluated the effects of their treatment (surgical cure and weight gain, respectively). Before treatment, osteocalcin levels were lower in CS (n = 16) and AN (n = 42) than in controls and in the AN patient subgroup with hypercorticism (n = 13) compared to those without (n = 29). OCR was absent in CS and in AN patients with hypercorticism, whereas their circadian cortisol cycle was maintained. In CS, successful surgical treatment increased osteocalcin levels (n = 5) and restored OCR. In AN, weight gain (n = 13) induced a significant decrease in cortisol levels in hypercortisolic AN patients, and restored normal osteocalcin levels and OCR. In conclusion, we found that hypercorticism was associated with a decrease in osteocalcin levels in nutritionally replete or deplete patients and that OCR was more affected by cortisol levels than by cortisol cycle.

Adrenocortical Hyperfunction↗
PubMed1988

Characterization of the rat osteocalcin gene: stimulation of promoter activity by 1,25-dihydroxyvitamin D3.

Osteocalcin is an abundant noncollagenous protein in bone, and its synthesis is stimulated by 1,25-dihydroxyvitamin D3 [1,25(OH)2D3]. In this study, the rat osteocalcin gene was isolated, sequenced, and found to be a single-copy gene that is highly conserved between human and rat. Northern blot analysis of RNAs from a number of rat tissues revealed osteocalcin mRNA only in calvariae, consistent with bone-specific expression of osteocalcin. In order to investigate promoter activity and its modulation by 1,25(OH)2D3, plasmids containing the osteocalcin promoter region linked to the reporter enzyme bacterial chloramphenicol acetyltransferase (CAT) were used to transfect rat osteosarcoma ROS 17/2.8 cells, which express osteocalcin endogenously, and UMR 106 cells, which lack osteocalcin expression. Transfected ROS 17/2.8 cells exhibited a higher basal CAT activity than UMR 106 cells. Moreover, 1,25(OH)2D3 stimulated the CAT expression 5-10-fold only in ROS 17/2.8 cells and not in UMR 106 cells. By use of unidirectional deletion analysis, a domain strongly responsive to 1,25(OH)2D3 was identified between bases -1035 and -871 upstream from the site of transcription initiation, while a weakly responsive region was found further downstream.

Amino Acid Sequence↗
PubMed1982

Calcium-dependent alpha-helical structure in osteocalcin.

Osteocalcin is an abundant Ca2+-binding protein of bone containing three residues of vitamin K dependent gamma-carboxyglutamic acid (Gla) among its 49 (human, monkey, cow) or 50 (chicken) amino acids. Gla side chains participate directly in the binding of Ca2+ ions and the adsorption of osteocalcin to hydroxylapatite (HA) surfaces in vivo and in vitro. Osteocalcin exhibits a major conformational change when Ca2+ is bound. Metal-free chicken osteocalcin is a random coil with only 8% of its residues in the alpha helix as revealed by circular dichroism. In the presence of physiological levels of Ca2+, 38% of the protein adopts the alpha-helical conformation with a transition midpoint at 0.75 mM Ca2+ in a rapid, reversible fashion which (1) requires an intact disulfide bridge, (2) is proportionally diminished when Gla residues are decarboxylated to Glu, (3) is insensitive to 1.5 m NaCl, and (4) can be mimicked by other cations. Tyr fluorescence, UV difference spectra, and Tyr reactivity to tetranitromethane corroborate the conformational change. Homologous monkey osteocalcin also exhibits Ca2+-dependent structure. Integration of predictive calculations from osteocalcin sequence has yielded a structural model for the protein, the dominant features of which include two opposing alpha-helical domains of 9-12 residues each, connected by a bea turn and stabilized by the Cys23-Cys29 disulfide bond. Cation binding permits realization of the full alph a-helical potential by partial neutralization of high anionic charge in the helical domains. Periodic Gla occurrence at positions 17, 21, and 24 has been strongly conserved throughout evolution and places all Gla side chains on the same face of one alpha helix spaced at intervals of approximately 5.4 A, closely paralleling the interatomic separation of Ca2+ in the HA lattice. Helical osteocalcin has greatly increased affinity for HA; thus, the Ca2+-induced structural transition may perform an informational role related to bone metabolism.

