Biomedical subjects

Yoshiro Saito

Publications and source records attributed to Yoshiro Saito.

At least 19 recordsLinked to original sources

PubMed2025

The SELENOP Polymorphism rs7579 Predicts Hepatic Steatosis in Females With Insulin Resistance in the General Population.

CONTEXT: Selenoprotein P is a hepatokine associated with several metabolic processes. Rs7579 (C > T) is a SeP-related functional single nucleotide polymorphism. OBJECTIVE: In this study, we aimed to identify the environmental factors affecting the relationship between rs7579 and metabolic diseases, such as metabolic dysfunction-associated steatotic liver disease, in the general population. METHODS: This cross-sectional study was based on the Shika Study, a survey of residents in the Noto Peninsula of Ishikawa Prefecture. We analyzed a total of 900 adults, measuring full-length selenoprotein P (FL-SeP) serum levels using a sol-particle homogeneous immunoassay. RESULTS: We observed that selenium and FL-SeP serum levels were associated with dyslipidemia. In males, serum selenium was associated with dyslipidemia and hepatic steatosis. However, in females, FL-SeP tended to be associated with diabetes. Participants carrying the TT genotype and hepatic steatosis exhibited higher levels of liver enzymes, insulin, the homeostatic model assessment of insulin resistance (HOMA-IR), and the homeostasis model assessment of β-cell function than those without hepatic steatosis or with other genotypes. In females carrying the TT genotype of rs7579, hepatic steatosis, hypertension, diabetes, obesity, and metabolic syndrome were associated with higher HOMA-IR levels. CONCLUSION: In this study, we revealed that the association between metabolic diseases and HOMA-IR differed single nucleotide polymorphism genotype and sex dependently. In females carrying the TT genotype of rs7579, hepatic steatosis-associated metabolic disorders (diabetes, hypertension, obesity, and metabolic syndrome) were associated with higher HOMA-IR. The results of this study open the way to genetic signatures-based personalized preventive medicines.

CCDC152↗

PubMed2007

Pharmacokinetics of gemcitabine in Japanese cancer patients: the impact of a cytidine deaminase polymorphism.

PURPOSE: Gemcitabine is rapidly metabolized to its inactive metabolite, 2',2'-difluorodeoxyuridine (dFdU), by cytidine deaminase (CDA). We previously reported that a patient with homozygous 208A alleles of CDA showed severe adverse reactions with an increase in gemcitabine plasma level. This study extended the investigation of the effects of CDA genetic polymorphisms on gemcitabine pharmacokinetics and toxicities. PATIENTS AND METHODS: Genotyping of CDA was performed by a direct sequencing of DNA obtained from the peripheral blood of Japanese gemcitabine-naïve cancer patients (n = 256). The patients recruited to the association study received a 30-minute intravenous infusion of gemcitabine at a dose of either 800 or 1,000 mg/m2, and eight blood samples were periodically collected (n = 250). Plasma levels of gemcitabine and dFdU were measured by high-performance liquid chromatography. Plasma CDA activities toward cytidine and gemcitabine were also measured (n = 121). RESULTS: Twenty-six genetic variations, including 14 novel ones and two known nonsynonymous single nucleotide polymorphisms (SNPs), were detected. Haplotypes harboring the nonsynonymous SNPs 79A>C (Lys27Gln) and 208G>A (Ala70Thr) were designated *2 and *3, respectively. The allelic frequencies of the two SNPs were 0.207 and 0.037, respectively. Pharmacokinetic parameters of gemcitabine and plasma CDA activities significantly depended on the number of haplotype *3. Haplotype *3 was also associated with increased incidences of grade 3 or higher neutropenia in the patients who were coadministered fluorouracil, cisplatin, or carboplatin. Haplotype *2 showed no significant effect on gemcitabine pharmacokinetics. CONCLUSION: Haplotype *3 harboring a nonsynonymous SNP, 208G>A (Ala70Thr), decreased clearance of gemcitabine, and increased incidences of neutropenia when patients were coadministered platinum-containing drugs or fluorouracil.

Adult↗

PubMed2006

Cytotoxic effects of various stressors on PC12 cells: involvement of oxidative stress and effect of antioxidants.

