Search PubMed⌕ Search

Biomedical subjects

Y Pan

Publications and source records attributed to Y Pan.

At least 127 records · Page 7Linked to original sources
PubMed1999

[Coverage of the lower leg defects using the reversed island skin flap based on the nutrient vessels of the saphenous nerve].

OBJECTIVE: To report the application of the distally based neurocutaneous saphenous island flap for the coverage of soft tissue defects in the lower limb. METHODS: According to the size and site of the defect and the rotation point, the flap was designed, and it was based on the arterial axis associated with the saphenous nerve and the greater saphenous vein. RESULTS: Six neurocutaneous saphenous island flaps were used and all survived. Flap dimensions were as large as 6 cm x 8 cm. The results were satisfactory after 6 to 20 months' follow-up. CONCLUSION: The vascularity of the saphenous nerve is closely connected with the vascularity of the skin. The flap supplied by the accompanying vessels of the cutaneous nerve can be utilized with good results.

Adolescent↗
PubMed1999

[Quantitive study of 6-keto-prostaglandin F1 alpha and thromboxane B2 in human pulp].

OBJECTIVE: To study the change of the levels of 6-keto-prostaglandin F1 alpha (6-K-PGF1 alpha) and thromboxane B2 (TXB2) in deep caries and pulpitis pulp. METHODS: The levels of 6-K-PGF1 alpha and TXB2 were determined by radioimmunoassay (RIA) in 44 pulp tissues from subjects with healthy pulp (H), deep caries (DC), chronic pulpitis (CP) and acute pulpitis(AP). The 6-K-PGF1 alpha/TXB2 ratio(K/T) was calculated. RESULTS: The lconcentrations of 6-K-PGF1 alpha in Group AP were highest and those in Group H were lowest. The levels of TXB2 in Group DC were lower than Group CP and those in Group H were lowest. Significant differences in K/T ratio were found among the groups except those between Group H and DC. The value of Group AP was highest and that of Group CP was lowest. CONCLUSION: The dysbolism and dysequilibrium of PGI2 and TXA2 may be closely related to the genesis of pulp diseases.

6-Ketoprostaglandin F1 alpha↗
PubMed1999

[Regulation of adherence to serum-coated hydroxyapatite by Streptococcus sanguis].

OBJECTIVE: To investigate the effects of pH and calcium iron on adhesion of Streptococcus sanguis to serum-coated hydroxyapatite. METHODS: The adhesion model in vitro established by Clark W. B. in 1977 was used to quantify adsorptive cells through [3H] thymidine labelling. RESULTS: The cpm values between different pH groups showed significant differences. Also, there were significant differences of cpm values between calcium groups and control group. CONCLUSION: Either pH or calcium iron has obvious effect on adherence of Stroptococcus sanguis to serum-coated hydroxyapatite. The findings suggest that regulating pH and concentration of calcium iron can help to change colonization on teeth surfaces by Streptococcus sanguis in periodontal circumstance.

Animals↗
PubMed1999

[Clinical and experimental study on effect of burn Jinhuang liquid in treating wound of II degree of burns].

OBJECTIVE: To explore therapeutic effect of Chinese herbal drug Burn Jinhuang Liquid (BJHL) in treating II degree (II- and II+ degree) burn injury. METHODS: One hundred and twenty II degree burn patients were treated with BJHL, the clinical effect was compared with that of moist exposure burn ointment (MEBO). Animal experiments on the effect of BJHL were conducted. RESULTS: To compare with MEBO, BJHL has a better effect of bacteria inhibition and declining rate of wound infection and shortening time of wound healing through clinical and experimental study. There was no irritation to the burn wound, and it has no side and toxic effects to the liver and kidney. CONCLUSION: BJHL has a comprehensive effect of bacteria inhibition, analgesis and wound healing improvement.

Adolescent↗
PubMed1999

[The treatment of 432 patients with pituitary adenomas via transsphenoidal approach].