1-Carboxyglutamic Acid↗
PubMed2005

Structural evidence of a fourth Gla residue in fish osteocalcin: biological implications.

Osteocalcin is a small (45 amino acids) secreted protein found to accumulate in bone and dentin of many organisms by interacting with calcium and hydroxyapatite, through the presence of three gamma-carboxylated residues. In this work, we describe the first X-ray crystal structure for a nonmammalian osteocalcin, obtained at 1.4 A resolution, purified from the marine teleost fish Argyrosomus regius. The three-dimensional fit between the A. regius structure and that of the only other known X-ray structure, the porcine osteocalcin, revealed a superposition of the Calpha atoms of their metal chelating residues, Gla and Asp, showing that their spatial distribution is consistent with the interatomic distances of calcium cations in the hydroxyapatite crystals. In both structures, the protein forms a tight globular arrangement of their three alpha-helices while the remaining residues, at N- and C-terminal regions, have essentially no secondary structure characteristics. This study revealed the presence of a fourth gamma-carboxylation at Glu(25), not previously detected in the structure of the porcine osteocalcin or in any other of the sequentially characterized mammalian osteocalcins (human, cow, and rat). A confirmation of the fourth Gla residue in A. regius osteocalcin was achieved via LC-MS analysis. These four doubly charged residues are, together with Asp(24), concentrated in a common surface region located on the same side of the molecule. This further suggests that the known high affinity of osteocalcin for bone mineral may be derived from the clustering of calcium binding sites on this surface of the molecules.

1-Carboxyglutamic Acid↗
PubMed2005

Heterogeneous nuclear ribonucleoprotein K represses transcription from a cytosine/thymidine-rich element in the osteocalcin promoter.

HnRNP K (heterogeneous nuclear ribonucleoprotein K) was biochemically purified from a screen of proteins co-purifying with binding activity to the osteocalcin promoter. We identify hnRNP K as a novel repressor of osteocalcin gene transcription. Overexpression of hnRNP K lowers the expression of osteocalcin mRNA by 5-fold. Furthermore, luciferase reporter assays demonstrate that overexpression of hnRNP K represses osteocalcin transcription from a CT (cytosine/thymidine)-rich element in the proximal promoter. Electrophoretic mobility-shift analysis reveals that recombinant hnRNP K binds to the CT-rich element, but binds ss (single-stranded), rather than ds (double-stranded) oligonucleotide probes. Accordingly, hnRNP K antibody can supershift a binding activity present in nuclear extracts using ss sense, but not antisense or ds oligonucleotides corresponding to the CT-rich -95 to -47 osteocalcin promoter. Importantly, addition of recombinant hnRNP K to ROS 17/2.8 nuclear extract disrupts formation of a DNA-protein complex on ds CT element oligonucleotides. This action is mutually exclusive with hnRNP K's ability to bind ss DNA. These results demonstrate that hnRNPK, although co-purified with a dsDNA-binding activity, does not itself bind dsDNA. Rather, hnRNP K represses osteocalcin gene transcription by inhibiting the formation of a transcriptional complex on the CT element of the osteocalcin promoter.

Animals↗
PubMed2001

Effect of vitamin K and/or D on undercarboxylated and intact osteocalcin in osteoporotic patients with vertebral or hip fractures.

