Search PubMed⌕ Search

Biomedical subjects

Yan Zhang

Publications and source records attributed to Yan Zhang.

At least 415 records · Page 23Linked to original sources
PubMed2004

Intrauterine infections and birth defects.

Intrauterine infection is an important cause of some birth defects worldwide. The most common pathogens include rubella virus, cytomegaloviurs, ureaplasma urealyticum, toxoplasma, etc. General information about these pathogens in epidemiology, consequence of birth defects, and the possible mechanisms in the progress of birth defects, and the interventions to prevent or treat these pathogens' infections are described. The infections caused by rubella virus, cytomegaloviurs, ureaplasma urealyticum, toxoplasma, etc. are common, yet they are proved to be fatal during the pregnant period, especially during the first trimester. These infections may cause sterility, abortion, stillbirth, low birth weight, and affect multiple organs that may induce loss of hearing and vision, even fetal deformity and the long-term effects. These pathogens' infections may influence the microenvironment of placenta, including levels of enzymes and cytokines, and affect chondriosome that may induce the progress of birth defect. Early diagnosis of infections during pregnancy should be strengthened. There are still many things to be settled, such as the molecular mechanisms of birth defects, the effective vaccines to certain pathogens. Birth defect researches in terms of etiology and the development of applicable and sensitive pathogen detection technology and methods are imperative.

Animals↗
PubMed2003

Prospective study of clinical epidemiology of Guillain-Barré syndrome in Harbin, China.

Clinical manifestations, outcomes, prognostic indicators, and clinico-epidemiological subgroups were described based on the information of 71 patients with Guillain-Barré syndrome (GBS), who were identified from a prospective survey in Harbin, China during a 1-year period from 1 October 1997 to 30 September 1998. GBS diagnoses of the patients were validated by senior neurologists and most patients were followed up for 6 months after onset. Antecedent events, mainly respiratory infections, were found in 55 (78%) patients during the month before onset. The clinical features, like motor weakness as initial symptoms (82%) and tendon areflexia or hyporeflexia (100%), are similar to those reported from other populations. However, the proportion (70%) of patients reaching to nadir less than 7 days after onset was rather high. Intravenous human immunoglobulin and/or plasmapheresis were used in 45% of the patients and steroids in 58%. At 6 months after onset, 82% of the patients could walk without aid, 46% of the patients had no any residual signs. Four (6%) patients died within 1 month due to respiratory failure. Three subgroups with different clinico-epidemiological characteristics were identified by using cluster analysis. In conclusion, GBS patients in Harbin, China were younger, had shorter time to nadir, frequently preceded by a respiratory infection, and often treated with steroids. Clinical and epidemiological differences of GBS might exist between various populations.

Adolescent↗
PubMed2003

Supramolecular hydrogels respond to ligand-receptor interaction.

N-(Fluorenyl-9-Methoxycarbonyl) dipeptides form supramolecular hydrogels via hydrogen bonding and hydrophobic interactions. These hydrogels respond to a ligand-receptor interaction as well as to thermal or pH perturbation and also exhibit chiral recognition.

Amino Acids↗
PubMed2003

Image reconstruction for in-line holography with the Yang-Gu algorithm.

A new approach to the numerical reconstruction of wave fronts stored by in-line holography is presented. The new algorithm can achieve good reconstructed results in both unitary and nonunitary systems. The influences of recording distance and noise as well as of digitalization errors on the quality of reconstruction are numerically investigated. The experimental results demonstrate the validity of this new approach.

Journal Article↗
PubMed2003

[Clinical application of tissue engineered bone repair of human craniomaxillofacial bone defects].

