Biomedical subjects

Yuetsu Tanaka

Publications and source records attributed to Yuetsu Tanaka.

At least 55 records · Page 3Linked to original sources

PubMed2004

Human T cell lymphotropic virus type I (HTLV-I)-specific CD4+ T cells: immunodominance hierarchy and preferential infection with HTLV-I.

CD4(+) T cells predominate in early lesions in the CNS in the inflammatory disease human lymphotropic T cell virus type I (HTLV-I)-associated myelopathy/tropical spastic paraparesis (HAM/TSP), but the pathogenesis of the disease remains unclear and the HTLV-I-specific CD4(+) T cell response has been little studied. We quantified the IFN-gamma-producing HTLV-I-specific CD4(+) T cells, in patients with HAM/TSP and in asymptomatic carriers with high proviral load, to test two hypotheses: that HAM/TSP patients and asymptomatic HTLV-I carriers with a similar proviral load differ in the immunodominance hierarchy or the total frequency of specific CD4(+) T cells, and that HTLV-I-specific CD4(+) T cells are preferentially infected with HTLV-I. The strongest CD4(+) T cell response in both HAM/TSP patients and asymptomatic carriers was specific to Env. This contrasts with the immunodominance of Tax in the HTLV-I-specific CD8(+) T cell response. The median frequency of HTLV-I-specific IFN-gamma(+) CD4(+) T cells was 25-fold greater in patients with HAM/TSP (p = 0.0023, Mann-Whitney) than in asymptomatic HTLV-I carriers with a similar proviral load. Furthermore, the frequency of CD4(+) T cells infected with HTLV-I (expressing Tax protein) was significantly greater (p = 0.0152, Mann-Whitney) among HTLV-I-specific cells than CMV-specific cells. These data were confirmed by quantitative PCR for HTLV-I DNA. We conclude that the high frequency of specific CD4(+) T cells was associated with the disease HAM/TSP, and did not simply reflect the higher proviral load that is usually found in HAM/TSP patients. Finally, we conclude that HTLV-I-specific CD4(+) T cells are preferentially infected with HTLV-I.

Amino Acid Sequence↗

PubMed2004

PDZ domain-binding motif of human T-cell leukemia virus type 1 Tax oncoprotein augments the transforming activity in a rat fibroblast cell line.

While human T-cell leukemia virus type 1 (HTLV-1) is associated with the development of adult T-cell leukemia (ATL), HTLV-2 has not been reported to be associated with such malignant leukemias. HTLV-1 Tax1 oncoprotein transforms a rat fibroblast cell line (Rat-1) to form multiple large colonies in soft agar, and this activity is much greater than that of HTLV-2 Tax2. We have demonstrated here that the increased number of transformed colonies induced by Tax1 relative to Tax2 was mediated by a PDZ domain-binding motif (PBM) in Tax1, which is absent in Tax2. Tax1 PBM mediated the interaction of Tax1 with the discs large (Dlg) tumor suppressor containing PDZ domains, and the interaction correlated well with the transforming activities of Tax1 and the mutants. Through this interaction, Tax1 altered the subcellular localization of Dlg from the detergent-soluble to the detergent-insoluble fraction in a fibroblast cell line as well as in HTLV-1-infected T-cell lines. These results suggest that the interaction of Tax1 with PDZ domain protein(s) is critically involved in the transforming activity of Tax1, the activity of which may be a crucial factor in malignant transformation of HTLV-1-infected cells in vivo.

Adaptor Proteins, Signal Transducing↗

PubMed2004

Regulation of human T-cell leukemia virus type 1 (HTLV-1) budding by ubiquitin ligase Nedd4.

The Gag protein of human T-cell leukemia virus type 1 (HTLV-1) contains the conserved sequences PPxY and PTAP, which are putative viral motifs required for budding (L-domain motifs). We show here that the PPxY motif, but not the PTAP motif, is essential for HTLV-1 virion budding from the plasma membrane. In addition, we show that overexpression of Nedd4 enhances HTLV-1 budding and that Nedd4 interacts with Gag via its WW domain. The HECT domain of Nedd4 is also required for budding. These results indicate that Nedd4 or a Nedd4-related ubiquitin ligase plays a critical role in HTLV-1 budding.

Amino Acid Motifs↗

PubMed2004

Hematopoietic progenitor cells as possible origins of epithelial thymoma in a human T lymphocyte virus type I pX gene transgenic rat model.