OBJECTIVE: To study some clinical features of 432 cases of pituitary adenomas treated by transsphenoidal microsurgery between July 1982 and October 1996. METHODS: Pathological examination, immunohistochemical examination and electronmicroscopic examination were done in 424, 29 and 103 cases respectively. RESULTS: Hyperprolactinemia was found in many so-called non-functioning adenomas besides in prolactinomas. The dura maters were invaded by tumors in 78 cases (the incidence of dural invasion was 65.5%). CONCLUSIONS: Hyperprolactinemia is not peculiar to prolactinomas, and differential diagnosis is necessary when hyperprolactinemia exists. The involvement of the dura mater of sellar floor is an important mark that the adjacent tissues were invaded by pituitary adenomas. The outcome of surgical treatment is significantly different between the patients with dural invasion and without invasion.

Adenoma↗
PubMed1999

[Analysis of intraocular pressure and corneal thickness after laser in situ keratomileusis].

OBJECTIVE: To analyze the changes and relationship of the intraocular pressure (IOP) and the corneal thickness (CT) after laser in situ keratomileusis (LASIK). METHODS: This prospective study comprised two groups: noncontact tonometer group 221 eyes (156 patients) 1 month after LASIK and 72 eyes (50 patients) 3 months after LASIK; Goldmann applanation tonometer group 60 eyes (36 patients) 1 month after LASIK. The spherical equivalent, the corneal thickness and the IOP readings were measured pre- and post-LASIK. RESULTS: The CT was thicker than the predicted value and it was much more prominent in the higher myopic group with more regression degree of refraction. The CT at postoperative 3 month was thicker than that at 1 month. There was a statistical decrease in mean tonometer readings, both with non-contact tonometer and Goldmann applanation tonometer; and there was statistically significant correlation between the changes of central corneal thickness and the changes of non-contact tonometer readings (r = 0.2, P < 0.002). The IOP decrease with Goldmann applanation tonometer was less than that with noncontact tonometer. CONCLUSIONS: The actual ablation depth of cornea is lower than the predicted. The IOP readings of the patients after LASIK are lower than the real IOP values. Further efforts should be made to improve the accuracy. Goldmann applanation tonometer is a better choice measuring IOP after excimer photoablative corneal refractive surgery.

Adolescent↗
PubMed1999

[Isolation and identification of saxifragin from Glycyrrhiza uralensis Fisch].

OBJECTIVE: To extract flavonoid constituents from Glycyrrhiza uralensis. METHOD: 30% EtOH extraction and column chromatographic isolation. RESULT: A flavonoid compound was isolated. CONCLUSION: Obtained from G. uralensis for the first time, the flavonoid compound was identified as saxifragin through spectral, physical and chemical analyses.

Flavonoids↗
PubMed1999

[Partial gene clone and nif gene homologous sequence analysis of Streptococcus sanguis].

OBJECTIVE: To analyze the sequence of Streptococcus sanguis chromosome which contains one DNA fragment of 800 base pairs (bp) and discuss Streptococcus sanguis biological features of heredity. METHODS: Streptococcus DNA of 800-bp genetic fragment was cloned and analyzed by using eukaryotic expression vector. RESULTS: By Genbank database, it showed that the 800-bp genetic sequence was highly homologous with other bacterial nifS and nifU gene, and the highest homologous score was 114. CONCLUSION: This nif gene of ATCC 10556 strain may correlate with nutrient metabolism and peroxide hydrogen release of Streptococcus sanguis.

Cloning, Molecular↗
PubMed1999

[Preparation of Streptococcus sanguis DIG-labeled DNA probes and clinical application].

OBJECTIVE: To investigate oral Streptococci nif gene. METHODS: According to the 800 base pairs(bp) sequence, a couple of special prime was designed, which were 5'TAGTTGAAGCGATTAAAGCG 3' and 5' TCGTCGTGAAAGCCAAA 3'. DIG-labeled DNA probes of ATCC10556 800 bp DNA fragment and 559 bp DNA fragment were made. By using Southern blotting and dot blotting, more than 30 bacterial strains were checked. RESULTS: 559 bp sequence was according with the reported results, and the Southern blot results showed that S34 sr, S34 no 1 strains had homologicous sequence with ATCC10556, two strains of Streptococcus sanguis were weak positive, and other strains were negative. CONCLUSION: Streptococcus sanguis ATCC10556 strain contained exactly nif gene and nif gene may be the special gene of Streptococcus sanguis ATCC 10556.