OBJECTIVE: To explore the feasibility of tissue engineered bone formation in human being using human bone marrow stromal cells (hBMSCs) and the possibility of clinical repair of craniomaxillofacial bone defects with tissue engineered bone. METHODS: Total 11 patients of cranial defects and aperture piriformis bone depression were included in this study. The hBMSCs were isolated by Percoll gradient centrifugation from patient's bone marrow aspirated from iliac crest. The hBMSCs were cultured in vitro and induced to become osteogenic cells in the DMEM medium containing 10% self-serum, beta-glycerophosphate (10 nmol/L) dexamethasone (10(-8) mol/L), L-2-ascorbic acid (50 micro mol/L), and 1, 25 (OH)(2)VD(3)(10 nmol/L). Induced hBMSCs of passage 3 were harvested and seeded onto partly demineralized allogenic bone matrix (pDBM) to form a cell-scaffold construct and in vitro co-culture for 1 week. The defects were repaired with the cell-scaffold construct. In 3 cases of aperture piriformis bone depression, one side was repaired with hBMSC/pDBM, while the other side was repaired by pDBM alone. All cases were followed up for 1, 3, 6 months post-operation as short-term evaluation and 1 to 2.5 years post-operation as long-term evaluation by three-dimensional computerized tomography (3D-CT) and clinical examination. In 2 cases who received secondary surgery, extra engineered bone tissue and control pDBM were harvested at the implantation sites for histological examination and immunohistochemistry. RESULTS: 3D-CT demonstrated that engineered bone was formed in 3 to 6 months post-operation. Additionally, formed bone maintained stable up to 1 - 2 years without absorption. Histologically, engineered bones revealed their structures similar to that of normal bone in HE staining. Interestingly, endochondral ossification was also observed in engineered bone. Immunohistochemistry shows positive staining of osteonectin and osteocalcin in engineered and normal bones. In contrast, implanted pDBM was completely degraded in 3 - 6 months as revealed by 3D-CT. Histologically, degraded pDBM and fibrous tissue were observed in the sites where pDBM alone was implanted. CONCLUSIONS: Tissue engineered bone can be formed in human being. Engineered bone can be used to repair clinical bone defect with satisfactory result. Furthermore, the result of this study proves that tissue engineered bone is possible for clinical application.

Adolescent↗
PubMed2003

Design, synthesis, and biological evaluation of simplified alpha-keto heterocycle, trifluoromethyl ketone, and formyl substituted folate analogues as potential inhibitors of GAR transformylase and AICAR transformylase.

A series of simplified alpha-keto heterocycle, trifluoromethyl ketone, and formyl substituted folate analogues lacking the benzoylglutamate subunit were prepared and examined as potential inhibitors of glycinamide ribonucleotide transformylase (GAR Tfase) and aminoimidazole carboxamide transformylase (AICAR Tfase).

Cell Line, Tumor↗
PubMed2003

10-(2-benzoxazolcarbonyl)-5,10-dideaza-acyclic-5,6,7,8-tetrahydrofolic acid: a potential inhibitor of GAR transformylase and AICAR transformylase.

The design and synthesis of 10-(2-benzoxazolcarbonyl)-DDACTHF (1) as an inhibitor of glycinamide ribonucleotide transformylase (GAR Tfase) and aminoimidazole carboxamide transformylase (AICAR Tfase) are reported. Ketone 1 and the corresponding alcohol 13 were evaluated for inhibition of GAR Tfase and AICAR Tfase and the former was found to be a potent inhibitor of recombinant human (rh) GAR Tfase (Ki=600 nM).

Binding Sites↗
PubMed2003

Design, synthesis and biological evaluation of 10-CF3CO-DDACTHF analogues and derivatives as inhibitors of GAR Tfase and the de novo purine biosynthetic pathway.

The synthesis and evaluation of analogues and key derivatives of 10-CF3CO-DDACTHF as inhibitors of glycinamide ribonucleotide transformylase (GAR Tfase) and aminoimidazole carboxamide transformylase (AICAR Tfase) are reported. Polyglutamate analogues of 1 were evaluated as inhibitors of Escherichia coli and recombinant human (rh) GAR Tfase, and AICAR Tfase. Although the pentaglutamate 6 was found to be the most active inhibitor of the series tested against rhGAR Tfase (Ki=0.004 microM), little distinction between the mono-pentaglutamate derivatives was observed (Ki=0.02-0.004 microM), suggesting that the principal role of the required polyglutamation of 1 is intracellular retention. In contrast, 1 and its defined polyglutamates 3-6 were much less inactive when tested against rhAICAR Tfase (Ki=65-0.120 microM) and very selective (> or =100-fold) for rh versus E. coli GAR Tfase. Additional key analogues of 1 were examined (7 and 8) and found to be much less active (1000-fold) highlighting the exceptional characteristics of 1.

Drug Design↗
PubMed2003

Simultaneous genotyping of multiplex single nucleotide polymorphisms of the K-ras gene with a home-made kit.

Accurate and fast genotyping of single nucleotide polymorphisms (SNPs) is important in the human genome project. Here an automated fluorescent method that can rapidly and accurately genotype multiplex known SNPs was developed by using a homemade kit, which has lower cost but higher resolution than commercial kit. With this method, oncogene K-ras was investigated, four known SNPs of K-ras gene exon 1 in 31 coloerctal cancer patients were detected. Results indicate that mutations were present in 8(26%) of 31 patients, and most mutations were localized in codon 12. The presence of these mutations is thought to be a critical step and plays an important role in human colorectal carcinogenesisas.

