Search PubMed⌕ Search

Biomedical subjects

Y Satoh

Publications and source records attributed to Y Satoh.

At least 235 records · Page 13Linked to original sources
PubMed1996

Laparoscopic microwave thermotherapy on small renal tumors: experimental studies using implanted VX-2 tumors in rabbits.

OBJECTIVE: To investigate the effectiveness of microwave thermotherapy on implanted renal VX-2 tumors. METHODS: Fifteen rabbits with implanted renal VX-2 tumors were divided into three groups according to the type of therapy: nephrectomy, laparoscopic microwave thermotherapy, and no treatment. Both the anticancer effect and safety were compared among these groups. RESULTS: The survival rate in the laparoscopic microwave thermotherapy group was significantly higher than that in the no-treatment group, and was the same as that in the nephrectomy group. The serum creatinine level did not increase after microwave therapy. CONCLUSION: Laparoscopic microwave thermotherapy may be useful for a nephron-salvaging treatment in small implanted renal VX-2 tumors in rabbits.

Animals↗
PubMed1996

[Studies on the bioactive constituents of Aurantii Fructus Immaturus].

An ethanol extract of "Kijitsu" (Aurantii Fructus Immaturus, Citrus aurantium L.) collected in China was assessed for the antitumor activity using murine leukemia P388 in vivo, and the extract was found to be active by the antitumor bioassay in vivo and in vitro. The extract was separated into a petroleum ether-soluble fraction and an ethyl acetate-soluble fraction. Fractionation was carried out using an index of cell-growth inhibitory activity against mouse leukemia L1210 cells to isolate antitumor active substances or compounds. The active compounds were purified employing silica gel column chromatography and HPLC. The antitumor effect of the isolated active compounds was studied. Five compounds, auraptene, marmin, tangeretin, nobiretin and 5-[(6',7'-dihydroxy-3',7'-dimethyl-2-octenyl)oxy]psoralen were isolated from Citrus aurantium L. Though they are all known compounds, 5-(6',7'-dihydroxy-3',7-dimethyl-2-octenyl)oxy-psoralen from this plants was first isolated. These compounds showed a cell-growth inhibitory effect against L1210 and K562 in vitro.

Animals↗
PubMed1996

Localization of porphyrin in mouse Harderian glands.

Lipid secreting Harderian glands in the ocular region of rodents contain a large amount of metal-free porphyrins. The localization of these porphyrins and the areas of formation of the lipidporphyrin complexes in the glandular lumina have not been clearly defined. We therefore examined the intracellular localization of porphyrin fluorescence both in tissue sections and in cultured cells of Harderian glands of 5 weeks old female ICR mice, using confocal UV-laser scanning microscopes. The fluorescence appeared in glandular cells containing lipid droplets, but not in non-glandular cells (e.g. myoepithelial or interstitial) without these droplets. Fluorescence in the cells was recognized in the cytoplasm, but there was no evidence indicating that porphyrins were restrictively stored in mitochondria. Nuclei and lipid droplets lacked fluorescence. It is thus reasonable to conclude that porphyrins accumulate in the cytoplasm, and that porphyrins and lipids are secreted separately from glandular cells. The lipid-porphyrin complex is therefore probably formed in the glandular lumina and not within the glandular cells.

Animals↗
PubMed1996

Cathepsin B in the growth of colorectal cancer: suppressive effect of leupeptin on the growth of DMH-induced rat colon neoplasm.

Cathepsin B, a thiol protease, has been reported to be involved in cancer progression and metastasis. The suppressive effects of two kinds of protease inhibitors, leupeptin and dietary camostate (FOY-305), on tumorigenesis and progression in 1, 2-dimethylhydrazine (DMH)-induced rat colon neoplasm were examined in relation to tissue cathepsin B activity. Male Donryu rats were treated with leupeptin or FOY-305 during or after the administration of DMH. There were no significant differences in average tumor numbers among all DMH-treated groups. However, the percentage of small tumors was significantly higher in the group in which leupeptin was supplied during DMH administration. This trend was not recognized in the FOY-305-treated groups. The ratio of cathepsin B activity in the tumors to that in the tumor-bearing tissue (T/Tb) was significantly increased with increasing tumor size (P = 0.009). The cathepsin B activity levels in the tumor-bearing mucosa in the groups which received leupeptin or FOY-305 following DMH treatment were both significantly lower than that in the group which received neither protease inhibitor (P = 0.046 and P = 0.0067, respectively). The results obtained indicate that leupeptin may have suppressed tumor growth by lowering the tissue cathepsin B activity.

