Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Amber”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 181 records · Page 10Linked to original sources
PubMed1981

A T7 amber mutant defective in DNA-binding protein.

A T7 amber mutant, UP-2, in the gene for T7 DNA-binding protein was isolated from mutants that could not grow on sup+ ssb-1 bacteria but could grow on glnU ssb-1 and sup+ ssb+ bacteria. The mutant phage synthesized a smaller amber polypeptide (28,000 daltons) than T7 wild-type DNA-binding protein (32,000 daltons). DNA synthesis of the UP-2 mutant in sup+ ssb-1 cells was severely inhibited and the first round of replication was found to be repressed. The abilities for genetic recombination and DNA repair were also low even in permissive hosts compared with those of wild-type phage. Moreover, recombination intermediate T7 DNA molecules were not formed in UP-2 infected nonpermissive cells. The gene that codes for DNA-binding protein is referred to as gene 2.5 since the mutation was mapped between gene 2 and gene 3.

Carrier Proteins↗
PubMed1979

Characterization of an amber suppressor in Pneumococcus.

Partial revertant has been isolated, with resistance to aminopterin intermediate between wild type and mutant. This phenotype is the result of a mutation at a gene unlinked to the amiA locus. This suppressor mutation (su+) has no phenotypic characteristics by itself except a slow growth. 9 amiA mutants (belonging to 6 sites) are affected by su+ out of the 30 investigated mutants (i.e. 22 sites). The efficiency of suppression is site dependent. Two sites out of 14 mutants belonging to the thymidylate synthetase gene are suppressible. Thymidylate synthetase activity is partially restored by su+. Optochin mutants can also be suppressed. Thus su+ is not gene specific but site specific. Moreover when the str-41 allele conferring resistance to streptomycin is introduced by transformation, the suppression effect is restricted. All these properties are characteristic of an informational suppressor. The t-RNA extracted from the suppressor strain su+ but not the wild type restored the synthesis of coat protein coded by RNA from an amber mutant of bacteriophage f2. Attempts to detect ochre suppression activity gave negative results. It is suggested that the su+ gene is amber specific. Thus su+ can provide insight into the nature of suppressible mutations which should be point mutations. Both low efficiency and high efficiency mutants are affected by su+; this is additional evidence that both categories contain point mutations.

Alleles↗
PubMed1981

Effects of reduced amount of RNA polymerase sigma factor on gene expression and growth of Escherichia coli: studies of the rpoD450 (amber) mutation.

A mutant of Escherichia coli K-12 carrying an amber mutation (rpoD40) in the structural gene for RNA polymerase sigma factor and a temperature-sensitive amber suppressor (supF-Ts6) grows virtually normally at 30 degrees C, but does not grow at 42 degrees C due to the inability to synthesize sigma polypeptides (Osawa, T. and Yura, T., Mol Gen Genet 180, 293 - 300, 1980). When the mutant cells are transferred from 30 to 42 degrees C, the cellular amount of sigma relative to total protein is found to decrease from 50% (at 30 degrees C) to 10% of the wild-type level after about 2 h. The decrease of sigma is accompanied by a gradual decrease in RNA and protein syntheses and a sudden loss of viability. At the highest temperature (36 degrees C) that permits steady growth of this mutant, the amount of sigma and the growth rate become 6% and 50 to 60% of the wild type, respectively. These results suggest that the minimum level of sigma required for growth is 0.02 to 0.04 in terms of molar ratio of sigma to core enzyme, that is 6 to 10% of the wild type. Two-dimensional gel electrophoresis of proteins synthesized under the reduced sigma level reveals either markedly increased or decreased syntheses of several polypeptides, while no detectable effect is observed in the majority of polypeptides. Notably, the synthesis of a set of major heat-shock polypeptides is greatly enhances. Hence, the decrease of RNA polymerase holoenzyme relative to the core enzyme seems to affect the synthesis of individual proteins differentially, primarily at the level of transcription. The expression of the groE operon, one of the major heat-inducible operons in E. coli is also studied in some detail.

