Search PubMed⌕ Search

Biomedical subjects

Y Muto

Publications and source records attributed to Y Muto.

At least 217 records · Page 12Linked to original sources
PubMed1995

Prediction of prognosis of primary biliary cirrhosis in Japan.

The clinical profile of primary biliary cirrhosis in Japan was clarified on the basis of data on 1066 patients attending 212 hospitals and institutions in this country. Six hundred and twelve patients (57.4%) were asymptomatic. The majority of the patients were middle-aged women. Pruritus was the most frequent initial symptom of symptomatic primary biliary cirrhosis. Antimitochondrial antibodies were positive in 877 patients (82.5%). Sjögren's syndrome was the most common associated autoimmune disease. Liver biopsy was performed in 753 patients at the time of diagnosis, and histological staging by Scheuer's classification indicated that 307 (43.7%) patients were in stage I and 222 (31.6%) were in stage II. The most frequent causes of death were hepatic failure and/or gastrointestinal bleeding, which affected 166 (78.3%) of the 212 patients who died. Statistical analysis using Cox's regression method revealed that the patient's age and the serum bilirubin, albumin, and total cholesterol concentrations were significant predictors of the prognosis. A prognostic index was also calculated that could be used to predict the duration of survival for patients with primary biliary cirrhosis.

Adult↗
PubMed1995

[Studies on antiulcer agents. III. Synthesis and antiulcer activity of phenylpropanol derivatives].

It was found that (+/-)ethyl 2-[2-(3-hydroxypropyl)-4-oxocyclohexylidene]-propionate (1), (+/-)ethyl 2-[2-(3-hydroxypropyl)-4,5-dimethoxyphenyl]propionate (2) and (+/-)3-[2-(3-hydroxypropyl)-4,5-dimethoxyphenyl]-2-butanone (3) had excellent antiulcer activities. In order to study structure-activity relationships, (+/-)2-[(3-hydroxypropyl)phenyl]cyclopentanone derivatives (4, 5) and (+/-)2-[(3-hydroxypropyl)phenyl]cyclopentanol derivatives (6, 7) were synthesized and tested for antiulcer activities. As a result, (+/-)2-[2-(3-hydroxypropyl)-4-methoxy-5-(2- piperidinoethoxy)phenyl]cyclopentanone (5k) exhibited potent antiulcer activities.

1-Propanol↗
PubMed1995

[Studies on antiulcer agents. IV. Synthesis and antiulcer activity of phenylpropanol derivatives].

It was found that (+/-)ethyl 2-[2-(3-hydroxypropyl)-4-oxocyclohexylidene-propionate (1), (+/-)ethyl 2-[2-(3-hydroxypropyl)-4,5-dimethoxyphenyl]propionate (2), (+/-)3-[2-(3-hydroxypropyl)-4,5-dimethoxyphenyl]-2-butanone (3) and (+/-)2-[2-(3-hydroxypropyl)-4-methoxy-5-(2- piperidinoethoxy)phenyl]cyclopentanone (4) had potent antiulcer activities. In order to study structure-activity relationships, (+/-)3-[(3-hydroxypropyl)phenoxy]-2-butanone derivatives (5, 6) were synthesized and tested for antiulcer activities. Among them, (+/-)3-[2-(3-hydroxypropyl)-4-methoxy-5-[3-(4- methylpiperidino)propoxy]phenoxy]-2-butanone.3/2 oxalate (6k) was selected as a preferred antiulcer agent.

1-Propanol↗
PubMed1995

[Treatment of acute promyelocytic leukemia--combined use of all-trans retinoic acid and granulocyte colony-stimulating factor].

We evaluated the effect of treatment by all-trans retinoic acid (ATRA) in 9 patients with acute promyelocytic leukemia (APL). Of 6 patients who had circulating leukemic blasts before treatment, 3 initially received ATRA alone but died of respiratory failure due to retinoic acid syndrome (RAS). High dose steroid therapy did not rescue RAS in these patients. Another 3 who were given intensive chemotherapy followed by ATRA and/or granulocyte colony-stimulating factor (G-CSF) achieved complete remission (CR). Of 3 patients without peripheral leukemic blasts before treatment, 1 received intensive chemotherapy followed by G-CSF and reached CR, 1 who had been previously given ATRA did not respond to ATRA, and 1 did not initially respond sufficiently to ATRA alone but responded dramatically to ATRA plus G-CSF. In the treatment of APL, appropriate combination of ATRA, G-CSF and chemotherapy should always be taken into consideration. In addition, RAS have to be carefully avoided when applying ATRA therapy in patients who have circulating leukemic blasts before treatment.

Adult↗
PubMed1995

[Continuous infusion therapy with low dose cytosine arabinoside and etoposide in acute myelogenous leukemia patients hardly tolerable for intensive combination chemotherapy].