1,2-Dimethylhydrazine↗
PubMed1996

Cathepsin B in the growth of colorectal cancer: increased activity of cathepsin B in human colorectal cancer.

Cathepsin B, a thiol protease, is involved in cancer metastasis. To clarify the role of cathepsin B in tumor progression in human colorectal cancer, the relationship between its activity, immunohistochemical staining, and clinical tumor progression was investigated. Cathepsin B activity in adenocarcinomas was significantly elevated compared with that in the tumor-bearing tissue. Furthermore, the tumor/tumor-bearing tissue (T/Tb) ratio of the activity was significantly higher than that of colorectal adenoma. Immunohistochemical studies demonstrated intense staining in the cancerous tissue. With respect to the clinical stage of tumors, the activity tended to be higher in tumors that had invaded the serosa or subserosa than in those that invaded the proper muscle. The results suggest that cathepsin B participates in the progression of human colorectal cancer, and its increased expression is a sensitive marker of the differentiation between colorectal adenoma and adenocarcinoma.

Adenocarcinoma↗
PubMed1996

A study of patients with Angle Class I unilateral cleft lip and palate (UCLP) using lateral roentgenographic cephalograms. A comparison between anterior cross-bite UCLP patients and anterior cross-bite non-UCLP, normal bite UCLP or normal bite non-UCLP patients.

In our previous study carried out in 1994, we found 49 patients with unilateral cleft lip and palate (UCLP) among 51 patients with cleft lip and palate who visited the Department of Orthodontics, Nihon University Dental Hospital at Matsudo. In particular, patients with cross-bite (anterior cross-bite) UCLP were predominant, accounting for 21 individuals (41%). In the present study, we reviewed 79 patients with malocclusion including 21 with anterior cross-bite UCLP, who represent the largest subpopulation among patients with cleft lip and palate. These 21 patients were compared with other UCLP patients showing normal bite with regard to morphological differences evident in lateral roentgenographic cephalograms, to establish a proper policy of orthodontic diagnosis and treatment of their condition. The anterior cross-bite UCLP group showed differences in the skeletal pattern and the denture to skeletal pattern from the other patient groups except for the mesio-distal relationship. The anterior cross-bite UCLP group had cross-bite of the concave type, while the normal bite UCLP group had malocclusion of the convex type accompanied by maxillary overdevelopment. Thus, it is suggested that normalization of reversed occlusion leads to favorable growth of the upper jaw in UCLP patients with anterior cross-bite.

Adolescent↗
PubMed1996

Recombinant human growth/differentiation factor 5 stimulates mesenchyme aggregation and chondrogenesis responsible for the skeletal development of limbs.

We have expressed and biologically characterized recombinant human growth/differentiation factor 5 (huGDF5). This protein is composed of a mature homodimer consisting of 15 kD subunits. Using recombinant expressed protein, we have demonstrated that huGDF5 in vitro stimulated mesenchyme aggregation and chondrogenesis in rat limb bud cells. In vivo, partially purified huGDF5 induced cartilage and bone formation in muscular tissues of rodents. However, in contrast to the effects of other BMPs, as for example BMP-2, the osteoblastic MC3T3-E1 cells did not respond to huGDF5 as measured by alkaline phosphatase activity. These results suggest that the action of GDF5 may be relatively specific for chondrogenesis during the entire process of the endochondral bone formation. GDF5 may control the morphogenesis of cartilaginous tissue, including joints, in the skeletal development of limbs.

Alkaline Phosphatase↗
PubMed1996

[Gastric and duodenal ulcers and their complications in elderly patients].