Escherichia coli↗
PubMed1985

An active variant of the prokaryotic transposable element IS903 carries an amber stop codon in the middle of an open reading frame.

The prokaryotic mobile genetic element IS903.B is an active variant of IS903. It differs from IS903 and IS102 by 34 and 61 nucleotide substitutions, respectively. The large open reading frame (ORFI) which probably encodes the transposase is conserved in all three IS elements, whereas the smaller open reading frame (ORFII), which codes on the opposite DNA strand and entirely overlaps ORFI, contains an amber stop codon past the middle of ORFII in IS903.B. Experiments using Escherichia coli K12 strains permissive or non-permissive for amber mutations revealed no difference in the cointegration frequency mediated by IS903.B. Therefore, a possible peptide encoded by ORFII on the IS903-related element is unlikely to be necessary for transposition.

Base Sequence↗
PubMed1989

The naturally occurring silent invertase structural gene suc2 zero contains an amber stop codon that is occasionally read through.

The yeast invertase structural gene SUC2 has two naturally occurring alleles, the active one and a silent allele called suc2 zero. Strains carrying suc2 zero are unable to ferment sucrose and do not show detectable invertase activity. We have isolated suc2 zero and found an amber codon at position 232 of 532 amino acids. However, transformants carrying suc2 zero on a multicopy plasmid were able to ferment sucrose and showed detectable invertase activity. Full-length invertase was found in gels stained for active invertase and in immunoblots. Therefore we concluded that the amber codon is occasionally read as an amino acid. The calculated frequency of read-through is about 4% of all translation events.

Alleles↗
PubMed1983

An amber replication mutant of F plasmid mapped in the minimal replication region.

We have constructed a mini-F derivative (pKP1013) consisting of a 5.4 kilobase pairs (kb) segment (44.0 to 49.4 kb) of mini-F and fragments carrying the chloramphenicol and spectinomycin resistance genes that originated from the R plasmid NR1. The plasmid pKP1013 replicates autonomously in a manner indistinguishable from that of the parental mini-F. An amber mutant defective in replication has been isolated from pKP1013 by localized mutagenesis using N-methyl-N'-nitro-N-nitrosoguanidine. The virtual absence of incorporation of [3H]-thymidine into the plasmid DNA as well as the kinetics of appearance of plasmid-free segregants suggest that plasmid DNA synthesis is primarily affected under nonpermissive conditions. The amber mutation has been mapped within the 530 base pairs (bp) region that extends from 45.25 (XmaI) to 45.78 Kb (PstI) by extensive analysis of in vitro recombinants constructed from rep+ and rep- plasmids.

Chromosome Mapping↗
PubMed1984

DNA sequence of an amber replication mutant indicates that a 29 kd protein is the product of the F plasmid replication gene.

DNA sequencing shows that the mutational alteration resulting from an amber-suppressible replication-defective mutation of F plasmid is a single base pair change from C:G to T:A which yields an amber codon in the coding frame for a 29 kd polypeptide located in the minimal replication region. We thus identified the gene indispensable for F DNA replication as the coding frame which encodes a 29 kd polypeptide. We will designate this gene repA.

Base Sequence↗
PubMed1977

Identification of an amber fragment of the beta subunit of Escherichia coli RNA polymerase: a yardstick for measuring controls on RNA polymerase subunit synthesis.

An amber fragment of the beta subunit of Escherichia coli RNA polymerase has been recovered from strains carrying the rpoB12 amber mutation, indicating that the B12 mutation resides in the structural gene for the beta subunit. The fragment is readily assayed and can be used to determine the degree of expression of a single rpoB cistron in strains haploid or diploid for this region. These studies confirm that the bacterial mechanism, which can compensate for reduced translation of the beta message, operates by the co-ordinate induction of rpoB and rpoC. Furthermore, I show that rpo control depends upon cistron(s) located on the F' factor, KLF10, whose product(s) can act negatively in trans on rpoBC expression.