We earlier reported that Fischer 344/jcl strain (F344) rats carrying a unique pX gene of human T lymphocyte virus type I (HTLV-I) under control of a rat lymphocyte-specific protein tyrosine kinase (p56lck) type I promoter (lck-pX rats) spontaneously developed epithelial thymomas from the thymic medulla. To investigate the role of bone marrow cells carrying the HTLV-I pX gene in development of thymomas, the bone marrow of normal F344 rats after lethal irradiation was reconstituted by bone marrow mononuclear cells (BMMC) of lck-pX rats. Epithelial thymomas similar to the original thymoma of lck-pX rats frequently developed in the nontransgenic recipients within 5 months after the BMMC transplantation. The thymomas expressed the pX gene, thereby indicating the thymoma cells to be of donor BMMC origin. Since the thymoma also developed in nontransgenic recipients reconstituted by BMMC depleted of adherent cells, it is suggested that nonadherent BMMC of donor lck-pX rats may migrate to and lodge in the thymus of recipient nontransgenic rats then transform into thymoma cells with epithelial characteristics. The thymoma cells were shown to bind to Ulex europaeus Agglutinin-1 (UEA-1) lectin, which binds epithelial cells in the thymic medulla. It was also shown that the nonadherent BMMC fraction used for bone marrow reconstitution contained a number of UEA-1-positive cells. Taken together, UEA-1 positive BMMC may be progenitor cells of the epithelial thymoma. The epithelial thymoma in lck-pX rats sheds light on epithelial cell development in thymic medulla and for oncogenesis of epithelial thymoma in humans.

Animals↗

PubMed2004

Regulation of human immunodeficiency virus type 1 Env-mediated membrane fusion by viral protease activity.

We and others have presented evidence for a direct interaction between the matrix (MA) domain of the human immunodeficiency virus type 1 (HIV-1) Gag protein and the cytoplasmic tail of the transmembrane envelope (Env) glycoprotein gp41. In addition, it has been postulated that the MA domain of Gag undergoes a conformational change following Gag processing, and the cytoplasmic tail of gp41 has been shown to modulate Env-mediated membrane fusion activity. Together, these results raise the possibility that the interaction between the gp41 cytoplasmic tail and MA is regulated by protease (PR)-mediated Gag processing, perhaps affecting Env function. To examine whether Gag processing affects Env-mediated fusion, we compared the ability of wild-type (WT) HIV-1 Env and a mutant lacking the gp41 cytoplasmic tail to induce fusion in the context of an active (PR(+)) or inactive (PR(-)) viral PR. We observed that PR(-) virions bearing WT Env displayed defects in cell-cell fusion. Impaired fusion did not appear to be due to differences in the levels of virion-associated Env, in CD4-dependent binding to target cells, or in the formation of the CD4-induced gp41 six-helix bundle. Interestingly, truncation of the gp41 cytoplasmic tail reversed the fusion defect. These results suggest that interactions between unprocessed Gag and the gp41 cytoplasmic tail suppress fusion.

Cell Fusion↗

PubMed2004

Repression of tax expression is associated both with resistance of human T-cell leukemia virus type 1-infected T cells to killing by tax-specific cytotoxic T lymphocytes and with impaired tumorigenicity in a rat model.

Human T-cell leukemia virus type 1 (HTLV-1) causes adult T-cell leukemia (ATL). Although the viral transactivation factor, Tax, has been known to have apparent transforming ability, the exact function of Tax in ATL development is still not clear. To understand the role of Tax in ATL development, we introduced short-interfering RNAs (siRNAs) against Tax in a rat HTLV-1-infected T-cell line. Our results demonstrated that expression of siRNA targeting Tax successfully downregulated Tax expression. Repression of Tax expression was associated with resistance of the HTLV-1-infected T cells to Tax-specific cytotoxic-T-lymphocyte killing. This may be due to the direct effect of decreased Tax expression, because the Tax siRNA did not alter the expression of MHC-I, CD80, or CD86. Furthermore, T cells with Tax downregulation appeared to lose the ability to develop tumors in T-cell-deficient nude rats, in which the parental HTLV-1-infected cells induce ATL-like lymphoproliferative disease. These results indicated the importance of Tax both for activating host immune response against the virus and for maintaining the growth ability of infected cells in vivo. Our results provide insights into the mechanisms how the host immune system can survey and inhibit the growth of HTLV-1-infected cells during the long latent period before the onset of ATL.