Among 1470 patients over 65-year-old who were treated for various diseases, 50 had gastric ulcer and 10 had duodenal ulcer. About half the gastric ulcers were located in the body and fundus (n = 24, 48.0%). One third of the patients with gastric or duodenal ulcers had as their chief complaints hematemesis and hematochezia (n = 20, 33.3%), and a greater number had atypical gastrointestinal complaints (general malaise, fever etc, n = 25, 41.7%). In 10 patients (16.7%) the ulcers were due to non-steroidal anti-inflammatory drugs, in 5 (8.3%) they were due to steroid hormones, both of which had been given to treat other conditions; in 45 (75.0%) the origin of the ulcers was unknown. Complications of gastric and duodenal ulcers were hematemesis and hematochezia (n = 20, 33.3%), and perforation (n = 2, 3.3%). Duodenal ulcers tended to be severe, and were associated with death due to bleeding and peritonitis.

Aged↗
PubMed1996

[A case of aortic valve replacement for active infectious endocarditis with multi-organ failure preoperatively].

A 57-year-old man underwent aortic valve replacement for active infectious endocarditis with multi-organ failure. He had become unconscious suddenly and had undergone transient pacing and endoteacheal intubation in the first hospital. Then he had been transferred to the second hospital, where careful medical treatment had been done for cardiac and hepatorenal failure. When he was transferred to our hospital, he was in New York Heart Association functional class IV with catecholamine support and had acute renal failure required hemodialysis. Aortic valve replacement with bileaflet mechanical valve and direct closure of perivalvular ring abscess made the patient free from catecholamine support and hemodialysis, while he needed permanent pacemaker implantation. This case suggests that both careful medical treatment before surgery and timing of surgical intervention were important for active infectious endocarditis with multi-organ failure preoperatively.

Aortic Valve↗
PubMed1996

[Intracavity suction and drainage in a patient with giant bulla accompanied by pneumoconiosis and emphysema: a case report].

A 74-year-old man with giant bulla accompanied by pneumoconiosis and emphysema was treated by intracavity suction and drainage procedure using chemical irritant and fibrin glue. About one month later, the bulla disappeared and the patient symptomatically improved on discharge from hospital. Intracavity suction and drainage is safe and effective treatment of emphysematous bulla in patients considered to be a bad risk for formal thoracotomy.

Aged↗
PubMed1996

[CpG motif in DNA from immune complexes of SLE patients augments expression of intercellular adhesion molecule-1 on endothelial cells].

The sequence of 9 DNA clones obtained from DNA-anti-DNA antibody immune complexes (IC) in 11 SLE patients was analyzed and the possible pathogenic role of the circulating DNA in SLE patients was discussed. Nucleic acid length of 9 cloned DNAs ranged from 87 to 312 base pairs(bp), with a mean length of 177 +/- 62bp, which were rich in guanine (G) + cytosine(C), CpG dinucleotide and palindromic sequences. Oligonucleotide TTTTCAATTCGAAGATGATT which contain the CpG motif in hexamer palindromic sequence segments in cloned DNA augmented the expression of ICAM-1 on the endothelial cells detected by FACS analysis and also augmented the gene expression of several cytokines such as interleukin-2, interleukin-6, interleukin-8 and tumor necrosis factor alpha. These data suggest that DNA in IC of SLE patients will augment expression of ICAM-1 on endothelial cells, resulting in exacerbation of vasculitis.

Antigen-Antibody Complex↗
PubMed1996

[Squamous cell carcinoma of unknown origin affecting mediastinal lymph nodes].

A 65-year-old woman was admitted to the hospital because of an abnormal shadow on a chest X-ray film. Chest CT scans showed enlargement of the right mediastinal lymph nodes. However, no primary lesion was detected despite thorough examination. Mediastinoscopic biopsy revealed that the tumor was a lymph-node metastatic lesion of a squamous cell carcinoma of unknown origin. A thoracotomy was done and the mass was completely resected. Radiotherapy was given after the operation. We have followed the patient for 1 year since the operation, but no primary lesion has yet been detected. Metastasis of cancer of unknown origin to hilar or mediastinal lymph nodes is extremely rare, and only 6 cases have been reported previously in the Japanese medical literature.

Aged↗
PubMed1996

[Initial outcome of coronary intervention in elderly patients].