DNA-Directed RNA Polymerases↗
PubMed2005

AMBER force-field parameters for phosphorylated amino acids in different protonation states: phosphoserine, phosphothreonine, phosphotyrosine, and phosphohistidine.

We report a consistent set of AMBER force-field parameters for the most common phosphorylated amino acids, phosphoserine, phosphothreonine, phosphotyrosine, and phosphohistidine in different protonation states. The calculation of atomic charges followed the original restrained electrostatic potential fitting procedure used to determine the charges for the parm94/99 parameter set, taking alpha-helical and beta-strand conformations of the corresponding ACE-/NME-capped model peptide backbone into account. Missing force-field parameters were taken directly from the general AMBER force field (gaff) and the parm99 data set with minor modifications, or were newly generated based on ab initio calculations for model systems. Final parameters were validated by geometry optimizations and molecular-dynamics simulations. Template libraries for the phosphorylated amino acids in Leap format and corresponding frcmod parameter files are made available. [Figure: see text].

Acids↗
PubMed1985

Two modes of amber codon read-through in vitro.

Read-through translation of bacteriophage R17 amB2 coat cistron carrying an amber mutation at the seventh codon was studied in vitro using the crude cell extract (S30) derived from an Escherichia coli nonsuppressor strain. Despite the presence of termination factors as well as ribosome-releasing factor (RRF) which prevent the read-through translation [M. Ryoji, J. W. Karpen, and A. Kaji (1981) J. Biol. Chem. 256, 5798-5801], synthesis of coat-like protein still persists at a low level in this system. Characterization of this protein by peptide fingerprinting and amino acid sequencing was performed to reexamine the generally accepted notion that it is produced by amino acid misinsertion to the amber mutation codon. The results indicated, however, that the major population of this coat-like protein is produced as a result of reinitiation of translation from the eighth codon. Read-through by amino acid misinsertion in this system becomes predominant only when the Mg2+ concentration is higher than 16 mM.

Cell-Free System↗
PubMed1986

Normal yeast tRNA(CAGGln) can suppress amber codons and is encoded by an essential gene.

We have isolated a gene that can encode yeast tRNA(CAGGln). When present on a multicopy plasmid, this gene suppresses the phenotype of a number of amber mutants, but has no effect on the ocher mutants tested. We therefore conclude that the anticodon CUG in tRNA(CAGGln) can decode the amber codon UAG by G-U mispairing, possibly by wobble base-pairing in the first codon position. This represents the second example we have observed in this laboratory of nonsense suppression in yeast by natural tRNA(Gln), involving G-U mispairing in the first codon position. Replacing the genomic copy of the cloned gene with a disrupted tRNA gene results in recessive lethality in heterozygous diploids and is lethal to haploid cells. This lethality can be rescued by transformation of cells with a single copy plasmid containing the tRNA(CAGGln) gene. Thus, the gene encoding tRNA(CAGGln) is apparently essential for viability in yeast, suggesting that it is normally present as a single copy gene.

Animals↗
PubMed1985

Morphogenetic structures present in lysates of amber mutants of bacteriophage Mu.