Base Sequence↗
PubMed1999

[Orthogonal experiments on extract-concentrate-spray drier related technological factors for shuguanwenjing granule].

By using orthogonal tests, with the ratio of dry powder abtained from crude drugs and the Icariin content of powder as criteria, the correlation among the extract-concentrate-spray drier technology for Shuguanwenjing Granule and the main technological factors such as time and frequency of decoction, volume of water, relative density of extract, the in-temperature and out-temperature of spray drier, etc. was studied.

Drug Combinations↗
PubMed1998

Protein kinase C-dependent regulation of Na+/Ca2+ exchanger isoforms NCX1 and NCX3 does not require their direct phosphorylation.

We compared the phosphorylation-dependent regulation of three mammalian Na+/Ca2+ exchanger isoforms (NCX1-NCX3) expressed in CCL39 fibroblasts that have little endogenous activity. Na+i-dependent 45Ca2+ uptake into NCX1- or NCX3-expressing cells, but not that into NCX2-expressing cells, was significantly enhanced by phorbol 12-myristate 13-acetate (PMA) or platelet-derived growth factor-BB, which was abolished by pretreatment of cells with calphostin C or a prior long exposure to PMA. This suggests that NCX1 or NCX3, but not NCX2, is stimulated by a pathway involving protein kinase C (PKC). Immunoprecipitation experiments using [32P]orthophosphate-labeled cells revealed that both NCX2 and NCX3 proteins were phosphorylated to a much lesser extent than the NCX1 protein in unstimulated cells and that the extent of phosphorylation was not increased by treatment with PKC activators, although NCX1 phosphorylation was enhanced significantly. Using site-directed mutagenesis, we identified three phosphorylation sites in the NCX1 protein in the PMA-stimulated cells to be Ser-249, Ser-250, and Ser-357 with Ser-250 being predominantly phosphorylated. We found that the NCX1 mutant with these serine residues substituted with alanine still maintained a normal response to PMA. In contrast, the NCX1 or NCX3 mutant, with the large central cytoplasmic loop deleted, lost the responsiveness to PMA. These results suggest that the PKC-dependent regulation of NCX1 or NCX3 requires the central cytoplasmic loop but does not require the direct phosphorylation of the exchanger.

Amino Acid Sequence↗
PubMed1998

Synthesis and biological activities of potent peptidomimetics selective for somatostatin receptor subtype 2.

A series of nonpeptide somatostatin agonists which bind selectively and with high affinity to somatostatin receptor subtype 2 (sst2) have been synthesized. One of these compounds, L-054,522, binds to human sst2 with an apparent dissociation constant of 0.01 nM and at least 3,000-fold selectivity when evaluated against the other somatostatin receptors. L-054,522 is a full agonist based on its inhibition of forskolin-stimulated adenylate cyclase activity in Chinese hamster ovary-K1 cells stably expressing sst2. L-054,522 has a potent inhibitory effect on growth hormone release from rat primary pituitary cells and glucagon release from isolated mouse pancreatic islets. Intravenous infusion of L-054,522 to rats at 50 microgram/kg per hr causes a rapid and sustained reduction in growth hormone to basal levels. The high potency and selectivity of L-054, 522 for sst2 will make it a useful tool to further characterize the physiological functions of this receptor subtype.

Animals↗
PubMed1998

Chromosome 16q24 deletion and decreased E-cadherin expression: possible association with metastatic potential in prostate cancer.

BACKGROUND: Deletion of chromosome 16q is a frequent aberration in prostatic carcinoma, indicating the existence of candidate tumor suppressor genes involved in the pathogenesis of prostate cancer. METHODS: Chromosome 16 numerical aberration and loss of 16q were studied by fluorescence in situ hybridization in 31 primary and 22 metastatic tumors from 53 patients. The results were compared with E-cadherin expression, tumor grade and stage, and DNA ploidy. RESULTS: Numerical chromosome 16 aberrations, 16q deletion, and loss of E-cadherin expression were found in 29%, 35%, and 29% of the primary tumors, respectively, and in 73%, 73%, and 73% of the metastases, respectively. High tumor grade and DNA aneuploidy were also found to have significant correlation with metastases. CONCLUSIONS: Deletion of chromosome 16q24 and/or loss of the E-cadherin function appears in a high frequency in metastases of prostate cancer. The strong correlations suggest that they may be important risk factors, contributing to the metastatic potential of the tumor.