OBJECTIVE: To examine serum undercarboxylated osteocalcin (OC) with application of an ELISA in normal women and in osteoporotic patients with vertebral fractures or hip fractures, and to investigate the effects of vitamin K and/or D treatment on undercarboxylated OC and intact OC in vertebral fractures. PATIENTS: They were 43 premenopausal (PRE) and 48 postmenopausal healthy females (POST), 89 osteoporotic patients with vertebral fractures (VX) and, 24 patients with hip fracture (HX). MEASUREMENTS: Intact OC was measured by an IRMA and undercarboxylated OC was measured by an ELISA. RESULTS: Intact osteocalcin was significantly higher in POST and VX than in PRE, and was significantly lower in HX than in POST and VX. Undercarboxylated OC tended to be higher in POST, VX and HX than in PRE, but not significantly. The ratio of undercarboxylated OC to intact OC was significantly higher in HX than in POST and in VX. After 4 weeks treatment with K, D, and K + D to 56 VX, undercarboxylated OC decreased significantly in the groups with K and K + D. Intact OC tended to increase slightly in the groups given K, D, K + D, but not significantly so. Vitamin K and vitamin K + D markedly decreased the ratio of undercarboxylated/intact OC to approximately 80%. On the other hand, vitamin D did not decrease that ratio. CONCLUSIONS: There was a disproportion of undercarboxylated osteocalcin to intact osteocalcin between postmenopausal women and osteoporotic patients with vertebral fractures or hip fractures. Vitamin K did decrease undercarboxylated osteocalcin, vitamin D did not change undercarboxylated osteocalcin, and vitamin D did not enhance the effect of vitamin K on undercarboxylated osteocalcin.

Adult↗
PubMed2003

Effect of VDR gene polymorphisms on osteocalcin secretion in calcitriol-stimulated human osteoblasts.

BACKGROUND: The impact of vitamin D receptor (VDR) gene polymorphisms in bone metabolism remains controversial. Some authors have found a beneficial effect of some VDR gene polymorphisms, while others found no differences, or even a lower bone mass in subjects with the same type of polymorphisms. The aim of this study was to assess if the VDR gene polymorphisms could have an effect on the calcitriol-stimulated osteocalcin in human osteoblasts. METHODS: Osteoblasts were obtained from human femoral necks replaced because of osteoarthritis. Bones were cut into pieces of 1 to 2 mm and placed in a nylon mesh. After the migration of osteoblasts, the pieces were collected and cultured with different concentrations of calcitriol (10(-8), 10(-9), and 10(-1)0 mol/L). After 48 hours of incubation with calcitriol, the osteocalcin secreted into the medium (corrected by either total proteins or total DNA content) was measured. The DNA was extracted from the osteoblasts, amplified by polymerase chain reaction (PCR), and analyzed for target sequences sites of the BsmI, ApaI, TaqI, and FokI restriction enzymes. RESULTS: The response observed in osteocalcin secretion in the bb or TT genotypes doubled the response observed in the BB or tt genotypes (calcitriol 10(-8) and 10(-9) mol/L). A slight trend was also observed with the aa genotype. Men showed higher levels of osteocalcin secretion than women. Age did not show any influence in osteocalcin secretion. CONCLUSION: VDR alleles and gender demonstrated an effect on the osteocalcin secretion. BB or tt genotypes, and also the "A" allele, showed the lowest calcitriol-stimulated osteocalcin secretion.

Aged↗
PubMed1989

Structure of the rat osteocalcin gene and regulation of vitamin D-dependent expression.

The osteocalcin gene encodes a 6-kDa polypeptide, which represents one of the most abundant noncollagenous bone proteins, and the present studies establish that osteocalcin mRNA is detected only in bone tissue. An osteocalcin gene was isolated from a rat genomic DNA library, and sequence analysis indicated that the mRNA is represented in a 953-nucleotide segment of DNA consisting of four exons and three introns. A modular organization of the 5' flanking sequences of the gene is reflected by the presence of at least three classes of regulatory elements, which include the following: (i) RNA polymerase II canonical sequences; (ii) a series of consensus sequences for hormone receptor binding sites and cyclic nucleotide responsive elements consistent with physiologic expression of the osteocalcin gene; and (iii) a 24-nucleotide sequence in the proximal promoter region with a CAAT motif as a central element. We have designated this highly conserved sequence as an "osteocalcin box" since only 2 nucleotide substitutions are found in the rat and human osteocalcin genes. We have demonstrated two factors regulating osteocalcin gene expression. First, a 200-fold increase occurs in normal fetal calvaria osteoblasts producing a mineralizing matrix, compared to confluent osteoblasts in a nonmineralizing matrix. Second, contained within the 600 nucleotides immediately upstream from the transcription start site are sequences that support a 10-fold stimulated transcription of the gene by 1,25-dihydroxyvitamin D.