The effect of age on the early results of coronary intervention was examined retrospectively using the initial success rate of coronary angioplasty in 60 patients older than 70 years. Patients were selected from those who underwent coronary angioplasty at the Saiseikai Utsunomiya Hospital from January 1992 to December 1994. There were 267 patients with 350 lesions, 223 men and 44 women, aged from 31 to 79 years (mean age 61.4 +/- 9.8 years). The elderly group consisted of 60 patients (mean age 73.5 +/- 3.0 years) and the control group was 207 patients less than 70 years (mean age 57.9 +/- 8.2 years). Successful coronary dilatation was defined as > 20% reduction of stenosis with residual stenosis < 50%. Body mass index, presence of hypertension or diabetes mellitus and the ratio of smokers were not significantly different between the two groups. The elderly group included more women and patients with hyperlipidemia. Both groups had similar baseline extent of coronary artery disease, distribution of coronary artery stenosis type and left ventricular ejection fraction. The initial success rate for all patients was 93.4%. There was no significant difference in the initial success rate between the elderly and control groups (98.8% and 91.9%, respectively). There was no significant difference in major complication rate between the two groups (6.3% and 11.5%). Multivariate logistic regression analysis showed that only the type of coronary artery stenosis was significantly associated with initial success rate (p < 0.01). These results suggest that coronary intervention can be successfully performed with a low incidence of major complication in elderly patients.

Adult↗
PubMed1995

Efficacy of TNF-alpha gene-transduced tumor cells in treatment of established in vivo tumor.

The therapeutic effect of TNF gene-transduced mouse fibrosarcoma cells (Meth-A: C5) on pre-inoculated parental cells (Meth-A: M0) was studied. Subcutaneous (s.c.) transplantation of M0 cells into one flank of syngeneic BALB/c mice was followed by s.c. injection of irradiated MO or C5 into the opposite flank 1 week later. The initial M0 tumor (T-MO) completely regressed in C5-vaccinated mice, whereas in M0-vaccinated mice continuous growth of T-M0 was observed. When a similar experiment was carried out in SCID mice, no regression of T-MO was observed, suggesting that the tumor regression in BALB/c mice was not due to direct anti-tumor activity of TNF secreted from C5, but to systemic immunity. Regression of the rechallenged M0 tumor was observed in mice which had shown T-MO regression by C5 vaccination, but rechallenged Colon 26 cells (syngeneic to BALB/c mice) continued to grow, indicating a specific immunity to Meth-A cells). The systemic immunity evoked in C5-vaccinated mice was directly demonstrated by enhanced killer activities of LAK and CTL with a proliferation of T-cell population in their splenocytes. Abrogation of the therapeutic effect of C5 vaccination with anti-Thy 1 and anti-Lyt 2 also demonstrates the involvement of cellular immunity in tumor regression.

Animals↗
PubMed1995

Existence of branched side chains in the cell wall mannan of pathogenic yeast, Candida albicans. Structure-antigenicity relationship between the cell wall mannans of Candida albicans and Candida parapsilosis.

Isolation of side chain oligosaccharides from mannans of Candida albicans NIH B-792 (serotype B) and Candida parapsilosis IFO 1396 strains has been conducted by acetolysis under mild conditions. Structural study of these oligosaccharides by 1H and 13C NMR and methylation analyses indicated the presence of novel branched side chains with the following structures in C. albicans mannan. [sequence: see text] It was observed that the H-1 proton chemical shifts of the second and the third mannose units from the reducing terminus in each oligosaccharide are shifted upfield by substitution with an alpha-linked mannose unit at position 6 of the 3-O-substituted mannose unit. An agglutination inhibition assay between factor 4 serum and cells of Candida stellatoidea IFO 1397 lacking the beta-1,2-linked mannose unit, with oligosaccharides obtained from these mannans, indicated that only the branched oligosaccharides were active. This finding suggests that the branched oligosaccharides correspond to the epitope of antigenic factor 4. The presence of the branched structure in other mannans was detected by the characteristic H-1-H-2-correlated cross-peak of the alpha-1,2-linked mannose unit connected with the 3,6-di-O-substituted one by two-dimensional homonuclear Hartmann-Hahn spectroscopy.

