Search PubMed⌕ Search

Biomedical subjects

Y Zhao

Publications and source records attributed to Y Zhao.

At least 505 records · Page 28Linked to original sources
PubMed1999

[Oxygen utilization coefficient in predicting the severity of critical illness].

OBJECTIVE: To evaluate the role of oxygen utilization coefficient (O(2)UC ) in predicting the severity of various diseases. METHODS: Gas analysis of arterial blood and central venous blood and calculation of O(2)UC [O(2)UC = (SaO(2) - SvO(2))/SaO(2)] were carried out in different groups (group 1, 16 cases of trauma, all survived; group 2, 18 emergency cases undergoing cardiopulmonary resuscitation(CPR); group 3, 13 cases undergoing CPR in intensive care unit, all died; group 4, 13 critically ill patients. RESULTS: O(2)UC was 0.30 +/- 0.08, 0.67 +/- 0.27 and 0.60 +/- 0.15 in the groups 1, 2 and 3 respectively. The difference between group 1 and 2 was significant (P < 0.001). O(2)UC persisted to increase, and maintained high for a long time (more than 8 approximately 12 hours), the prognosis of the patients was bad. The critical limitation of O(2)UC was 0.40. In group 4 O(2)UC was closely correlated with the severity of clinical condition. CONCLUSION: O(2)UC is a convenient, reliable and sensible predictor in the treatment of critically ill patients.

Adolescent↗
PubMed1999

[The clinical significance of lung resistance-related protein gene (lrp), multidrug resistance-associated protein gene (mrp) and mdr-1/p170 expression in acute leukemia].

OBJECTIVE: To evaluate the relationship between lrp, mrp, mdr-1/p170 and multidrug resistance in acute leukemia (AL). METHODS: 85 AL patients were divided into three groups: untreated (A), complete remission (B) and relapsed/refractory (C). The expression of lrp, mrp and mdr-1 mRNA was detected with RT-PCR assay and that of p170 measured with immunocytochemistry. RESULTS: The frequency of lrp gene expression in ANLL A, B and C group was 11.11%, 9.09% and 36.36%, in ALL A, B, C group it was 0%, 20.00% and 46.67%; the frequency of mrp gene expression in ANLL A, B, C group was 44.44%, 9.09% and 59.09%, in ALL A, B, C group it was 28.57%, 20.00% and 53. 33%; the frequency of mdr-1 gene expression in ANLL A, B, C group was 0%, 4.54% and 59.09%, in ALL A, B, C group it was 0%, 0% and 33.33%; p170 expression in ANLL C group was (9.45 +/- 14.66) %, it was the highest value in the three groups; statistics showed that there was no correlationship among the expressions of lrp, mrp and mdr-1 gene, P > 0.05; patients with lrp and mdr-1 expression had a lower complete remission (CR) percentage than those who had not in the untreated group; the combination of lrp, mrp and mdr-1 gene detection turned out to be a more sensitive, specific and accurate way in evaluation of multidrug resistance (MDR). CONCLUSION: Overexpression of one or more genes of lrp, mrp and mdr-1/p170 is associated with MDR in AL. Expression of lrp, mrp and mdr-1/p170 is good indicators in clinical MDR. Two or three factors of lrp, mrp and mdr-1 are more valuable in the evaluation of MDR than any one of these three factors. The mechanisms of mrp, lrp and mdr-1 causing MDR are different, it means that the mechanisms of MDR are complicated the combination of lrp, mrp and mdr-1/p170 detection may be the best way to evaluate MDR.

ATP Binding Cassette Transporter, Subfamily B, Mem↗
PubMed1999

[Effects of the anti-LCAMs monoclonal antibodies on proliferation of pulmonary fibrosis in vitro].

OBJECTIVE: To explore the effects of the antibodies to LCAMs on proliferation of pulmonary fibroblast (L929 cell line). METHODS: Proliferation of fibroblasto and level of collagen production were determined by (3)H-TDR incorporation and ELISA. RESULTS: The supernate of AMs cultured with anti-LCAMs could inhibit the proliferation of fibroblast. The presence of anti-CD(11)B (125 microg/ml) could significantly inhibit the proliferation of fibroblast (P < 0.05), and reduce collagen secretion by 29.7%. When anti-CD(18) and anti-CD(54) at the concentration of 25 microg/ml, 5 microg/ml respectively, the inhibition rate of fibroblast proliferation differed from that in control group (P < 0.05). moreover combination of the two antibodies resulted in more significant inhibition effect than that seen by the two antibodies separately. CONCLUSIONS: The increased expression of CAMs on AM might play an important role in the pathogenesis of the pulmonary fibrosis and MAbs to CD(11)B/CD(18), CD(54) possess a potential regiment for intervention of pulmonary fibrosis.