The Mu phage particle is structurally similar to that of the T-even phages, consisting of an icosahedral head and contractile tail. This study continues an analysis of the morphogenesis of the Mu phage particle by defining the structural defects resulting from mutations in specific Mu genes. Defective lysates produced by induction of 55 amber mutants, representing 24 essential genes, were examined in the electron microscope and categorized into eight classes based on the observed phage-related structures. (1) Mutations in genes lys, F and G, and some H mutations, did not cause a visible alteration in particle structure. (2) Mutants defective in genes A, B, and C produced no detectable phage structures, consistent with their lack of production of late RNA. (3) Extracts defective in genes L, M, Y, N, P, Q, V, W, and R contained only head structures, and these appeared normal. (4) K-defective mutants accumulated free heads as well as free tails which were longer than normal and variable in length. (5) Tails which appeared normal were the only structures found in T- and some I-defective extracts. (6) Free tails and empty heads accumulated in D-, E-, and some I- and H-defective extracts. These heads were as much as 16% smaller than normal heads. The heads found in some I amber lysates had a protruding neck-like structure and unusually thick shells suggestive of a scaffolding-like structure. (7) Defects in gene J resulted in the accumulation of unattached tails and full heads. (8) Previous analysis of lysates produced by inversion-defective gin mutants fixed in the G(+) orientation demonstrated that S and U mutants produced particles lacking tail fibers (F.J. Grundy and M.M. Howe (1984), Virology 134, 296-317). In these experiments with Gin+ phages S and U mutants produced apparently normal phage particles. Presumably the tail fiber defects were masked by the production of S' and U' proteins by G(-) phages in the population.

Chromosome Deletion↗
PubMed1989

Effect of an amber mutation in the herpes simplex virus thymidine kinase gene on polypeptide synthesis and stability.

KG111 is a mutant of herpes simplex virus (HSV), strain KOS, that exhibits temperature-dependent drug resistance. For example, it is almost as resistant as a thymidine kinase (tk)-deficient virus at 39 degrees, but is relatively sensitive to acyclovir at 34 degrees, Using marker transfer techniques, we have mapped the mutation conferring temperature-dependent drug resistance in KG111 to the 5' portion of the tk gene. Sequencing of this region revealed an amber mutation at codon 44, which lies between the first and second methionine codons of the tk polypeptide. This mutation is identical to that found in TK4, an HSV mutant derived from Cl 101 (L. Haarr et al., 1985, J. Virol. 56, 512-519). Analyses of immunoprecipitated tk proteins from KG111- and TK4-infected cells showed that KG111 and TK4 do not synthesize full-length tk polypeptides, but instead produce a truncated form of the protein. Small amounts of a similar truncated tk polypeptide are also produced in wild-type-infected cells and are thought to arise from initiation at a downstream AUG. The relative amounts and size of the mutant tk proteins compared with those of the wild-type are consistent with the amber mutation eliminating translation of full-length polypeptide and causing a four- to fivefold increase in the utilization of downstream AUG codons for initiation. The truncated polypeptides specified by KG111 and TK4 are less stable than the full-length polypeptide at 39 degrees, which may contribute to the conditional drug-resistant phenotype. On the other hand, the truncated polypeptides normally expressed by wild-type virus at low levels and the more highly expressed truncated tk polypeptides from a deletion mutant are relatively stable at 39 degrees. These results suggest that stability of the truncated tk polypeptide is influenced by the amount of tk present.

Animals↗
PubMed1995

Neutrophil priming: the cellular signals that say 'amber' but not 'green'.

One of the most intriguing gaps in our understanding of how neutrophils work concerns the mechanism by which the oxidase response in these cells is 'primed'. In the primed state, there is no increase in oxidase activity, yet subsequent stimulation provokes a response that is larger than in nonprimed, activated cells. Thus, neutrophils exist in one of three states: quiescent, primed or active. Individual primed cells may be thought of as being 'ready to go' but awaiting further stimulus before the oxidase response is elicited. The primed neutrophils are thus held at 'amber', awaiting 'green' before activity is triggered. Here, Maurice Hallett and Darren Lloyds suggest a molecular basis for the signals that say 'amber' but not 'green'.

Amino Acid Sequence↗
PubMed1993

Temperature-sensitive amber suppression of ompF'-'lacZ fused gene expression in a supE mutant of Escherichia coli K12.