Animals↗

PubMed2004

Apoptosis induced by the histone deacetylase inhibitor FR901228 in human T-cell leukemia virus type 1-infected T-cell lines and primary adult T-cell leukemia cells.

Inhibition of histone deacetylase (HDAC) activity induces growth arrest, differentiation, and, in certain cell types, apoptosis. FR901228, FK228, or depsipeptide, is an HDAC inhibitor effective in T-cell lymphomas. Adult T-cell leukemia (ATL) is caused by human T-cell leukemia virus type 1 (HTLV-1) and remains incurable. We examined whether FR901228 is effective for treatment of ATL by assessing its ability to induce apoptosis of HTLV-1-infected T-cell lines and primary leukemic cells from ATL patients. FR901228 induced apoptosis of Tax-expressing and -unexpressing HTLV-1-infected T-cell lines and selective apoptosis of primary ATL cells, especially those of patients with acute ATL. FR901228 also efficiently reduced the DNA binding of NF-kappaB and AP-1 in HTLV-1-infected T-cell lines and primary ATL cells and down-regulated the expression of Bcl-x(L) and cyclin D2, regulated by NF-kappaB. Although the viral protein Tax is an activator of NF-kappaB and AP-1, FR901228-induced apoptosis was not associated with reduced expression of Tax. In vivo use of FR901228 partly inhibited the growth of tumors of HTLV-1-infected T cells transplanted subcutaneously in SCID mice. Our results indicated that FR901228 could induce apoptosis of these cells and suppress the expression of NF-kappaB and AP-1 and suggest that FR901228 could be therapeutically effective in ATL.

Adult↗

PubMed2003

A duodenally absorbable CXC chemokine receptor 4 antagonist, KRH-1636, exhibits a potent and selective anti-HIV-1 activity.

A low molecular weight nonpeptide compound, KRH-1636, efficiently blocked replication of various T cell line-tropic (X4) HIV type 1 (HIV-1) in MT-4 cells and peripheral blood mononuclear cells through the inhibition of viral entry and membrane fusion via the CXC chemokine receptor (CXCR)4 coreceptor but not via CC chemokine receptor 5. It also inhibited binding of the CXC chemokine, stromal cell-derived factor 1alpha, to CXCR4 specifically and subsequent signal transduction. KRH-1636 prevented monoclonal antibodies from binding to CXCR4 without down-modulation of the coreceptor. The inhibitory effect against X4 viral replication by KRH-1636 was clearly reproduced in the human peripheral blood lymphocytesevere combined immunodeficiency mouse system. Furthermore, this compound was absorbed into the blood after intraduodenal administration as judged by anti-HIV-1 activity and liquid chromatography MS in the plasma. Thus, KRH-1636 seems to be a promising agent for the treatment of HIV-1 infection.

Animals↗

PubMed2003

Different cytokine production in tax-expressing cells between patients with human T cell lymphotropic virus type I (HTLV-I)-associated myelopathy/tropical spastic paraparesis and asymptomatic HTLV-I carriers.

Human T cell lymphotropic virus type I (HTLV-I) provirus load has been reported to be generally higher in patients with HTLV-I-associated myelopathy/tropical spastic paraparesis (HAM/TSP) than in asymptomatic HTLV-I carriers (ACs). However, some ACs have a high HTLV-I provirus load comparable with that in patients with HAM/TSP. To examine whether other factors influence the outcome of HTLV-I infection in patients with HAM/TSP and ACs, we analyzed spontaneous Tax expression and cytokine production in peripheral blood mononuclear cells using flow cytometry. The Tax expression in HTLV-I-infected cells (percentage of Tax expressing cells/HTLV-I provirus load when assumed 1 copy/cell) and the intensity of Tax expression did not differ between these 2 groups. However, the production of interferon-gamma and tumor necrosis factor-alpha in Tax-expressing cells was significantly lower in ACs with high HTLV-I provirus load than in patients with HAM/TSP. This result suggests that the production of inflammatory cytokines in Tax-expressing cells is one of the factors that contribute to the development of HAM/TSP.

Adult↗

PubMed2003

Spread of HTLV-I between lymphocytes by virus-induced polarization of the cytoskeleton.