In order to specifically elucidate the involvement of oxidative stress, the effects of various types of stressors and antioxidants on PC12 cells were examined. In this study, the following four stressors were studied in detail: free radicals generated from 2,2'-azobis(2-amidinopropane) dihydrochloride (AAPH), 4-hydroxynonenal (HNE), 7-ketocholesterol (KC), and arsenic trioxide (As2O3). Undifferentiated PC12 cells were treated with 50% lethal concentration (LC50) of these stressors, and subsequently the viability, apoptosis/necrosis ratio, reactive oxygen species (ROS) production, caspase-3 activity, and protection by antioxidants were measured to elucidate the underlying mechanisms that determine the action of these stressors on PC12 cells. The cytotoxicity did not correlate directly with the intracellular formation of ROS. For example, as compared to AAPH, As2O3 produced considerably smaller amounts of ROS at LC50. As observed in the cells incubated with As2O3, KC and HNE exerted cell toxicity, but with a moderate production of ROS. With the exception of HNE, the apoptosis/necrosis ratio of all the stressors evaluated by annexin V and propidium iodide assays increased with an increase in the incubation time at the LC50 values of these stressors. In accordance with apoptosis ratio, caspase activity was detected in the cells incubated with AAPH, As2O3, and KC, but not HNE at LC50 for 24 h. The protective effect of alpha-tocopherol, 17beta-estradiol, 2,3-dihydro-5-hydroxy-2,2-dipentyl-4,6-di-tert-butylbenzofuran (BO653), glutathione, and N-acetylcysteine (NAC) against cytotoxicity depended on the type of stressors. These antioxidants were found to be effective against the abovementioned stressors, except As2O3 against which only NAC was effective. These results suggest that the involvement of ROS and the protective effect of antioxidants depend on the type of stressors.

Aldehydes↗

PubMed2006

Impact of the haplotype CYP3A4*16B harboring the Thr185Ser substitution on paclitaxel metabolism in Japanese patients with cancer.

OBJECTIVE: Paclitaxel is one of the most important anticancer drugs for the treatment of various tumors such as non-small cell lung cancer. We investigated the association between CYP3A4 haplotypes and pharmacokinetic parameters of paclitaxel metabolism. METHODS: This study enrolled 235 Japanese patients with cancer who were receiving paclitaxel. These patients were screened for CYP3A4 gene polymorphisms by either direct sequencing or pyrosequencing. Plasma concentrations of paclitaxel and its 3 metabolites were determined by HPLC in 229 patients. RESULTS: Median values of paclitaxel clearance, normalized for body surface area, were lower in the high-dose group (>or=175 mg/m2, n = 199) than in the low-dose group (<or=100 mg/m2, n = 30), suggesting nonlinearity of pharmacokinetics caused by Cremophor EL. Therefore we mainly used the patients in the high-dose group for further analysis. The median value of the area under the curve (AUC) ratio of 3'-p-hydroxypaclitaxel to paclitaxel was 20% greater (95% confidence interval, 2.4% to 41.7%) in the women than in the men (P = .01). Although no significant difference in paclitaxel clearance was observed among the CYP3A4 haplotypes, 16B-bearing (1/16B) patients (n = 8) showed a 20% lower (95% confidence interval, -58.5 to -11.5%) median AUC ratio of 3'-p-hydroxypaclitaxel to paclitaxel (P = .04) and a 2.4-fold higher median AUC ratio of 6alpha-hydroxypaclitaxel to paclitaxel (P < .001) compaed with those in the wild-type (1/1) patients (n = 180). In contrast, no significant differences were seen between 1/1 and 18B/1 (n = 10) patients for the pharmacokinetic parameters examined. CONCLUSIONS: Our results suggest that CYP3A416B is associated with both reduced 3'-p-hydroxylation of paclitaxel and probably increased levels of 6alpha-hydroxypaclitaxel.

Adult↗

PubMed2006

Induction of adaptive response and enhancement of PC12 cell tolerance by 7-hydroxycholesterol and 15-deoxy-delta(12,14)-prostaglandin J2 through up-regulation of cellular glutathione via different mechanisms.