Amino Acid Sequence↗
PubMed1990

Coordinate occupancy of AP-1 sites in the vitamin D-responsive and CCAAT box elements by Fos-Jun in the osteocalcin gene: model for phenotype suppression of transcription.

Osteocalcin, a bone-specific protein and marker of the mature osteoblast, is expressed only in nonproliferating osteoblasts in a mineralizing extracellular matrix, while type I collagen is expressed in proliferating cells. The nuclear proteins encoded by the c-fos and c-jun protooncogenes are expressed during the proliferation period of osteoblast phenotype development. We present evidence that AP-1 (HeLa cell-activating protein 1) sites residing within two promoter elements of the osteocalcin gene bind the Fos-Jun protein complex: the osteocalcin box (OC box; nucleotides -99 to -76), which contains a CCAAT motif as a central element and influences tissue-specific basal levels of osteocalcin gene transcription, and the vitamin D-responsive element (VDRE; nucleotides -462 to -440), which mediates enhancement of osteocalcin gene transcription. Gel electrophoretic mobility-shift analysis demonstrated high AP-1 binding activity in proliferating osteoblasts and dramatic changes in this activity after the down-regulation of proliferation and the initiation of extracellular-matrix mineralization in primary cultures of normal diploid osteoblasts. Methylation interference analysis established at single nucleotide resolution that purified recombinant Fos and Jun proteins bind in a sequence-specific manner to the AP-1 sites within the VDRE and OC box. Similarly, an AP-1 motif within a putative VDRE of the alkaline phosphatase gene, which is also expressed after the completion of proliferation, binds the Fos-Jun complex. These results support a model in which coordinate occupancy of the AP-1 sites in the VDRE and OC box in proliferating osteoblasts may suppress both basal level and vitamin D-enhanced osteocalcin gene transcription as well as transcription of other genes associated with osteoblast differentiation--a phenomenon we describe as phenotype suppression. This model is further supported by binding of the Fos-Jun complex at an AP-1 site in the type alpha I collagen promoter that is contiguous with, but not overlapping, the VDRE. Such a sequence organization in the collagen VDRE motif is compatible with vitamin D modulation of collagen but not with osteocalcin and alkaline phosphatase expression in proliferating osteoblasts.

Animals↗
PubMed1990

Vitamin D-mediated modifications in protein-DNA interactions at two promoter elements of the osteocalcin gene.

By the combined use of DNase I footprinting, electrophoretic mobility-shift assay, and methylation interference analysis, we have identified a series of sequence-specific protein-DNA interactions in the 5' flanking region of the rat osteocalcin gene. Stimulation of osteocalcin gene expression by 1,25-dihydroxyvitamin D3, a physiologic mediator of this bone-specific gene in vitro and in vivo, is associated with modifications in the binding of ROS 17/2.8 cell nuclear factors to two promoter segments that up-regulate transcription. One segment located between -462 and -437 exhibits a vitamin D-dependent increase in sequence-specific binding of nuclear factors. This element (CTGGGTGAATGAGGACATTACTGACC), identified at single nucleotide resolution, contains a region of hyphenated dyad symmetry and shares sequence homology with consensus steroid-responsive elements and with the sequence that has been identified as the vitamin D receptor binding site in the human osteocalcin gene. We have also observed that vitamin D stimulation of osteocalcin gene expression results in a 5-fold increase in protein binding to the region of the osteocalcin box, a 24-nucleotide segment in the proximal promoter with a CCAAT motif as the central core. Our results demonstrate protein-DNA interactions in a vitamin D-responsive element and in a second sequence, the osteocalcin box, both of which are involved in the physiologic regulation of the osteocalcin gene in response to 1,25-dihydroxyvitamin D3.

Animals↗
PubMed1999

Etomidate and the osteocalcin response to gynaecological surgery.