Animals↗
PubMed1999

[The effect of anti-transforming growth factor-beta1 antibody on fibroblast proliferation in vitro].

OBJECTIVE: Using anti-transforming growth factor-beta(1) antibody binding to transforming growth factor-beta(1) (TGF-beta(1)) in conditioned supernatant obtained from alveolar macrophages (AM) in broncho-alveolar lavage fluid (BALF) in bleomycin-induced rats, we investigated the effect of binding of TGF beta(1) to anti-TGF beta(1) antibody on proliferation and synthesis of collagen by fibroblast in pulmonary fibrosis. METHODS: Bleomycin (0.75 mg/100 BW) was instilled intratracheally into wistar rats, then broncho-alveolar lavage (BAL) was performed 7 days later. AMs (5 x 10(5)/ml) were cultured in 0.2% FCS RPMI-1640 medium in vitro for 24 hours and conditioned medium was obtained. L929 fibroblast (7 x 10(3)/well) was cultured in 96-well microtiter plate with conditioned medium and in different doses of anti- TGF beta(1) antibody (1, 5, 10, 20 microg/ml) and IgG for 24 hours respectively. (3)H-Tdr was added 1 microCi per well for 6 hours before culture finished. The proliferation of fibroblast was studied by (3)H-Tdr incorporation rate and synthesis of collagen type IV was tested by ELISA. RESULTS: (1) Fibroblast proliferation which was induced by AM conditioned medium could be significantly depressed by anti-TGF beta(1) antibody in vitro (P < 0.01), and it appeared in a dose-dependent manner. (2) Synthesis of collagen type IV was depressed about 32% by 10 microg/ml anti-TGF beta(1) antibody. CONCLUSIONS: Fibroblast proliferation and collagen synthesis could be depressed by anti-TGF beta(1) antibody in vitro. It seems possible to provide a new way for the treatment of pulmonary fibrosis.

Animals↗
PubMed1999

[The effect of blood-pancreatic juice barrier on 5-fluorouracil in post-pancreatoduodenectomy patients].

OBJECTIVE: To observe the distribution and the relationship of 5-Fu in the plasma and the pancreatic juice in post-pancreatoduodenectomy patients after 5-Fu given intravenously. METHODS: After 5-Fu (1.0 g/m(2)) was given intravenously in post-pancreatoduodenectomy patients, blood and pancreatic juice were collected. The 5-Fu concentrations were determined by HPLC and at last the penetration ratio (PR) of 5-Fu was studied with PCNONLIN. RESULTS: 5-Fu in the plasma penetrated the pancreatic tissue and crossed the blood-pancreatic juice barrier (BPJB) in post-pancreatoduodenectomy patients (PR = 1.01 +/- 0.49). The concentration of 5-Fu in pancreatic juice was much higher than that in plasma. CONCLUSIONS: 5-Fu is suitable for adjuvant chemotherapy of pancreatic adenocarcinoma after pancreatoduodenectomy.

Adenocarcinoma↗
PubMed1999

[Effect of preoperative chemotherapy on apoptosis and tissues of pancreatic adenocarcinoma].

OBJECTIVE: To investigate the apoptosis and tissues change of pancreatic adenocarcinoma with or without preoperative chemotherapy and discuss the effect of preoperative regional chemotherapy on pancreatic adenocarcinoma cell. METHODS: Using the method of TUNEL and microscope, we determined the apoptosis of tumor cells and tissues changes in 30 pancreatic adenocarcinoma patients with or without preoperative chemotherapy. RESULTS: The ratio of apoptosis was much higher in the preoperatively treated group than in the untreated group (44.87 +/- 27.78) and (3.6 +/- 3.76)/HP, (P < 0.01). The ratio of apoptosis was related to the tissue type of pancreatic adenocarcinoma. The ratio of apoptosis in the highly differentiated adenocarcinoma group was much higher than that in the middle or low differentiated adenocarcinoma group (P < 0.05, P < 0.01). The inflammatory reaction and the proliferous intima of vessels were more obvious in the preoperatively treated group than in the untreated group (P < 0.05, P < 0.01). CONCLUSIONS: Preoperative regional chemotherapy can effectively inhibit pancreatic adenocarcinoma by inducing the apoptosis of tumor cells.

Adenocarcinoma↗
PubMed1999

[Direct intramuscular injection of pSV-VEGF(165) augments capillaries formation in a rabbit model of hindlimb ischemia].

OBJECTIVE: To investigate an easier and safer clinical method of gene therapy for treating arterial ischemic diseases in the lower extremity. METHODS: Recombinant plasmid pSV-VEGF(165) constructed in vitro was directly injected into the ischemic hindlimb muscles in rabbit models. 30 days after gene transfer, the capillary density and the capillary to muscle fiber ratio were determined histochemically in the resected samples. RESULTS: The capillary density and the capillary to muscle fiber ratio were significantly higher for pSV-VEGF(165) transfected group than for control group, particularly increased in the shank of the hindlimbs. CONCLUSIONS: Direct intramuscular injection of pSV-VEGF(165) was an easier and efficient gene therapy method, and it significantly augmented the capillary formation in ischemic limbs.