Increasing evidence suggests an adaptive response induced by reactive oxygen species and other physiologically existing oxidative stimuli. We have recently reported that a variety of lipid peroxidation products at sublethal concentrations could induce adaptive response and enhance PC12 cell tolerance, although the detailed underlying molecular mechanisms have not been clearly clarified. In the present study, we found that both 7-hydroxycholesterol (7-OHCh) and 15-deoxy-delta(12,14)-prostaglandin J2 (15d-PGJ2) at sublethal concentrations significantly increased the cellular GSH as well as the enzyme activity of glutamate-cysteine ligase (GCL), the rate-limiting enzyme of GSH synthesis. Depletion of cellular GSH by buthionine sulfoximine completely abolished the adaptive response. Interestingly, treatment with 15d-PGJ2 significantly increased the gene expression of both subunits of GCL in an NF-E2-related factor 2 (Nrf2)-dependent manner, whereas neither 7-OHCh induced any considerable changes on the GCL gene expression nor did the Nrf2-small interfering RNA treatment exert any appreciable effects on the GSH elevation and subsequent adaptive response induced by 7-OHCh. These results demonstrate that the adaptive response induced by both 7-OHCh and 15d-PGJ2 is mediated similarly through the up-regulation of GSH but via different mechanisms.

Animals↗

PubMed2006

Catalytic roles of CYP2D6.10 and CYP2D6.36 enzymes in mexiletine metabolism: in vitro functional analysis of recombinant proteins expressed in Saccharomyces cerevisiae.

Cytochrome P450 2D6 (CYP2D6) metabolizes approximately one-third of the medicines in current clinical use and exhibits genetic polymorphism with interindividual differences in metabolic activity. To precisely investigate the effect of CYP2D6*10B and CYP2D6*36 frequently found in Oriental populations on mexiletine metabolism in vitro, CYP2D6 proteins of wild-type (CYP2D6.1) and variants (CYP2D6.10 and CYP2D6.36) were heterologously expressed in yeast cells and their mexiletine p- and 2-methyl hydroxylation activities were determined. Both variant CYP2D6 enzymes showed a drastic reduction of CYP2D6 holo- and apoproteins compared with those of CYP2D6.1. Mexiletine p- and 2-methyl hydroxylation activities on the basis of the microsomal protein level at the single substrate concentration (100 microM) of variant CYP2D6s were less than 6% for CYP2D6.10 and 1% for CYP2D6.36 of those of CYP2D6.1. Kinetic analysis for mexiletine hydroxylation revealed that the affinity toward mexiletine of CYP2D6.10 and CYP2D6.36 was reduced by amino acid substitutions. The Vmax and Vmax/Km values of CYP2D6.10 on the basis of the microsomal protein level were reduced to less than 10% of those of CYP2D6.1, whereas the values on the basis of functional CYP2D6 level were comparable to those of CYP2D6.1. Although it was impossible to estimate the kinetic parameters for the mexiletine hydroxylation of CYP2D6.36, the metabolic ability toward mexiletine was considered to be poorer not only than that of CYP2D6.1 but also than that of CYP2D6.10. The same tendency was also observed in kinetic analysis for bufuralol 1''-hydroxylation as a representative CYP2D6 probe. These findings suggest that CYP2D6*36 has a more drastic impact on mexiletine metabolism than CYP2D6*10.

Anti-Arrhythmia Agents↗

PubMed2006

Turning point in apoptosis/necrosis induced by hydrogen peroxide.

The turning point between apoptosis and necrosis induced by hydrogen peroxide (H2O2) have been investigated using human T-lymphoma Jurkat cells. Cells treated with 50 microM H2O2 exhibited caspase-9 and caspase-3 activation, finally leading to apoptotic cell death. Treatment with 500 microM H2O2 did not exhibit caspase activation and changed the mode of death to necrosis. On the other hand, the release of cytochrome c from the mitochondria was observed under both conditions. Treatment with 500 microM H2O2, but not with 50 microM H2O2, caused a marked decrease in the intracellular ATP level; this is essential for apoptosome formation. H2O2-reducing enzymes such as cellular glutathione peroxidase (cGPx) and catalase, which are important for the activation of caspases, were active under the 500 microM H2O2 condition. Prevention of intracellular ATP loss, which did not influence cytochrome c release, significantly activated caspases, changing the mode of cell death from necrosis to apoptosis. These results suggest that ATP-dependent apoptosome formation determines whether H2O2-induced cell death is due to apoptosis or necrosis.

Adenosine Triphosphate↗

PubMed2006

Four novel defective alleles and comprehensive haplotype analysis of CYP2C9 in Japanese.