Circulating osteocalcin is a good marker of osteoblastic activity and decreases significantly after stressful physiological states such as major surgery. Glucocorticoids are known to inhibit osteoblastic activity and result in a decline in circulating osteocalcin. We used etomidate to inhibit the cortisol response to routine gynaecological surgery to determine if this would prevent the postoperative decline in osteocalcin. Twenty-four patients were allocated randomly to receive either thiopental or etomidate for induction of anaesthesia; all other aspects of anaesthesia and perioperative management were standardized. In the thiopental group, circulating cortisol increased significantly at 2 and 6 h after the start of surgery and plasma osteocalcin concentrations decreased significantly to almost 50% of baseline values at 48 h. Etomidate abolished the cortisol response to surgery, and circulating osteocalcin concentrations did not change after operation. There was a significant difference in osteocalcin concentration between the groups at 48 h. We conclude that the cortisol response to surgery is associated with a postoperative decrease in circulating osteocalcin.

Adult↗
PubMed2000

A new assay method that detects only intact osteocalcin. Two-step non-invasive diagnosis to predict adynamic bone disease in haemodialysed patients.

BACKGROUND: We studied the usefulness of a new assay method that detects only the intact human osteocalcin molecule in haemodialysed patients. METHODS: Iliac bone biopsy specimens obtained from 62 haemodialysed patients were analysed. RESULTS: Bone formation rates (BFR/BS) correlated positively with serum intact osteocalcin concentrations (n=62), osteocalcin concentrations assayed by a conventional method (n=31), parathyroid hormone (PTH) concentrations (n=62), and total alkaline phosphatase concentrations (r=0.602, 0. 588, 0.650, and 0.401 respectively). Based on ROC curve and Youden index analysis, the optimal cut-off value to distinguish adynamic bone disease from a mild lesion was 195 pg/ml of serum PTH concentration (Youden index=0.233) or 30 ng/ml of serum intact osteocalcin concentration (Youden index=0.628). The optimal cut-off value to distinguish between hyperparathyroid bone and a mild lesion was 455 pg/ml of serum PTH level (Youden index=0.63) or 50 ng=ml of serum intact osteocalcin concentration (Youden index=0.634). Since both ROC curve and Youden index suggested that the serum PTH concentration was not a good marker to distinguish adynamic bone from a mild lesion or hyperparathyroid bone, we designed a two-step procedure. The first step was the diagnosis of adynamic bone (cut-off: 65 pg/ml) or hyperparathyroid bone (cut-off: 455 pg/ml) according to serum PTH concentration. In a second step, we assessed serum intact osteocalcin concentration in patients with serum PTH concentrations between 65 and 455 pg/ml. The cut-off values for adynamic and hyperparathyroid bone in this diagnostic approach were 30 and 70 ng/ml respectively. As a result, 49 out of 62 patients were diagnosed properly. The Youden index of this two-step diagnosis was 0.527 and 0.661 for adynamic bone and hyperparathyroid bone respectively. Sensitivity markedly improved to 94.4% and 96.2% for adynamic bone and hyperparathyroid bone respectively, without sacrificing specificity (84.0 and 88.8% respectively). CONCLUSION: Measurement of serum intact osteocalcin concentration is useful for the diagnosis of adynamic bone in haemodialysed patients. A two-step procedure involving also simultaneous measurement of serum PTH concentration further improved the sensitivity of each individual marker while maintaining specificity.

Adult↗
PubMed1995

Fetal osteocalcin levels are related to placental 11 beta-hydroxysteroid dehydrogenase activity in humans.