Acids↗
PubMed1995

Derivatives of 2-[[N-(Aminocarbonyl)-N-hydroxyamino]methyl]-1,4- benzodioxan as orally active 5-lipoxygenase inhibitors.

N-Hydroxyureas based on the 1,4-benzodioxan template were prepared from appropriately substituted 1,4-benzodioxan-2-methanols as the key intermediates and evaluated in the in vitro guinea pig polymorphonuclear leukocyte 5-lipoxygenase (5-LO) assay for their 5-LO inhibitory activity. Placement of a 7-phenoxy or 7-p-fluorophenoxy substituent resulted in a dramatic increase in in vitro potency. Selected compounds were subsequently assayed in an ex vivo dog model of LTB4 synthesis at a dose of 1.0 mg/kg. The 7-phenoxy derivatives 16 and 17 showed modest duration of action (DA) in this dog model. The 6-regioisomers 21 and 22 were less potent. Replacement of the 7-phenoxy group of 16 with the p-fluorophenoxy moiety enhanced the DA dramatically. Compound 18 (CGS 25667), which had an IC50 value of 100 nM in the in vitro guinea pig 5-LO assay, had a DA of 8.5 h (zileuton, DA = 8.5 h) at the oral dose of 1.0 mg/kg. Optical antipodes (24, 26) of 18 were independently synthesized in high (> 95%) enantiomeric purity from commercially available optically active glycidyl tosylates and evaluated. In the in vitro assay, the 2S-(-)-enantiomer (24, CGS 25997, IC50 = 85 nM) was found to be twice as active as the 2R-(+)-counterpart (26, CGS 25998, IC50 = 180 nM). In the ex vivo experiment, 24, which dose dependently inhibited plasma 5-LO activity, was shown to be significantly longer acting than 26, with a DA of 8.4 h when dosed orally at 1.0 mg/kg.

Administration, Oral↗
PubMed1995

Analysis of relationships between sex hormone dynamics and bone metabolism and changes in bone mass in surgically induced menopause.

A 3-year follow-up study was performed of bone metabolism and bone changes induced by surgical menopause as a consequence of hysterectomy and oophorectomy (OVX) is 52 nonmenopausal women. We investigated 22 bone parameters and determined seven bone indices as indicators of bone mineral content by dual energy X-ray absorptiometry (DXA), quantitative computed tomography (QCT), and microdensitometry (MD). The significant correlations between levels of sex hormones and/or bone parameters and bone indices demonstrated that marked sex-steroid deficiency after surgical menopause induced bone uncoupling during high bone turnover and subsequent rapid bone loss on the early period after OVX. Principal component analysis using correlation coefficients suggested a seven-loading-factor matrix composed of bone parameters and a two-loading-factor matrix composed of bone indices. Two groups of parameters--estradiol and estriol, and androstenedione together, and luteinizing hormone and follicle stimulating hormone together--indicated that the rate of bone loss was greater in the trabecular bone than in the cortical bone. Three other groups of parameters--urine calcium, urine hydroxyproline, and serum bone Gla-protein together; serum alkaline phosphatase, serum calcium, and 1,25-dihydroxycholecalciferol [1,25(OH)2D] together; and plasma tartrate-resistant acid phosphatase--indicated that bone uncoupling, with a prevalence of resorption over formation of bone, was greater in trabecular bone than is cortical bone and also that magnitude and rate of bone loss in the axial vertebrae surpassed those in the appendicular metacarpals after OVX. Two other groups of parameters, namely, trabecular bone mineral density (Dd) and bone mineral content (Dc), both measured by DXA, and bone mineral density (L2, L3), measured by QCT, together; and the cortical thickness index (MCI), cortical bone mineral density (sigmaGS/D), and the ratio of GSmin/max, measured by MD, indicated that the relative rates of bone reduction at the 3-year follow-up were greater in the axial vertebrae than in the appendicular metacarpals. Thus, bone change in the trabecular bone was associated with rapid loss during the early phase after OVX, whereas that in the cortical bone was slow during the late phase.

Absorptiometry, Photon↗