Animals↗
PubMed1999

[Preoperative arterial infusion chemotherapy of colorectal carcinoma pathological and clinical effects].

OBJECTIVE: To investigate the pathological and clinical effects of preoperative selective intra-arterial infusion chemotherapy on colorectal carcinoma. METHODS: 30 patients with colorectal carcinoma underwent selective regional arterial angiography by Seldinger's method followed by intra-arterial infusion chemotherapy. RESULTS: changes of karyopyknosis, karyorrhexis, coagulation and necrosis of cytoplasm in cancer cells around vascular vessels were found in all cases. Interstitial edema, invasion of inflammatory cells, fibroelastosis around cancer cells, proliferous intima, thrombus and inflammation of vessels were also found at the same sites. CONCLUSIONS: Histological changes are significant after preoperative selective intra-arterial infusion chemotherapy for colorectal carcinoma. This therapy can relieve symptoms.

Adult↗
PubMed1999

[Relationship between GSTM1 genotype and susceptibility to senile cataract].

OBJECTIVE: To study the relationship between the glutathione s-transferase gene deletion and cataract formation. METHODS: Blood cells of total of 77 cases with senile cataract and 76 controls were detected for GSTM1 gene, and the subcapsular epithelial cells of 22 cataract lenses were also detected for GSTM1 gene. RESULTS: The GSTM1 gene deletion rate in cataract group was 53.25% and that in the control group was 46.05%, they being not significantly different statistically (chi(2) = 0.750, P > 0.05, OR = 0.75). GSTM1 gene deletion rate in the subcapsular epithelial cells of 20 cases was basically consistent with that in blood cells. CONCLUSION: GSTM1 gene deletion is not related to senile cataract formation.

Aged↗
PubMed1999

[Relationship between obese gene expressive product and simple obesity in children].

OBJECTIVE: To investigate the relationship between obese gene expressive product-obese protein (OP) and the pathogenesis and prognosis of simple obesity in 30 children with normal body weight (control group). METHODS: Before immunoassay, OP was extracted from the whole blood samples with Sep-pak C(18) Cartridge. RESULTS: The plasma contents of OP in the obese group were (118.53 +/- 25.02) ng/L and (197.14 +/- 26.83) ng/L (P < 0.001), respectively. In the obese group, plasma OP was not detected in three cases and was (19.90 +/- 3.94) ng/L in other three cases. These obese children with severe OP deficit not only had more increased body mass index, and levels of total cholesterol, triglyceride and low-density lipoprotein-cholesterol, but also had lower therapeutic effect (16.67%) than those with mild OP depletion (79.16%). CONCLUSION: The children with simple obesity have OP deficit. Simple obesity may be related with the reduced plasma content of OP. The obese children with severe OP deficit have poorer curative effect and unfavorable prognosis.

Child↗
PubMed1999

[Effect of tian ma cu zhi chongji medicinal granules (TMCZCJ) on blood rheology in hypostasis rats due to stagnation of liver-qi and learning-memory disorder in cerebral ischemia-reperfusion mice].

OBJECTIVE: To investigate the effect of TMCZCJ on the blood rheology in hypostasis rats due to stagnation of the liver-qi and on the learning-memory disorder in cerebral ischemia-reperfusion mice. METHOD: The models of hypostasis due to stagnation of the liver-qi were made by combining irritation with hypodemic injected adrenalin and ice-bath in rats, and the models of learning-memory disorder were made by repeatedly ligating-reperfusing the bilateral carotid in mice. The hypostasis rats and learning-memory disorder mice were perorally administrated TMCZCJ(7.7, 15.4 g.kg-1) once a day, for fourteen consecutive days. RESULT: TMCZCJ can significantly reduce plasma viscosity, blood viscosity and reduced viscosity in hypostasis rats. It can also improve the latent learning-memory capability and memory gain-repetition ability in water-maze for cerebral ischemia-reperfusion mice. CONCLUSION: TMCZCJ can improve remarkably blood rheology in hypostasis rats and learning-memory disorder in cerebral ischemia-reperfusion mice.

Animals↗
PubMed1999

[Establishment of a heterologous graft model for human breast infiltrating duct carcinoma in nude mice].

A heterologous graft model for human breast infiltrating duct carcinoma is reported in this paper. The grafts derived from an infiltration duct carcinoma of a patient's right breast and her metastatic lymphnode mass were transplanted into the breast pads of nude mice in 1996, and the carcinoma masses were found in breast pads 31 days later. By now, the grafts of carcinoma have been transplanted into nude mice for 15 passages with a full success in 59 mice and with the biological characteristics of the original breast carcinoma. This heterologous graft model was established for the first time in China and the results suggest it be a good model for further research of breast carcinoma.