Adenocarcinoma↗
PubMed1998

Tripeptide growth hormone secretagogues.

A series of C-terminus capped dipeptides and tripeptides was synthesized as growth hormone (GH) secretagogues. Among them, tripeptide Aib-D-Trp-D-homoPhe-OEt showed low nanomolar activity in the rat pituitary assay. Thus, we have demonstrated that the GH secretagogue activity of the hexa-hepta-GH releasing peptides can be mimicked at the tripeptide level.

Amino Acid Sequence↗
PubMed1998

Alpha1-syntrophin has distinct binding sites for actin and calmodulin.

Overlay and co-sedimentation assays using recombinant alpha1-syntrophin proteins revealed that two regions of alpha1-syntrophin, i.e. aa 274-315 and 449-505, contain high-affinity binding sites for F-actin (Kd 0.16-0.45 microM), although only a single high-affinity site (Kd 0.35 microM) was detected in the recombinant full-length syntrophin. We also found that actomyosin fractions prepared from both cardiac and skeletal muscle contain proteins recognized by anti-syntrophin antibody. These data suggest a novel role for syntrophin as an actin binding protein, which may be important for the function of the dystrophin-glycoprotein complex or for other cell functions. We also found that alpha1-syntrophin binds calmodulin at two distinct sites with high (Kd 15 nM) and low (Kd 0.3 microM) affinity.

Actins↗
PubMed1998

Bidirectional signaling between sarcoglycans and the integrin adhesion system in cultured L6 myocytes.

The rat L6 skeletal muscle cell line was used to study expression of the dystrophin-containing glycoprotein complex and its interaction with the integrin system involved in the cell-matrix adhesion reaction. A complex of dystrophin and its associated proteins was fully expressed in L6 myotubes, from which anti-dystrophin or anti-alpha-sarcoglycan co-precipitated integrin alpha 5 beta 1 and other focal adhesion-associated proteins vinculin, talin, paxillin, and focal adhesion kinase. Immunostaining and confocal microscopy revealed that dystrophin, alpha-sarcoglycan, integrin alpha 5 beta 1, and vinculin exhibited overlapping distribution in the sarcolemma, especially at focal adhesion-like, spotty structures. Adhesion of cells to fibronectin- or collagen type I-coated dishes resulted in induction of tyrosine phosphorylation of alpha- and gamma-sarcoglycans but not beta-sarcoglycan. The same proteins were also tyrosine-phosphorylated when L6 cells in suspension were exposed to Arg-Gly-Asp-Ser peptide. All of these tyrosine phosphorylations were inhibited by herbimycin A. On the other hand, treatment of L6 myotubes with alpha- and gamma-sarcoglycan antisense oligodeoxynucleotides resulted in complete disappearance of alpha- and gamma-sarcoglycans and in significant reduction of levels of the associated focal adhesion proteins, which caused about 50% reduction of cell adhesion. These results indicate the existence of bidirectional communication between the dystrophin-containing complex and the integrin adhesion system in cultured L6 myocytes.

Animals↗
PubMed1998

Two pimarane diterpenoids from Ephemerantha lonchophylla and their evaluation as modulators of the multidrug resistance phenotype.

Two new pimarane diterpenoids, lonchophylloids A (1) and B (2), were isolated from the stems of Ephemerantha lonchophylla. The structures of 1 and 2 were established predominantly through the application of extensive 1H-and 13C-NMR, 1D- and 2D-homonuclear and heteronuclear correlation NMR experiments, and X-ray diffraction methods. Consistent with structure--activity predictions, both compounds were capable of sensitizing cells that expressed the multidrug resistance phenotype to the toxicity of the anticancer drug doxorubicin.

ATP Binding Cassette Transporter, Subfamily B, Mem↗