OBJECTIVE: Overexposure to glucocorticoids in utero reduces birth weight and, in animals, leads to persistent hypertension in the offspring. The fetus is normally protected from maternal glucocorticoids by placental 11 beta-hydroxysteroid dehydrogenase (11 beta-HSD) which catalyses the conversion of cortisol to inert cortisone. In adult humans, osteocalcin is a sensitive marker of glucocorticoid exposure. The aim of this study was to determine whether cord blood osteocalcin levels were related to the ability of placental 11 beta-HSD to inactivate maternal cortisol. DESIGN: Cross-sectional study examining the relation between cord blood levels of osteocalcin and placental glucocorticoid metabolism at term. PATIENTS: Twenty-one women attending for delivery at the Simpson Memorial Maternity Pavilion in Edinburgh had cord venous and arterial blood samples collected at delivery. MEASUREMENTS: Cord plasma levels of osteocalcin, cortisol and cortisone were measured by radioimmunoassay and indices of placental 11 beta-HSD activity were calculated. RESULTS: All indices of placental 11 beta-hydroxysteroid dehydrogenase activity correlated directly and significantly with cord blood osteocalcin levels. For cord blood osteocalcin and the placental 11 beta-HSD Activity Index, Pearson's r was +0.58, r2 = 0.33 and P < 0.02. CONCLUSION: We conclude that term cord blood osteocalcin level reflects the effectiveness of placental glucocorticoid inactivation, and may be a marker for the development of adult hypertension.

11-beta-Hydroxysteroid Dehydrogenases↗
PubMed1986

Serum osteocalcin in rheumatoid arthritis and other inflammatory arthritides: relation between inflammatory activity and the effect of glucocorticoids and remission inducing drugs.

Osteocalcin, a vitamin K dependent protein synthesised by osteoblasts, was measured in serum by radioimmunoassay in patients with rheumatoid arthritis (n = 36) and seronegative spondyloarthropathies (n = 23). The serum osteocalcin levels were decreased in both patient groups compared with the levels measured in age and sex matched healthy controls. We found no relation between serum osteocalcin and the disease duration or inflammatory activity of the patients who were without drug treatment at the first examination. After administration of glucocorticoids (20 mg prednisolone a day) circulating osteocalcin decreased significantly after one week of treatment. During gradual reduction of the steroid dosage osteocalcin returned to pretreatment values. Treatment with non-steroidal anti-inflammatory drugs (NSAIDs) did not influence circulating osteocalcin. During treatment with chloroquine or penicillamine serum osteocalcin increased significantly, concomitant with a reduction of the acute phase reactants. Controversy persists about the abnormality of bone turnover in rheumatic diseases, but our data suggest that the overall bone turnover is decreased in patients with rheumatoid arthritis and other inflammatory arthritides.

Adrenocorticotropic Hormone↗
PubMed1992

Osteocalcin and its message: relationship to bone histology in magnesium-deprived rats.

These studies examine effects of brief Mg deprivation on bone histomorphometry and on secretion and synthesis of the specific osteoblast product, osteocalcin. Osteocalcin mRNA was determined in calvaria-derived cells and was correlated to circulating concentrations of the protein after 8 days of Mg deprivation. Circulating osteocalcin was decreased in Mg-deprived rats when compared with pair-fed normal rats after 8 days of Mg deprivation, with no significant changes in calcium or 1,25-dihydroxyvitamin D [1,25(OH)2D]. Serial sampling demonstrated a difference in osteocalcin levels by 2 days of Mg deprivation, before any changes in circulating calcium or parathyroid hormone were present. Although circulating osteocalcin is decreased in Mg-deprived animals, levels can be stimulated with 1,25(OH)2D3. Osteocalcin mRNA is reduced after Mg deprivation, suggesting that low circulating levels are due, at least in part, to reduced osteocalcin synthesis. Mg-deprived rats had diminished bone volume and abnormal histological features consistent with disorganized and chaotic bone remodeling. These findings indicate that low-Mg intake during growth can alter the quality and quantity of bone and suggest that Mg deprivation may contribute to the development of osteoporosis.

Animals↗
PubMed2000

Expression of opioid receptors in osteoblast-like MG-63 cells, and effects of different opioid agonists on alkaline phosphatase and osteocalcin secretion by these cells.