Base Sequence↗
PubMed2003

Genome-wide identification of chromosomal regions of increased tumor expression by transcriptome analysis.

Genes up-regulated in tumor cells provide attractive anticancer therapeutic targets. Although the general underlying mechanism for the increased expression in tumors is unknown, tumor-specific up-regulation of some genes can be attributed to aberrant DNA amplification, a phenomenon common to many tumors. Using a computational method, we constructed a general transcriptome map with the human genomic sequences and expressed sequence tags in the public database. The transcriptome map revealed nonrandom chromosomal regions (termed region of increased tumor expression) where clusters of genes exhibited increased expression in the 10 tumor tissue types tested. These genomic regions often correspond to experimentally verified tumor amplicons. Our large-scale transcriptome analysis led to identification of many additional chromosomal regions with increased tumor expression, regions that represent potential tumor amplicons.

Chromosomes, Human↗
PubMed2003

p75 neurotrophin receptor protects primary cultures of human neurons against extracellular amyloid beta peptide cytotoxicity.

The cytotoxicity of extracellular amyloid beta peptide (Abeta) has been clearly demonstrated in many cell types. In contrast, primary human neurons in culture are resistant to extracellular Abeta-mediated toxicity. Here, we investigate the involvement of p75 neurotrophin receptor (p75NTR) in Abeta-treated human neurons. We find that Abeta1-40 and Abeta1-42, but not the reverse control peptide, Abeta40-1, rapidly increase the levels of p75NTR in a specific and dose-dependent manner. In contrast to observations in cell lines, enhanced expression of p75NTR in human neurons via a herpes simplex virus amplicon vector does not increase the susceptibility of neurons to Abeta. Unexpectedly, inhibition of p75NTR expression with an antisense expression construct or incubation of the cells with an antibody to the extracellular domain of p75NTR sensitizes human neurons to extracellular nonfibrillar or fibrillar Abeta1-42 cytotoxicity. Unlike intracellular Abeta, extracellular Abeta toxicity is independent of p53 and Bax activity. However, Abeta toxicity is inhibited by caspase inhibitors and the glycogen synthase kinase 3beta inhibitor lithium. Neuroprotection against Abeta is phosphatidylinositide 3-kinase dependent but Akt independent. These results are consistent with a neuroprotective role for p75NTR against extracellular Abeta toxicity in human neurons.

Amyloid beta-Peptides↗
PubMed2003

Cytosolic prion protein is not toxic and protects against Bax-mediated cell death in human primary neurons.

Recently, it was observed that reverse-translocated cytosolic PrP and PrP expressed in the cytosol induce rapid death in neurons (Ma, J., Wollmann, R., and Lindquist, S. (2002) Science 298, 1781-1785). In this study, we investigated whether accumulation of prion protein (PrP) in the cytosol is toxic to human neurons in primary culture. We show that in these neurons, a single PrP isoform lacking signal peptide accumulates in the cytosol of neurons treated with epoxomicin, a specific proteasome inhibitor. Therefore, endogenously expressed PrP is subject to the endoplasmic reticulum-associated degradation (ERAD) pathway and is degraded by the proteasome in human primary neurons. In contrast to its toxicity in N2a cells, reverse-translocated PrP (ERAD-PrP) is not toxic even when neurons are microinjected with cDNA constructs to overexpress either wild-type PrP or mutant PrPD178N. We found that ERAD-PrP in human neurons remains detergent-soluble and proteinase K-sensitive, in contrast to its detergent-insoluble and proteinase K-resistant state in N2a cells. Furthermore, not only is microinjection of a cDNA construct expressing CyPrP not toxic, it protects these neurons against Bax-mediated cell death. We conclude that in human neurons, ERAD-PrP is not converted naturally into a form reminiscent of scrapie PrP and that PrP located in the cytosol retains its protective function against Bax. Thus, it is unlikely that simple accumulation of PrP in the cytosol can cause neurodegeneration in prion diseases.

Blotting, Western↗
PubMed2003

[A survey of the long-term incidence rate of benign prostate hyperplasia after vasectomy].

