Search PubMed⌕ Search

Biomedical subjects

Y Kikuchi

Publications and source records attributed to Y Kikuchi.

At least 523 records · Page 29Linked to original sources
PubMed1992

Human parathyroid hormone-related peptide-(107-111) does not inhibit bone resorption in neonatal mouse calvariae.

Recent analysis of the structure-function relationship of human PTH-related peptide (hPTHrP) has led to the discovery that its direct inhibitory activity on osteoclastic bone resorption resides fully in the 107-111 sequence of the peptide, as assessed by a bone resorption assay using isolated rat osteoclasts. Here we report that hPTHrP-(107-111) is inactive in neonatal mouse calvariae in culture. hPTHrP-(107-111), at doses of 10(-12)-10(-6) M and incubation periods up to 96 h, did not affect either basal or agonist-stimulated 45Ca release from prelabeled neonatal mouse calvariae, while salmon calcitonin was a potent and powerful inhibitor of both basal and stimulated 45Ca release from bone. Moreover, salmon calcitonin, but not hPTHrP-(107-111), inhibited the increase in osteoclast number in hPTHrP-(1-34)-treated bones. Furthermore, hPTHrP-(107-139) also failed to inhibit 45Ca release and the hPTHrP-(1-34)-induced increase in osteoclast number in this organ culture model when tested under conditions identical to those for hPTHrP-(107-111). The addition of indomethacin to hPTHrP-(107-111)- or hPTHrP-(107-139)-treated bones was without effect, excluding the possibility that the direct inhibitory activity of these peptides on osteoclasts is ablated by a prostaglandin-mediated mechanism. Although the mechanism underlying the apparent inability of the carboxyl-terminal PTHrP fragments to inhibit osteoclastic bone resorption in neonatal mouse calvariae is unknown, it may involve the complex microenvironment of osteoclasts in intact bone, which contains a large variety of cell types other than osteoclasts.

Animals↗
PubMed1992

Amino acids and peptides. XXXIII. Synthesis of N-terminal epitope peptides of mammalian metallothioneins (MTs).

In order to determine the fine structure of the mammalian metallothionein (MT) epitope to a monoclonal anti-rat Zn-MT-II antibody (MT 189-14-7), N-terminal peptides of various lengths of mammalian metallothioneins (MTs) were synthesized by a conventional solution method using the newly developed beta-2-adamantylaspartate, and their immunological properties were examined. It was found that the N-terminal acetyl group was indispensable for the reaction with the monoclonal antibody and the N-terminally acetylated pentapeptide, Ac-Met-Asp-Pro-Asn-Cys-OH, was the smallest peptide which exhibited a significant reactivity with the antibody.

Amino Acid Sequence↗
PubMed1992

What is the clinical disadvantage of discarding old radiographs? Survey of patients not re-examined for a long time.

The clinical disadvantage of discarding old radiographs was evaluated in patients who had not been re-examined for more than 8 years after their last radiological examination, 38,772 in total. During the 1 year survey, 158 (0.41%) of them underwent re-examination after a long interval. Retrospective evaluation revealed that in only 12 patients (0.032%) were the old films useful. This survey suggested that the clinical risk of not referring to films more than 8 years old would be less than 0.049%. We consider this acceptable, and have formulated new guidelines of storage of films.

Evaluation Studies as Topic↗
PubMed1992

P wave height during incremental exercise in patients with chronic airway obstruction.

We examined changes in P wave height in lead 2 of an ECG obtained during progressive exercise in 23 patients with COPD, and measured both P wave changes and pulmonary hemodynamics during exercise at a constant workload corresponding to approximately 50 to 60 percent of VO2 max in nine patients. The P wave response to exercise (delta P/delta VO2, %/ml/min), estimated by the relationship between percentage of change in P wave height and VO2, was significantly greater (p less than 0.01) in 15 patients who had a decrease in PaO2 with exercise (group A) than eight patients who did not have a fall in PaO2 with exercise (group B). There was a significant negative correlation between change in PaO2 and change in P wave height from rest to maximal exercise (r = -0.68, p less than 0.001). Oxygen therapy in nine patients in group A reduced the increase in P wave height during exercise. Furthermore, change in P wave height from rest to exercise correlated significantly with that of mean pulmonary artery pressure (r = 0.75, p less than 0.01). These results suggest that increase in P wave height during exercise in COPD patients is related partly to oxygen desaturation during exercise, and continuous measurement of P wave change may be useful for noninvasively predicting the pulmonary vascular pressure response to exercise.