Cell contact is required for efficient transmission of human T cell leukemia virus- type 1 (HTLV-I) between cells and between individuals, because naturally infected lymphocytes produce virtually no cell-free infectious HTLV-I particles. However, the mechanism of cell-to-cell spread of HTLV-I is not understood. We show here that cell contact rapidly induces polarization of the cytoskeleton of the infected cell to the cell-cell junction. HTLV-I core (Gag protein) complexes and the HTLV-I genome accumulate at the cell-cell junction and are then transferred to the uninfected cell. Other lymphotropic viruses, such as HIV-1, may similarly subvert normal T cell physiology to allow efficient propagation between cells.

CD4-Positive T-Lymphocytes↗

PubMed2003

Low frequency of CD94/NKG2A+ T lymphocytes in patients with HTLV-1-associated myelopathy/tropical spastic paraparesis, but not in asymptomatic carriers.

Human natural killer (NK)-cell receptors are expressed by NK cells and some T cells, primarily TCR+CD8+ cytotoxic T lymphocytes (CTLs). Inhibitory NK cell receptors (iNKRs) can down-regulate antigen-mediated T-cell effector functions, including cytotoxic activity and cytokine release. In the present study we demonstrate that CD3+ T cells that bind tetramers of HLA-E and express its ligand, the NK-cell inhibitory receptor CD94/NKG2A, were significantly decreased in frequency in patients with human T-cell lymphotropic virus 1 (HTLV-1)-associated myelopathy/tropical spastic paraparesis (HAM/TSP) but not in asymptomatic HTLV-1 carriers. These cells were either alphabeta or gammadelta T cells. T-cell receptor (TCR) Vbeta-specific reverse transcription-polymerase chain reaction and spectratyping analysis revealed that the TCR repertoire in directly isolated HLA-E tetramer-positive cells from peripheral blood mononuclear cells was skewed in both HTLV-1-infected and healthy individuals. However, oligoclonally or monoclonally expanded levels of TCR Vbetawere more frequently detected within HTLV-1-infected individuals than healthy controls. Importantly, HLA-E tetramer-positive or NKG2A+ T cells from HTLV-1 patients do not express Tax and display different TCR usage from the immunodominant Tax11-19-specific CD8+ T cells, suggesting that they do not encounter HTLV-1-infected cells. The expression of NK cell-associated receptors by clonally expanded CD8+ T cells during chronic viral infection suggests that these receptors play a role in regulating CD8+ T cell-mediated antiviral immune responses and that a decrease of this cell subset results in an increased risk of inflammatory diseases such as HAM/TSP.

Antigens, CD↗

PubMed2003

Capsaicin inhibits growth of adult T-cell leukemia cells.

Human T-cell leukemia virus type 1 (HTLV-1)-associated adult T-cell leukemia (ATL) is resistant to conventional chemotherapy. We examined the in vitro effects of capsaicin, the principal ingredients of red pepper, on three ATL cell lines. Capsaicin treatment inhibited the growth of ATL cells both in dose- and time-dependent manner. The inhibitory effect was mainly due to the induction of cell cycle arrest and apoptosis. Capsaicin treatment also induced the degradation of Tax and up-regulation of I kappa-B alpha, resulting in the decrease of nuclear factor (NF)-kappa B/p65 DNA binding activity. In addition, the Bcl-2 level was found to be decreased. Based on these findings, capsaicin may be considered for chemoprevention of ATL.

Apoptosis↗

PubMed2003

Induction of protective immune responses against R5 human immunodeficiency virus type 1 (HIV-1) infection in hu-PBL-SCID mice by intrasplenic immunization with HIV-1-pulsed dendritic cells: possible involvement of a novel factor of human CD4(+) T-cell origin.

The potential of a dendritic cell (DC)-based vaccine against human immunodeficiency virus type 1 (HIV-1) infection in humans was explored with SCID mice reconstituted with human peripheral blood mononuclear cells (PBMC). HIV-1-negative normal human PBMC were transplanted directly into the spleens of SCID mice (hu-PBL-SCID-spl mice) together with autologous mature DCs pulsed with either inactivated HIV-1 (strain R5 or X4) or ovalbumin (OVA), followed by a booster injection 5 days later with autologous DCs pulsed with the same respective antigens. Five days later, these mice were challenged intraperitoneally with R5 HIV-1(JR-CSF). Analysis of infection at 7 days postinfection showed that the DC-HIV-1-immunized hu-PBL-SCID-spl mice, irrespective of the HIV-1 isolate used for immunization, were protected against HIV-1 infection. In contrast, none of the DC-OVA-immunized mice were protected. Sera from the DC-HIV-1- but not the DC-OVA-immunized mice inhibited the in vitro infection of activated PBMC and macrophages with R5, but not X4, HIV-1. Upon restimulation with HIV-1 in vitro, the human CD4(+) T cells derived from the DC-HIV-1-immunized mice produced a similar R5 HIV-1 suppressor factor. Neutralizing antibodies against human RANTES, MIP-1alpha, MIP-1beta, alpha interferon (IFN-alpha), IFN-beta, IFN-gamma, interleukin-4 (IL-4), IL-10, IL-13, IL-16, MCP-1, MCP-3, tumor necrosis factor alpha (TNF-alpha), or TNF-beta failed to reverse the HIV-1-suppressive activity. These results show that inactivated HIV-1-pulsed autologous DCs can stimulate splenic resident human CD4(+) T cells in hu-PBL-SCID-spl mice to produce a yet-to-be-defined, novel soluble factor(s) with protective properties against R5 HIV-1 infection.