OBJECTIVE: To study the relationship of the long-term incidence rate of benign prostate hyperplasia (BPH) after vasectomy to age and time after operation. METHOD: Questionnaire survey, physical examination, and ultrasonography were conducted among 850 healthy males, aged 55 - 76 who underwent vasectomy more than 20 years before and 390 healthy males, aged 53 - 75, who had not undergone vasectomy in Yichang, Hubei province, selected by randomized cluster sampling. The data such as international prostate symptom scoring (IPSS), quality of life (QOL) index, maximum urine flow rate (MFR), and average flow rate (AFR), digital rectal examination (DRE), volume of prostate gland (V), and residual urine (R) were analyzed. RESULTS: The general BPH incidence rate of the vasectomy group was 10.8%, significantly lower than that of the control group (40.8%, P < 0.01). The age-specific BPH incidence rates in the vasetomy group were all significantly lower than those of the control group, especially that of the subjects aged over 70 (10.8% vs. 56.5%, P < 0.001). The BPH incidence rate of those who had undergone vasectomy 25 years or over before was 7.8%, significantly lower than that of those who had undergone vasectomy 20 years before (13.2%, P < 0.05), but not significantly difference from that of those who had undergone vasectomy 30 years or over before (5.5%, P > 0.05). The volumes of prostate gland in all age subgroups were significantly smaller in the vasectomy group than in the control group. CONCLUSION: Vasectomy reduces the incidence rate of BPH significantly.

Age Factors↗
PubMed2003

[Repair of alveolar bone defect with tissue engineered bone: an experimental study of dogs].

OBJECTIVE: To study the feasibility of repairing experimental horizontal alveolar bone defects by tissue engineering based on bone marrow stromal cells (BMSC). METHODS: Dog bone marrow mononuclear cells were isolated from the bone marrow by gradient centrifugation and then cultured in conditional medium to be induced to become osteogenic. Immunohistochemistry was used to examine the expression of core-binding factor alpha subunit 1 (Cbfa1), osteocalcin (OCN), and type I collagen in the cultured BMSCs. Histochemical technique was used to examine the expression of alkaline phosphatase (AKP) in the BMSCs. Inversed phase-contrast microscopy and electron microscopy were used to observe the morphology and proliferation of the BMSCs. Induced BMSCs at passage 3 were harvested and mixed with calcium alginate to form a gelatin form cell-scaffold construct. A horizontal alveolar bone defect (5 mm high) was created surgically in each buccal side of the mandibular premolars 3 and 4 and molar 1 of 11 dogs. The defects was randomly repaired with a cell-scaffold construct (experimental group, 20 teeth), calcium alginate alone (control group A, 15 teeth), or left untreated (control group B, 12 teeth). At four, twelve, and twenty-four weeks after operation, 2, 7, 2 dogs were killed respectively and block sections of mandibular bones at the defects were collected and processed for gross and histological observation as well as X-ray examination. The status of bone repair 12 weeks after operation in the 3 groups was compared. RESULT: In vitro induced BMSCs exhibited an osteogenic phenotype. Since the passage 3 calcium salt sedimentation could be seen in the extracellular stroma of BMSCs. Cbfa1, type I collagen, and AKP were expressed in the BMSCs in every passage. OCN was expressed since the second passage. Histologically, bone nodule structure was observed in the experimental group 4 weeks after operation. The engineered bone became more mature, similar to the normal bone, 12 weeks after operation. Twelve weeks after operation, the alveolar ridge regeneration amounted to a repair height of 2.43 +/- 0.93 mm, 0.98 +/- 0.87 mm, and 0.78 +/- 0.75 mm and reached 48.59%, 19.74%, and 15.76% of the original height in the experimental group, control group A, and control group B respectively, with a significant difference between the experimental and control groups A and B (all P < 0.01). CONCLUSION: BMSCs can be induced to become osteogenic and be used as seed cells to engineer bone tissue and repair experimental alveolar bone defect.

Alkaline Phosphatase↗
PubMed2003

Increasing sensitivity to arsenic trioxide-induced apoptosis by altered telomere state.