We have previously shown that several stressful situations associated with tissue injury determine a decrease in serum osteocalcin concentration. Since reduced osteocalcin production is a marker of decreased osteoblastic activity, this finding could be related to the pathogenesis of osteoporosis secondary to some diseases. Endogenous opioids are involved in stress response. Proenkephalin-derived peptides have been shown to inhibit alkaline phosphatase activity, another marker of bone formation, in the murine cell line ROS-17/2.8. On the other hand, serum osteocalcin has been reported as being low in heroin abusers. We have therefore thought it of interest to study the presence of opioid receptors in the human osteoblast-like cell line MG-63, and to evaluate the effects of different opioid agonists on the secretion of alkaline phosphatase and osteocalcin by these cells. The presence of opioid receptors was studied by means of RT-PCR and immunohistochemistry. RT-PCR studies suggested the presence of specific mRNA for the three types of receptors, and immunohistochemistry clearly showed their occurrence. Osteocalcin synthesis was significantly inhibited by high concentrations of the mu agonists morphine and (D-Ala(2), N-MePhe(4),Gly(5)-ol)-enkephalin although no changes were seen with the delta agonist (D-Ala(2),D-leu(5))-enkephalin. Morphine-induced osteocalcin inhibition was abolished when osteoblastic cells were incubated simultaneously with naloxone, whereas it was potentiated when cells were preincubated with naloxone. None of the opioid agonists modified the secretion of alkaline phosphatase. In conclusion, human osteoblast-like cells MG-63 express the three types of opioid receptors. Endogenous opioids may be involved in the reduction of osteocalcin observed in stressful situations associated with tissue injury.

Alkaline Phosphatase↗
PubMed1986

Multiple immunoreactive forms of osteocalcin in uremic serum.

Circulating osteocalcin, which normally reflects the rate of bone formation, is elevated in uremia. In 18 patients receiving maintenance hemodialysis, serum osteocalcin levels were directly related to the bone formation rate (r = 0.88, P less than 0.001), osteoblastic osteoid surface density (r = 0.65, P less than 0.01), and osteoclastic resorptive surface density (r = 0.75, P less than 0.001). Multiple regression analysis showed that osteocalcin levels remained positively correlated with osteoclastic resorption when the bone formation rate was held constant (P less than 0.01). The intimation that the coupling of bone formation and resorption could not explain the relationship between osteocalcin and resorption led us to determine whether fragments of this abundant matrix protein are released by bone resorption and retained in uremia. Sera from dialysis patients with renal osteodystrophy were fractionated by sequential gel filtration and HPLC, and assayed for immunoreactive osteocalcin. When normal serum was analyzed, a single sharp peak was found. In pooled sera from patients with high osteoclastic resorptive surfaces identified by histomorphometry, we found five additional immunoreactive peaks, while three additional peaks were detected in sera from patients with lower osteoclastic surfaces. Bio-Gel P-10 chromatography showed that these multiple peaks were of lower molecular weight than intact osteocalcin. We suggest that the liberation of bone matrix by osteoclasts contributes to the circulating osteocalcin immunoreactivity in uremia.

Adult↗
PubMed1987

Immunocytochemical localization of osteocalcin in developing rat teeth.

Osteocalcin was purified by gel chromatography from a crude extract obtained after decalcification of rat incisors. The apparent molecular weight, as determined by 5-15% SDS-polyacrylamide gel electrophoresis, was 18,000, and amino acid analysis revealed 60 gamma-carboxyglutamic acid residues per 1000. Antisera against osteocalcin, raised in rabbits, reacted specifically with osteocalcin when investigated by immuno-electroblotting of dentin crude extract. 4-micron cryosections of formaldehyde-fixed tooth germs showed positive immunocytochemical staining for osteocalcin in dentin and odontoblasts. The staining of the mantle dentin at the coronal sides of the tooth germs was more intense than that of the adjacent circumpulpal dentin, while the odontoblasts involved in the formation of mantle dentin showed stronger immunoreactivity than did odontoblasts involved in circumpulpal dentin formation. This marked difference was not observed on the root sides of the tooth germs. In 1-micron cryosections, osteocalcin immunoreactivity was found evenly distributed throughout the entire cell body, with the exception of the Golgi region, which was less intensely stained, while the nucleus and the cell process were negative. The positive staining reaction with anti-osteocalcin antiserum was found in dentin from the very onset of its formation in the fetus. In conclusion, our results demonstrate the presence of osteocalcin in odontoblasts and dentin. Its immunocytochemical localization may be compatible with a distinct role in early dentinogenesis.

Animals↗