Genetic variations in cytochrome P450 2C9 (CYP2C9) are known to contribute to interindividual and interethnic variability in response to clinical drugs such as warfarin. In the present study, CYP2C9 from 263 Japanese subjects was resequenced, resulting in the discovery of 62 variations including 32 novel ones. In addition to the two known non-synonymous single nucleotide polymorphisms (SNPs), Ile359Leu (*3; allele frequency=0.030) and Leu90Pro (*13; 0.002), seven novel non-synonymous SNPs, Leu17Ile (0.002), Lys118ArgfsX9 (*25; 0.002), Thr130Arg (*26; 0.002), Arg150Leu (*27; 0.004), Gln214Leu (*28; 0.002), Pro279Thr (*29; 0.002) and Ala477Thr (*30; 0.002), were found. Functional characterization of novel alleles using a mammalian cell expression system in vitro revealed that *25 was a null allele and that *26, *28 and *30 were defective alleles. The *26 product showed a 90% decrease in the Vmax value but little change in the Km value towards diclofenac. Both *28 and *30 products showed two-fold higher Km values and three-fold lower Vmax values than the *1 allele, suggesting the importance of Gln214 and Ala477 for substrate recognition. Linkage disequilibrium and haplotype analyses were performed using the detected variations. Only five haplotypes (frequency >0.02) accounted for most (>87%) of the inferred haplotypes, and they were closely associated with the haplotypes of CYP2C19 in Japanese. Although the haplotype structure of CYP2C9 was rather simple in Japanese, the haplotype distribution was quite different from those previously reported in Caucasians and Africans. Taken together, novel defective alleles and detailed haplotype structures would be useful for determining metabolic phenotypes of CYP2C9 substrate drugs in Japanese and probably Asians.

Alleles↗

PubMed2006

Genetic variation and haplotype structure of the ABC transporter gene ABCG2 in a Japanese population.

The ATP-binding cassette transporter, ABCG2, which is expressed at high levels in the intestine and liver, functions as an efflux transporter for many drugs, including clinically used anticancer agents such as topotecan and the active metabolite of irinotecan (SN-38). In this study, to elucidate the linkage disequilibrium (LD) profiles and haplotype structures of ABCG2, we have comprehensively searched for genetic variations in the putative promoter region, all the exons, and their flanking introns of ABCG2 from 177 Japanese cancer patients treated with irinotecan. Forty-three genetic variations, including 11 novel ones, were found: 5 in the 5'-flanking region, 13 in the coding exons, and 25 in the introns. In addition to 9 previously reported nonsynonymous single nucleotide polymorphisms (SNPs), 2 novel nonsynonymous SNPs, 38C>T (Ser13Leu) and 1060G>A (Gly354Arg), were found with minor allele frequencies of 0.3%. Based on the LD profiles between the SNPs and the estimated past recombination events, the region analyzed was divided into three blocks (Block -1, 1, and 2), each of which spans at least 0.2 kb, 46 kb, and 13 kb and contains 2, 24, and 17 variations, respectively. The two, eight, and five common haplotypes detected in 10 or more patients accounted for most (>90%) of the haplotypes inferred in Block -1, Block 1, and Block 2, respectively. The SNP and haplotype distributions in Japanese were different from those reported previously in Caucasians. This study provides fundamental information for the pharmacogenetic studies investigating the relationship between the genetic variations in ABCG2 and pharmacokinetic/pharmacodynamic parameters.

ATP Binding Cassette Transporter, Subfamily G, Mem↗

PubMed2006

Sequence-based analysis of the CYP2D636-CYP2D610 tandem-type arrangement, a major CYP2D6*10 haplotype in the Japanese population.

The frequency of the CYP2D6*10 allele (100C>T) in the Japanese is relatively high (0.3-0.4), and the two *10-related genes, Ch1 (currently *10B) and Ch2 (*36), and their tandem arrangement Ch(2)-Ch(1) (*36-*10B) have been reported. Although the tandem form of *36-*10 is assumed to be a major form, no detailed information has been reported for its intervening and flanking regions. Thus in this study, the tandem-type *36-*10B and the single-type *10 were analyzed by long-range PCR and sequencing of the subsequent nested PCR products. The sequence of the entire *36-*10 region confirmed the recombination of CYP2D6*10 with CYP2D7P. Also, we found that most of the *10B-harboring haplotypes have the upstream *36 gene and that the majority of the remaining haplotypes are the single-type *10B. Haplotype frequencies of the single-type *10 and *36-*10B were 0.06 and 0.30, respectively, in the subjects analyzed. Additionally, several novel single nucleotide polymorphisms (SNPs) were found in the *36 region and several *36 haplotypes were identified. This sequence information is an important addition to the CYP2D6 sequence data that was obtained by the human genome project.