In this work, we investigated the synergic effects between low-dose arsenic trioxide and diethyloxadicarbocyanine (DODC), a telomerase inhibitor, on cell apoptosis. Results revealed that low-dose arsenic could block cell cycle arrest at the G2/M phase and induce apoptosis, whereas DODC could block cell cycle arrest at the G0/G1 phase but not induce apoptosis. However, cells pretreated with DODC showed greater sensitivity to arsenic than untreated cells. The percentage of apoptosis produced by combination treatment with the two agents increased and that was similar to the effect of high-dose arsenic treatment alone. Further studies showed that DODC alone could induce hairpin G-quadruplex formation and inhibit telomerase activity in a dose-dependent manner. Compared with HT1080 cells, 293 cells were more sensitive to cell growth inhibition and apoptosis and were less sensitivity to telomerase activity. These results indicate that DODC can synergistically enhance the apoptosis induced by arsenic, suggesting the increased cell senescence in response to arsenic is induced by an altered telomere state rather than by a loss of telomerase. Thus clinical application of combination treatment with arsenic and telomerase inhibitor may have potential in cancer therapy.

Apoptosis↗
PubMed2003

CpG ODN 2006 and IL-12 are comparable for priming Th1 lymphocyte and IgG responses in cattle immunized with a rickettsial outer membrane protein in alum.

Immunostimulatory oligodeoxynucleotides containing unmethylated CpG dinucleotides (CpG ODN) stimulate IL-12-dependent Th1 dominated cytokine and enhanced IgG responses when co-delivered with antigen to mice. However, the CpG ODN sequences that are optimal for each mammalian species may differ. Previously, we demonstrated that a CpG ODN containing the GTCGTT motif was optimal for stimulating bovine B cell proliferation, and induced IL-6, IL-12 and IFN-gamma production by peripheral blood mononuclear cells (PBMC). The current study was designed to test the hypothesis that the nuclease resistant phosphorothioate modified ODN 2006 (TCGTCGTTTTGTCGTTTTGTCGTT) would induce antigen-specific type 1 cytokine and enhanced IgG responses similar to those induced by IL-12. To test this adjuvant effect, calves were immunized with Anaplasma marginale major surface protein 2 (MSP2) with alum alone or combined with CpG ODN 2006, non-CpG ODN R2006 or IL-12. MSP2-specific IgG1 and IgG2 responses developed more rapidly in calves given IL-12, ODN 2006 or ODN R2006, but the highest IgG1 titers were obtained in CpG ODN-immunized calves. Antigen-specific lymphocyte proliferation and frequency of IFN-gamma-secreting cells were significantly increased in CpG ODN 2006- or IL-12-treated calves, and antigen-stimulated PBMC from these calves also expressed higher levels of IFN-gamma transcripts and lower levels of IL-4 transcripts. No differences in IL-10 mRNA expression were detected among the groups. These results indicate that CpG ODN 2006 is an effective vaccine adjuvant for stimulating both antibody and IFN-gamma mediated cellular immune responses in cattle.

Adjuvants, Immunologic↗
PubMed2003

Rational design, synthesis, evaluation, and crystal structure of a potent inhibitor of human GAR Tfase: 10-(trifluoroacetyl)-5,10-dideazaacyclic-5,6,7,8-tetrahydrofolic acid.

Glycinamide ribonucleotide transformylase (GAR Tfase) has been the target of anti-neoplastic intervention for almost two decades. Here, we use a structure-based approach to design a novel folate analogue, 10-(trifluoroacetyl)-5,10-dideazaacyclic-5,6,7,8-tetrahydrofolic acid (10-CF(3)CO-DDACTHF, 1), which specifically inhibits recombinant human GAR Tfase (K(i) = 15 nM), but is inactive (K(i) > 100 microM) against other folate-dependent enzymes that have been examined. Moreover, compound 1 is a potent inhibitor of tumor cell proliferation (IC(50) = 16 nM, CCRF-CEM), which represents a 10-fold improvement over Lometrexol, a GAR Tfase inhibitor that has been in clinical trials. Thus, this folate analogue 1 is among the most potent and selective inhibitors known toward GAR Tfase. Contributing to its efficacious activity, compound 1 is effectively transported into the cell by the reduced folate carrier and intracellularly sequestered by polyglutamation. The crystal structure of human GAR Tfase with folate analogue 1 at 1.98 A resolution represents the first structure of any GAR Tfase to be determined with a cofactor or cofactor analogue without the presence of substrate. The folate-binding loop of residues 141-146, which is highly flexible in both Escherichia coli and unliganded human GAR Tfase structures, becomes highly ordered upon binding 1 in the folate-binding site. Computational docking of the natural cofactor into this and other apo or complexed structures provides a rational basis for modeling how the natural cofactor 10-formyltetrahydrofolic acid interacts with GAR Tfase, and suggests that this folate analogue-bound conformation represents the best template to date for inhibitor design.

Binding Sites↗