We evaluated the efficacy of continuous drip infusion therapy with low dose cytosine arabinoside (AraC) and etoposide (VP16) in poor-condition patients with acute myelogenous leukemia (AML). Patients' age ranged from 19 to 85 years with a median of 63 years. Principally they received continuous drip infusion for 14 days with AraC (20 mg/day) and VP16 (50 mg/day). Complete remission (CR) rate was 58.3% (7/12) in untreated cases, 33.3% (2/6) in refractory cases to the standard chemotherapy, and 28.6% (2/7) in relapsed cases. The duration of CR ranged from 1.5 to 20 (+) months (median 8) in untreated group and from 2 to 22 months (median 10) in refractory and relapsed groups. Adverse effects such as gastroenterological symptoms appeared but were tolerable. Although infections due to myelosuppression appeared in 22 of 25 cases, they were well controlled by antibiotics. Chemotherapy-related death was not observed. Although CR rate and CR duration of this therapy were not sufficiently high, the regimen was effective in some patients with refractory or relapsed AML. Further studies are required to establish the efficacy, indication and safety of this treatment.

Adolescent↗
PubMed1995

Effects of branched-chain amino acid infusion on protein metabolism in rats with acute hepatic failure.

Branched-chain amino acids (BCAA) are known to improve hepatic encephalopathy as well as protein malnutrition in cirrhosis. However, such effects in acute hepatic failure (AHF) remain to be elucidated. The current study was conducted to investigate whether BCAA improves protein metabolism in AHF. AHF was induced in male Donryu rats weighing approximately 230 g by giving 60 mg/kg lipopolysaccaride intravenously and 800 mg/kg D-galactosamine hydrochloride intraperitoneally. From 18 hours after injection, AHF rats and control rats were given one of the following five solutions intravenously for 6 hours: 1) saline, 2) 10% glucose, 3) standard 10% amino acid formula with total nitrogen content of 12.2 g/L and BCAA/aromatic amino acid molar ratio of 37.05, 4) BCAA-enriched solution with nitrogen content of 21.9 g/L and the ratio of 148.2, or 5) an active placebo against BCAA-enriched solution with nitrogen content of 21.9 g/L and the ratio of 37.05. In parallel, each group was given a continuous infusion of 14C-leucine. After the plasma radioactivity of 14C-leucine and the expired 14CO2 level reached a plateau, protein turnover was analyzed according to the kinetic model proposed previously by Waterlow. When compared with the control, rates of total protein turnover (total flux), oxidation, and breakdown all increased significantly in AHF. Infusion of standard 10% amino acid formula, BCAA-enriched solution or the placebo in AHF increased total flux and oxidation significantly as compared with the effect of saline or 10% glucose. Although saline, 10% glucose, standard 10% amino acid formula, and the placebo had no effect on synthesis rate, it was increased significantly with BCAA-enriched solution.(ABSTRACT TRUNCATED AT 250 WORDS)

Acute Disease↗
PubMed1995

[Acute myelogenous leukemia with diabetes insipidus without desmopression administration by anti-leukemic chemotherapy].

We report a case of AML with diabetes insipidus (DI). A 68-year-old female was admitted to our hospital because of fever and leukocytosis. The WBC was 197,000/microliter with 98% blasts positive for myeloperoxidase, CD33, CD34 and HLA-DR. While, on admission, urine volume was more than 6 liters daily. Blood vasopressin level was 0.3 microgram/ml. The patient was diagnosed as having AML with DI. By chemotherapy consisting of BHAC, DNR, 6-MP and PSL and intrathecal administration of AraC, MTX and PSL, and nasal drip of DDAVP, complete remission was attained and the urine volume was reduced to normal. Finally DDAVP became unnecessary. Although the exact cause of DI cannot be ascertained, rapid increase of leukemic blasts and leukostasis in small vessels might be associated with hypothalamus-pituitary system damage. Reportedly, DI is a rare complication of leukemia and administration of DDAVP could be halted in only two patients with leukemia and DI.

Aged↗
PubMed1995

[Carotenoids].

Explore the source record for details and available documents.

Adult↗
PubMed1995

Selective deuteration of RNA for NMR signal assignment.

For site-selective deuterium labeling of RNA, [5-2H]uridine phosphoramidite was prepared. The uridine at position 10 of a 25-mer RNA, GGACAGACUUCGGUCGGAGUACUCG, was labeled in two different manners for "positive" (U = [5-1H]U, U = [5-2H] U) and "negative"(U = [5-2H]U, U = [5-1H]U) observations. By comparison of NOESY spectra of the two labeled samples with that of the unlabeled RNA, we could unambiguously assign the H5-H6 signals of U10, and measure their NOE connectivities.

Base Sequence↗