3' Flanking Region↗

PubMed2006

Thirty novel genetic variations in the SLC29A1 gene encoding human equilibrative nucleoside transporter 1 (hENT1).

Thirty-nine genetic variations, including thirty novel ones, were found in the human SLC29A1 gene, which encodes equilibrative nucleoside transporter 1, from 256 Japanese cancer patients administered gemcitabine. The found novel variations included -8,166G>A, -81,10A>G, -7,947G>A, -7,789T>C, -5,595G>A, -3,803_-3,783delTCGGGGAGGTGGCAGTGGGCG, -3,548G>C, -3,414G>A, -1355T>C, -34C>G, IVS1+141G>A, IVS1+260C>T, IVS1-82C>T, 177C>G, IVS3-6C>T, 564C>T, IVS8+44T>C, IVS8+90T>C, IVS8+97T>C, IVS8+131C>T, IVS8+169G>A, 933T>C, 954C>T, IVS11-52G>C, IVS11-46G>A, 1,288G>A, 1,641C>G, 1,703_1,704delGT, 1812C>T, and 1861C>T. The frequencies were 0.051 for IVS8+169G>A, 0.012 for -7,947G>A, 0.006 for IVS1+141G>A and 1,703_1,704delGT, 0.004 for -8,166G>A, -8,110A>G, -3,548G>C, -1,355T>C, -34C>G, IVS8+44T>C, and 1,812C>T, and 0.002 for the other 19 variations. Among them, 177C>G and 1,288G>A resulted in amino acid substitutions Asp59Glu and Ala430Thr, respectively. Using the detected polymorphisms, linkage disequilibrium analysis was performed, and 28 haplotypes were identified or inferred. Our findings would provide fundamental and useful information for genotyping SLC29A1 in the Japanese and probably other Asian populations.

5' Flanking Region↗

PubMed2006

Novel genetic variations and haplotypes of hepatocyte nuclear factor 4alpha (HNF4A) found in Japanese type II diabetic patients.

Thirty-nine single nucleotide variations, including 16 novel ones, were found in the 5' promoter region, all of the exons and their surrounding introns of HNF4A in 74 Japanese type II diabetic patients. The following novel variations were identified (based on the amino acid numbering of splicing variant 2): -208G>C in the 5' promoter region; 1154C>T (A385V) and 1193T>C (M398T) in the coding exons; 1580G>A, 1852G>T, 2180C>T, 2190G>A, and 2362_2380delAAGAATGGTGTGGGAGAGG in the 3'-untranslated region, and IVS1+231G>A, IVS2-83C>T, IVS3+50C>T, IVS3-54delC, IVS5+173_176delTTAG, IVS5-181_-180delAT, IVS8-106A>G, and IVS9-151A>C in the introns. The allele frequencies were 0.311 for 2362_2380delAAGAATGGTGTGGGAGAGG, 0.054 for 1580G>A, 0.047 for 1852G>T, 0.020 for IVS1+231G>A, 0.014 for IVS9-151A>C, and 0.007 for the other 11 variations. In addition, one known nonsynonymous single nucleotide polymorphism, 416C>T (T139I), was detected at a 0.007 frequency. Based on the linkage disequilibrium profiles, the region analyzed was divided into three blocks. Haplotype analysis determined/inferred 10, 16, and 12 haplotypes for block 1, 2, and 3, respectively. Our results on HNF4A variations and haplotypes would be useful for pharmacogenetic studies in Japanese.

Asian People↗

PubMed2006

Diverse structures of chimeric CYP-REP7/6-containing CYP2D6 and a novel defective CYP2D6 haplotype harboring single-type *36 and CYP-REP7/6 in Japanese.

