Search PubMed⌕ Search

PubMed · 14681367

Aptamer database.

Abstract

The aptamer database is designed to contain comprehensive sequence information on aptamers and unnatural ribozymes that have been generated by in vitro selection methods. Such data are not normally collected in 'natural' sequence databases, such as GenBank. Besides serving as a storehouse of sequences that may have diagnostic or therapeutic utility, the database serves as a valuable resource for theoretical biologists who describe and explore fitness landscapes. The database is updated monthly and is publicly available at http://aptamer. icmb.utexas.edu/.

Explore related subjects

Keep this discovery

Explore connections, maps & timelines

BibTeXRIS

Jennifer F Lee, Jay R Hesselberth, Lauren Ancel Meyers, Andrew D Ellington. 2004-01-01. Aptamer database.. https://doi.org/10.1093/nar%2Fgkh094

Cite the original work for its findings. Save a collection to share your selection of sources.

KEEP EXPLORING

Related citations

Application of mutated miR-206 target sites enables skeletal muscle-specific silencing of transgene expression of cardiotropic AAV9 vectors.

Insertion of completely complementary microRNA (miR) target sites (miRTS) into a transgene has been shown to be a valuable approach to specifically repress transgene expression in non-targeted tissues. miR-122TS have been successfully used to silence transgene expression in the liver following systemic application of cardiotropic adeno-associated virus (AAV) 9 vectors. For miR-206-mediated skeletal muscle-specific silencing of miR-206TS-bearing AAV9 vectors, however, we found this approach failed due to the expression of another member (miR-1) of the same miR family in heart tissue, the intended target. We introduced single-nucleotide substitutions into the miR-206TS and searched for those which prevented miR-1-mediated cardiac repression. Several mutated miR-206TS (m206TS), in particular m206TS-3G, were resistant to miR-1, but remained fully sensitive to miR-206. All these variants had mismatches in the seed region of the miR/m206TS duplex in common. Furthermore, we found that some m206TS, containing mismatches within the seed region or within the 3' portion of the miR-206, even enhanced the miR-206- mediated transgene repression. In vivo expression of m206TS-3G- and miR-122TS-containing transgene of systemically applied AAV9 vectors was strongly repressed in both skeletal muscle and the liver but remained high in the heart. Thus, site-directed mutagenesis of miRTS provides a new strategy to differentiate transgene de-targeting of related miRs.

Base Pairing↗

Site-resolved stabilization of a DNA triple helix by magnesium ions.

Proton exchange and NMR spectroscopy have been used to define the effects of Mg2+ ions upon the stability of individual base pairs in the intramolecular parallel triple helix formed by the DNA oligonucleotide d(GAAGAGGTTTTTCCTCTTCTTTTTCTTCTCC). The rates of exchange of individual Watson-Crick and Hoogsteen imino protons in the DNA triple helix were measured in the absence and in the presence of Mg2+ ions. The results reveal that Mg2+ lowers the exchange rates of most imino protons in the structure by stabilizing the corresponding base pairs in their native closed conformation. Comparison of the DNA triple helix containing Na+ counterions to the same helix containing Mg2+ counterions shows that these stabilizing effects result, in large part, from Mg2+ ions closely associated with the DNA. Moreover, the effects are site-specific and depend on the number and location of protonated cytosines relative to the observed base. These findings provide new insights into the molecular roles of C+*GC triads in determining the stability of DNA triple-helical structures.

Base Pairing↗