Animals↗
PubMed1999

[Experimental study on antiendotoxin effect of extracts from Artemisia annua L].

OBJECTIVE: To explore the antiendotoxin effect of extracts from Artemisia annua (AA) and qinghaosu (QHS). METHOD: LPO and SOD in chondriosome, ACP in lysosomes, tumor nicrosis factor-alpha(TNF-alpha) and endotoxin in plasma, and P450 concentration in hepatic microsome of rats were determined. Mortality of endotoxemic mice and histomorphology were observed. RESULT: LPO, ACP, endotoxin, TNF-alpha and P450 content were decreased with AA and QHS. SOD activity was increased with AA and QHS. At the same time, mortality was decreased. Histomorphology of lysosomes and chondriosome of rats were protected from endotoxin. CONCLUSION: AA and QHS possess an antiendotoxin effect.

Animals↗
PubMed1999

[Effects of alumina particle-size on mechanical properties of alumina-glass composite].

OBJECTIVE: To study the effects of alumina particle-size on mechanical properties of alumina-glass composite. METHODS: Alumina compacts were prepared by isostatic press method and sintered at 1400 degrees C for 2 hours with two various particle-size alumina. Alumina-glass composite was made by infiltrating partially sintered porous alumina with glass at 1200 degrees C for 4 hours. RESULTS: The strength and fracture toughness of nanometre alumina-glass composite were 358.2 MPa, 2.38 MPam1/2 respectively. The strength and fracture toughness of micrometer alumina-glass composite were 432.2 MPa, 5.12 MPam1/2 respectively. Image analysis of SEM micrograph showed that porous rate was about 11.5% in the nanometer alumina-glass composite, 1.2% in the micrometer alumina-glass composite, and there was more glass composition in the nanometer alumina-glass composite than that in the micrometer alumina-glass composite. CONCLUSION: The alumina volume percentage and porous rate play an important role in the strength and fracture toughness of alumina-glass composite.

Aluminum Oxide↗
PubMed1999

[Study on the crystal heat treatment schedule of Plat-II castable ceramic].

OBJECTIVE: To establish the crystal heating schedule of Plat-II castable ceramic materials. METHODS: This study first identified the thermal limits of Plat-II castable ceramic crystallization basing on DTA exotherm analysis, then the crystal density of various heating schedule was observed by scanning electron microscope. RESULTS: The efficient crystal heating schedule of Plat-II castable ceramic was established: The temperature was increased from the room temperature to 620 degrees C with the speed of 10 degrees C/min, kept 20 min, then was increased continually to 670 degrees C with the speed of 5 degrees C/min, and kept 30 min. CONCLUSION: The establishment of the crystal heat treatment schedule of Plat-II castable ceramic will become the basis for the further study.

Crystallization↗
PubMed1999

[Complete overdenture retained with implants and bar-clip attachments].

OBJECTIVE: To sum up and evaluate the applied experience and applied effects of implants and bar-clip attachments in complete overdenture. METHODS: Bar-clip attachments were used as a super structure of implant to manufacture complete overdenture in three designs: mucosa, implant-mucosa, and implant supporting way. The retentive force of the overdenture was measured with measuring instrument of retentive force of prosthesis. RESULTS: All three designs could obtain good retentive effect, specially implant-mucosa supporting and implant supporting designs, which were of more better stability and supporting effect; 2-3 nelon clips could supply 10-15 N retentive force to the overdenture. CONCLUSION: The complete overdenture retained with implant and bar-clips attachments is a very effective way for restoration of endtulous patients, which should be applied more popularly.

Dental Implants↗
PubMed1999

[Preparation of Streptococcus sanguis DIG-labeled DNA probes and clinical application].

OBJECTIVE: To investigate oral Streptococci nif gene. METHODS: According to the 800 base pairs(bp) sequence, a couple of special prime was designed, which were 5'TAGTTGAAGCGATTAAAGCG 3' and 5' TCGTCGTGAAAGCCAAA 3'. DIG-labeled DNA probes of ATCC10556 800 bp DNA fragment and 559 bp DNA fragment were made. By using Southern blotting and dot blotting, more than 30 bacterial strains were checked. RESULTS: 559 bp sequence was according with the reported results, and the Southern blot results showed that S34 sr, S34 no 1 strains had homologicous sequence with ATCC10556, two strains of Streptococcus sanguis were weak positive, and other strains were negative. CONCLUSION: Streptococcus sanguis ATCC10556 strain contained exactly nif gene and nif gene may be the special gene of Streptococcus sanguis ATCC 10556.

Base Sequence↗