AIDS Vaccines↗

PubMed2003

SR-related protein TAXREB803/SRL300 is an important cellular factor for the transactivational function of human T-cell lymphotropic virus type 1 Tax.

Expression of the human T-cell lymphotropic virus type 1 (HTLV-1) genes is transcriptionally activated by the cognate oncoprotein Tax which enhances the binding of the cyclin AMP-responsive element binding protein (CREB) to the Tax responsive element (TxRE) located in its long terminal repeat (LTR). TxRE is highly homologous to the cyclic AMP-responsive element (CRE) except for the GC-rich sequence flanking the CRE. We cloned the cDNA for a cellular factor, TAXREB803, of which the DNA-binding domain bound to TxRE and the binding was dependent on the 3' GC-rich sequence in TxRE. TAXREB803 is an SR-related protein composed of 2,752 amino acids including numerous arginine/serine (RS) motifs. TAXREB803 enhanced both the Tax dependent transcription and the CREB binding to TxRE in cooperation with Tax. The interaction of TAXREB803 and Tax was detected by coimmunoprecipitation assays as well as by indirect immunofluorescence assays. Significantly, Tax transactivation for the HTLV-1 LTR decreased dramatically when the expression level of the endogenous TAXREB803 was suppressed by the small interfering RNA. These results suggest that TAXREB803 functions as a transcriptional coactivator for Tax and plays a critical role in the expression of HTLV-1 genes.

Animals↗

PubMed2003

Rapid tumor formation of human T-cell leukemia virus type 1-infected cell lines in novel NOD-SCID/gammac(null) mice: suppression by an inhibitor against NF-kappaB.

We established a novel experimental model for human T-cell leukemia virus type 1 (HTLV-1)-induced tumor using NOD-SCID/gammac(null) (NOG) mice. This model is very useful for investigating the mechanism of tumorigenesis and malignant cell growth of adult T-cell leukemia (ATL)/lymphoma, which still remains unclear. Nine HTLV-1-infected cell lines were inoculated subcutaneously in the postauricular region of NOG mice. As early as 2 to 3 weeks after inoculation, seven cell lines produced a visible tumor while two transformed cell lines failed to do so. Five of seven lines produced a progressively growing large tumor with leukemic infiltration of the cells in various organs that eventually killed the animals. Leukemic cell lines formed soft tumors, whereas some transformed cell lines developed into hemorrhagic hard tumors in NOG mice. One of the leukemic cell lines, ED-40515(-), was unable to produce visible tumors in NOD-SCID mice with a common gamma-chain after 2 weeks. In vivo NF-kappaB DNA binding activity of the ED-40515(-) cell line was higher and the NF-kappaB components were changed compared to cells in vitro. Bay 11-7082, a specific and effective NF-kappaB inhibitor, prevented tumor growth at the sites of the primary region and leukemic infiltration in various organs of NOG mice. This in vivo model of ATL could provide a novel system for use in clarifying the mechanism of growth of HTLV-1-infected cells as well as for the development of new drugs against ATL.