In an ompF'-'lacZ fusion system carried by the open reading frame vector pORF1 in a supE mutant of Escherichia coli K12, read-through of an amber codon was decreased at temperatures higher than 40 degrees C. This effect of temperature was dependent on the nucleotide sequence surrounding the amber codon, which was inserted into a site between the ompF and lacZ cistrons. Upon a temperature shift-up from 30 to 42 degrees C, beta-galactosidase synthesis directed by this fusion showed a transient arrest.

Bacterial Outer Membrane Proteins↗
PubMed1984

The yeast cloning vector YEp13 contains a tRNALeu3 gene that can mutate to an amber suppressor.

We have shown that the yeast-Escherichia coli shuttle vector YEp13 contains, as part of its yeast chromosomal segment, a tRNALeu3 gene. We have also isolated and characterized a variant of YEp13 , namely YEp13 -a, which is capable of suppressing a variety of yeast amber-suppressible alleles in vivo. YEp13 -a differs from YEp13 by a single point mutation, which changes the three-nucleotide, plus-strand sequence corresponding to the tRNALeu3 anticodon from the normal C-A-A to C-T-A. This nucleotide change creates a site for the restriction enzyme XbaI in the suppressor tRNALeu3 gene. We have taken advantage of the correlation between the suppressor mutation and the XbaI site formation, to show that the tRNALeu3 gene on YEp13 corresponds to the genetically characterized yeast chromosomal amber suppressor SUP53 . We have also shown that SUP53 is located just centromere-distal to LEU2 on chromosome III. Finally, comparison of the DNA sequence of SUP53 and its flanking regions with the sequences of other cloned yeast tRNALeu3 genes has revealed considerable sequence homology in the immediate 5'-flanking regions of these genes.

Base Sequence↗
PubMed1986

First position wobble in codon-anticodon pairing: amber suppression by a yeast glutamine tRNA.

A 2.4-kb fragment of DNA isolated from the Saccharomyces cerevisiae genome was found to suppress amber mutations when its carrier plasmid was present in high copy number. A 1.2-kb subclone of this fragment was sufficient to confer suppressor activity. Sequencing has established that this fragment carries a normal glutamine tRNA gene. Deletion of this tRNA gene from the subclone resulted in the loss of suppressor activity. The tRNAGln has the anticodon CUG that normally recognizes the glutamine codon CAG. We propose that suppression occurs via an inefficient readthrough of the UAG amber stop codons during translation. Such readthrough requires wobble in the first position of the codon.

Anticodon↗
PubMed1995

An oligodeoxyribonucleotide-directed dual amber method for site-directed mutagenesis.

A simple procedure for in vitro site-directed mutagenesis (SDM) was developed using two oligodeoxyribonucleotide (oligo) primers, one serving as selection primer and the other for mutagenesis in the target DNA (mutagenic primer). The mutant clones can be selected by reversion mutations of dual amber (am) to dual Gln codons in the cat gene, resulting in a chloramphenicol-resistant phenotype in sup(O) host cells. Unlike previously reported procedures, the new method requires neither special chemical reagents, nor single-stranded DNA purification, nor any additional biochemical treatments such as multiple PCRs, restriction digestion and so on, but utilises one of the oligo-directed dual am (ODA) plasmids, i.e., pKF16c, pKF17c, pKF18c or pKF19c. The two amber (am) mutations located two codons apart from each other in cat (catam2) can be simultaneously reverted with a 20-nucleotide primer (CQ, pAACCAGACCGTTCAGCTGGA) during primer extension. In a model experiment using the lacZ' gene, an am mutation or a single-bp deletion (sbd) mutation was frequently co-introduced in lacZ' using a mixture of am- or sbd-encoding mutagenic primer for lacZ', and the CQ primer for catam2. Applying this procedure to the human AT cDNA (encoding antithrombin), a missense mutation (Arg406-->Met) in one of the human AT variants, AT-Kyoto, involved in congenital thrombosis disease, was introduced efficiently into the wild-type cDNA (> 85%).

Base Sequence↗