Chimeric REP7/6 has been used as a marker of CYP2D6 deletion, such as for CYP2D6*5. However, the CYP2D6*10D (*10D) haplotype found in a Japanese population consist of CYP2D6*10B, CYP2D7P-derived 3'-flanking region, and a chimeric repetitive sequence, CYP-REP7/6 (REP7/6) (Ishiguro et al. Clin. Chim. Acta. 2004: 347, 217-221). From our analysis, REP7/6 was found in 26 out of 254 Japanese subjects. Thus, the REP7/6-containing CYP2D6 genes (2D6-REP7/6) were analyzed in detail. In order to specifically detect the 2D6-REP7/6 structure, primers were designed in CYP2D6 intron 6 and the REP7/6 3'-flanking region. Among 26 subjects analyzed by PCR, 5 had 2D6-REP7/6. The other 21 subjects were confirmed to have *5 by another *5-specific primer set. Three out of five subjects with 2D6-REP7/6 had the *10D structure. However, further analysis by PCR and sequencing revealed that their haplotypes were further divided into tandem-type *36-*10D (n=2) and single-type *10D (n=1). The remaining two subjects had a novel type of a *36-containing defective structure that consists of CYP2D6*36 and 3'-flanking REP7/6 (single-type *36-REP7/6). Then, REP7/6 sequences in *5, *10D, *36-*10D, and single-type *36 were determined and classified into 5 types: types A to D for *5, type E for *10D and *36-*10D, and type F for *36. These findings could be useful for accurate determination of *5 and REP7/6-harboring aberrant CYP2D6 haplotypes.

Asian People↗

PubMed2006

Fourteen novel genetic variations and haplotype structures of the TYMS gene encoding human thymidylate synthase (TS).

Forty genetic variations including 14 novel ones were found in the human TYMS gene, which encodes thymidylate synthase, in 263 Japanese cancer patients who received 5-fluorouracil (FU)-based chemotherapy. Three novel variations were located within the 28-bp tandem repeat sequence in the 5'-untranslated region (UTR) and were designated 5Rc, 3Rc-ins and 4Rc. Allele frequencies were 0.021 for 5Rc, 0.006 for 3Rc-ins and 0.002 for 4Rc. Other novel variations included -133G>C and -125G>C in the 5'-UTR; IVS1-278G>A, IVS2-68C>T, IVS2-23T>C, IVS4+122_+123insATTG, IVS4-141G>A, IVS5-100A>T and IVS6-111G>A in the introns; and 1244(*302)A>G and 1264(*322)G>A in the 3'-UTR. The allele frequencies were 0.34 for IVS4+122_+123insATTG, 0.042 for -133G>C, 0.011 for IVS4-141G>A, 0.006 for -125G>C, 0.004 for IVS1-278G>A, IVS2-68C>T, 1244(*302)A>G and 1264(*322)G>A, and 0.002 for IVS2-23T>C, IVS5-100A>T and IVS6-111G>A. Using the detected polymorphisms, linkage disequilibrium (LD) analysis was performed, which divided the TYMS gene into three LD blocks. The 28-bp tandem repeat sequence in the 5'-UTR was assigned as Block 2 with a total of 7 alleles. In Blocks 1 and 3, 7 and 19 haplotypes were determined/inferred, respectively. Our findings provide fundamental and useful information for genotyping TYMS in the Japanese and probably other Asian populations.

3' Untranslated Regions↗

PubMed2005

Adaptive response induced by lipid peroxidation products in cell cultures.

The adaptive response induced by the lipid peroxidation products, such as phosphatidylcholine hydroperoxide, lysophosphatidylcholine (LysoPC), 15-deoxy-Delta(12,14)-prostaglandin J(2), 4-hydroxynonenal (4-HNE), hydroxyoctadecadienoic acid, 7-hydroxycholesterol, and cholesterol 5beta,6beta-epoxide, was investigated in this study. Although these products have been implicated in oxidative stress-related diseases, pretreatment with such compounds at sublethal concentrations significantly protected PC12 cells against subsequent oxidative stress induced by 6-hydroxydopamine. Moreover, 4-HNE and LysoPC also exhibited adaptive protection in human arterial endothelial cells. These findings suggest a general hormetic effect of such compounds in cell cultures and may lead to a reappraisal of the eventual role of reactive oxygen species and lipid peroxidation in organisms.

Adrenergic Agents↗

PubMed2005

4-Hydroxynonenal induces adaptive response and enhances PC12 cell tolerance primarily through induction of thioredoxin reductase 1 via activation of Nrf2.