Animals↗

PubMed2003

Expression of the c-Met proto-oncogene and its possible involvement in liver invasion in adult T-cell leukemia.

c-Met is a tyrosine kinase receptor for hepatocyte growth factor and suggested to be involved in oncogenesis ormetastatic phenotypes in many malignancies. Adult T-cell leukemia (ATL) is a neoplasia characterized by massive invasion of the leukemic cells into various organs. Recently, we have reported frequent hepatic involvement and the relationship between liver invasion and the poor prognosis in ATL. In the present study, we investigated the expression of c-Met in ATL cells and its relation to liver dysfunction. In three of four human T-cell lymphotrophic virus-I-positive T-cell lines, c-Met was expressed both at mRNA and protein levels, whereas it was not expressed in human T-cell lymphoma virus-I-negative T-cell lines. The expressed c-Met should be functional, because hepatocyte growth factor could induce the autophosphorylation of c-Met. Although the viral-transactivating protein Tax has been shown to be involved in the deregulated expression of cellular genes, Tax mRNA was not detected in c-Met mRNA-expressed cell lines. From freshly isolated peripheral blood mononuclear cells, the expression of c-Met mRNA was detected in 10 of 16 ATL patients but not from healthy individuals. Finally, serum transaminase levels were significantly increased in c-Met-positive ATL cases, and all of the infiltrated c-Met-positive cells into liver were shown to be multilobularly nucleated phenotype. Taken together, these data suggest for the first time that c-Met is involved in the liver invasive phenotype of ATL.

Blotting, Western↗

PubMed2002

Transactivation of the fucosyltransferase VII gene by human T-cell leukemia virus type 1 Tax through a variant cAMP-responsive element.

Human T-cell leukemic virus type 1 (HTLV-1)-infected T cells express the fucosyltransferase (Fuc-T) VII gene involved in the biosynthesis of the leukocyte sialyl Lewis X, which may be related to tissue infiltration in patients with malignant adult T-cell leukemia. HTLV-1 induces Fuc-T VII transcription through the viral transactivator Tax, although the underlying molecular mechanism remains unknown. In the present study, we analyzed the role of the cis-activating element in Tax activation using reporter constructs bearing the 5'-regulatory region of Fuc-T VII in Jurkat T cells. A sequence (GGCTGTGGGGGCGTCATATTGCCCTGG) covering a half-palindromic cyclic adenosine monophosphate (cAMP)-responsive element (CRE) was found to be required for Tax activation of the Fuc-T VII promoter. We further demonstrated that transcription factors of the CRE-binding protein (CREB)/activating transcription factor (ATF) family bind to this CRE-like sequence and that Tax binds in association with CREB and the coactivator CREB-binding protein (CBP) in Jurkat T cells. This element, containing the G+C-rich flanking sequences, is homologous to the Tax-responsive viral CREs in the HTLV-1 long terminal repeat (LTR)-promoter. Furthermore, CREM alpha, an isoform of CREB deficient in the glutamine-rich domains, was found to activate the Fuc-T VII promoter in a phosphorylation-independent manner, similar to the viral CRE in HTLV-1 LTR but in contrast to the phosphorylation-dependent activation of the cellular CREs by Tax. These findings indicate that the Fuc-T VII promoter is transactivated by Tax in concert with CBP through a CRE-like sequence in a manner similar to that of viral CRE in HTLV-1 LTR.

5' Untranslated Regions↗

PubMed2002

Bay 11-7082 inhibits transcription factor NF-kappaB and induces apoptosis of HTLV-I-infected T-cell lines and primary adult T-cell leukemia cells.

Human T-cell leukemia virus type I (HTLV-I) is the causative agent of an aggressive form of leukemia designated adult T-cell leukemia (ATL). We have previously demonstrated that all T-cell lines infected with HTLV-I and primary leukemic cells from ATL patients display constitutively high activity of transcription factor NF-kappaB. In this study we showed that Bay 11-7082, an inhibitor of NF-kappaB, induced apoptosis of HTLV-I-infected T-cell lines but only negligible apoptosis of HTLV-I-negative T cells. Bay 11-7082 rapidly and efficiently reduced the DNA binding of NF-kappaB in HTLV-I-infected T-cell lines and down-regulated the expression of the antiapoptotic gene, Bcl-x(L), regulated by NF-kappaB, whereas it had little effect on the DNA binding of another transcription factor, AP-1. Although the viral protein Tax is an activator of NF-kappaB, Bay 11-7082-induced apoptosis of HTLV-I-infected cells was not associated with reduced expression of Tax. Furthermore, Bay 11-7082- induced apoptosis of primary ATL cells was more prominent than that of normal peripheral blood mononuclear cells, and apoptosis of these cells was also associated with down-regulation of NF-kappaB activity. Our results indicate that NF-kappaB plays a crucial role in the pathogenesis and survival of HTLV-I-infected leukemic cells and that it is a suitable target for the prevention and treatment of ATL.

Adult↗