4-Hydroxynonenal (4-HNE) is one of the major end products of lipid peroxidation. It has been widely accepted that 4-HNE can induce oxidative stress, implicating into extensive stress-related diseases. In the present study, however, 4-HNE was found to exert adaptive cytoprotective effect at low concentrations, which was primarily through induction of thioredoxin reductase 1 (TR1) via transcriptional activation of NF-E2-related factor 2 (Nrf2). Pretreatment with 4-HNE at sublethal concentrations significantly protected PC12 cells against the subsequent oxidative cell death induced by H2O2 and 6-hydroxydopamine. The cellular antioxidative glutathione system did not show any considerable changes, whereas the TR1 activity as well as the mRNA level was significantly elevated by the 4-HNE treatment. Cells treated with TR1 small interfering RNA exhibited less resistance to oxidative stress, and the adaptive response was completely abolished. The Nrf2 was transcriptionally activated by 4-HNE. Cells treated with Nrf2-small interfering RNA exerted lower constitutive levels of TR1 and exhibited less resistance to oxidative stress, and the 4-HNE-induced TR1 expression and subsequent adaptive response were again abolished in such cells. Treatment with 4-HNE at the adaptive concentration induced transient activation of extracellular signal-regulated protein kinase 1/2 and Akt/protein kinase B. Pharmacological inhibition of both these kinase pathways effectively attenuated 4-HNE-induced TR1 expression and subsequent adaptive protection. The above findings, taken together, suggest that stimulation with 4-HNE at sublethal concentrations induces adaptive response and enhances cell tolerance, primarily through induction of TR1 via transcriptional activation of Nrf2 signaling pathway, thereby protecting cells against the forthcoming oxidative stress.

Adaptation, Physiological↗

PubMed2005

Functional analysis of three CYP1A2 variants found in a Japanese population.

Human cytochrome P450 1A2 (CYP1A2) catalyzes the metabolism of many important drugs and environmental chemicals. We previously reported three naturally occurring genetic polymorphisms (125C>G, Pro42Arg, CYP1A2*15; 1130G>A, Arg377Gln, *16; and 1367G>A, Arg456His, *8) found in a Japanese population. In this study, these variant enzymes were expressed in Chinese hamster V79 cells, and their mRNA and protein expression levels as well as catalytic activities were determined. All three variant enzymes showed reduced protein expression levels (66% for Pro42Arg and approximately 30% for Arg377Gln and Arg456His) compared with that of the wild type (WT) without any change in mRNA expression levels. Kinetic analysis for 7-ethoxyresorufin O-deethylation revealed that V(max) and V(max)/K(m) of all three variants were less than 3 and 1% of the WT, respectively, although the K(m) value was significantly increased only in the Arg377Gln variant (approximately a 9-fold increase). Markedly reduced activities of the three variants were also observed for phenacetin O-deethylation. In the reduced CO difference spectral analysis using recombinant proteins produced in the Sf21/baculovirus system, the peak at 450 nm seen in the WT protein was hardly observed in the three variants, suggesting marked reductions in their hemoprotein formation. These results suggest that Pro42, Arg377, and Arg456 are critical amino acids for the production of catalytically active CYP1A2 holoenzyme.

Animals↗

PubMed2005

Lipid peroxidation: mechanisms, inhibition, and biological effects.

In the last 50 years, lipid peroxidation has been the subject of extensive studies from the viewpoints of mechanisms, dynamics, product analysis, involvement in diseases, inhibition, and biological signaling. Lipids are oxidized by three distinct mechanisms; enzymatic oxidation, non-enzymatic, free radical-mediated oxidation, and non-enzymatic, non-radical oxidation. Each oxidation mechanism yields specific products. The oxidation of linoleates and cholesterol is discussed in some detail. The relative susceptibilities of lipids to oxidation depend on the reaction milieu as well as their inherent structure. Lipid hydroperoxides are formed as the major primary products, however they are substrates for various enzymes and they also undergo various secondary reactions. Phospholipid hydroperoxides, for example, are reduced to the corresponding hydroxides by selenoproteins in vivo. Various kinds of antioxidants with different functions inhibit lipid peroxidation and the deleterious effects caused by the lipid peroxidation products. Furthermore, the biological role of lipid peroxidation products has recently received a great deal of attention, but its physiological significance must be demonstrated in future studies.

Animals↗