Aged↗
PubMed1992

Comparative studies on thermoregulatory responses to heat between Japanese Brazilians and Japanese.

Eight male Japanese Brazilians (20-32 yrs) and 11 male Japanese (22-24 yrs) volunteered for this study. The Brazilians had been staying for about 2-21 weeks in Japan. Their physical characteristics are not significantly different from those of the Japanese. Each one of them sat on a chair for 45 min at 40 degrees C (R.H. 50%) in a climatic chamber. Then, they exercised using a bicycle ergometer in a semi-reclining position for 45 min at 40% of maximal oxygen uptake. Forearm blood flow (FBF), oxygen uptake (VO2), heart rate (HR), skin temperature (Tsk), sweat rate (SR) at chest region and body weight loss (delta Wt) were measured. Thermal sensation and thermal comfort were also measured. Thermal and comfort sensation confirmed that Japanese Brazilians felt cooler and more comfortable in 40 degrees C environment than the Japanese. VO2, SR and delta Wt for both groups were not significantly different. FBF and HR for Brazilians were significantly lower than those for Japanese. Tsk at chest region for Brazilians was found to be significantly higher than that for Japanese. Thus the thermoregulatory responses observed in Japanese Brazilians may be largely attributed to the climate in their native places located on the Tropic of Capricorn.

Adult↗
PubMed1992

Influence of noise on heart rate and quantity of work in mental work.

In the present study, we investigated the correlation between the physiological function, heart rate (HR) and the quantity of work performed when A-weighted sound pressure level of factory noise or construction noise was varied during the mental operations of calculation and erosion. Furthermore, we looked for differences in the effects of sound noise and music on the quantity of work performed. The A-weighted sound pressure level was set at four levels of background noise, i.e. 60, 70 and 80 dB (A). The music sound level was set at 70 dB (A). The subjects were exposed to factory noise, construction noise and music during their mental work. A balanced factorial experiment was conducted with a total of 16 combinations of types of mental work (two levels of calculation and erosion), sound noise (two levels of factory and construction sound noise), and A-weighted sound pressure levels (four levels). The order of the experimental procedures was determined at random. The following conclusions were made from the findings of the study. 1) HR elevation occurred due to exposure to sound noise, and further increase in HR resulted from an increase in the A-weighted sound pressure level. This result can be attributed to the action of sound noise as a stressor, which excites sympathetic nerves, leading to an elevation of HR. 2) The quantity of work performed decreased with an increase in the A-weighted sound pressure level. 3) When the subjects were exposed to music with an A-weighted sound pressure level of 70 dB (A) instead of sound noise of the same level, almost no elevation of HR was observed. However, the quantity of work completed when exposed to music was less than that performed when exposed to sound noise of the same A-weighted sound pressure level.

Heart Rate↗
PubMed1992

Clinical application of the polymerase chain reaction for a rapid diagnosis of Mycobacterium tuberculosis infection.

A gene amplification method of Mycobacterium tuberculosis DNA by the polymerase chain reaction (PCR) has been devised. A primer pair used in this study is 5'GTTGCCGTGGCGG TATCGG3' and 5'GCGACATTACGGGGCAGGTGG3', which brackets a 152-base region encoding the 65KD antigen, and a specific probe is 5'TTTGGGGTCATCTTTGGAGCG3'. The procedure could be completed within 2 days. The specificity and the sensitivity of the PCR for M. tuberculosis complex in identifying M. tuberculosis complex did not conflict with the conventional methods at all. Using this method, we could diagnose three cases of the disease, which had been very difficult to diagnose by the conventional methods, by detecting the DNA from the blood, liver biopsy specimen, lung aspirate, and pleural effusion.

AIDS-Related Opportunistic Infections↗
PubMed1992

A randomized trial of reduced doses of azidothymidine in Japanese patients with human immunodeficiency virus type 1 infection.

Adverse reactions to the standard dose (1,200 mg/day-1,500 mg/day) of azidothymidine (AZT) are serious. An in vitro pharmacokinetic study of intracellular AZT-5'-triphosphate suggested the feasibility of a clinical trial with reduced doses of AZT. A randomized trial with reduced doses of AZT (group A; 400 mg/day, n = 15, group B; 800 mg/day, n = 13), was conducted enrolling 28 patients with human immunodeficiency virus infection. The effective rate of AZT on CD4+ lymphocyte counts was similar for both groups, but the duration of the effect of AZT was significantly longer in group A (p less than 0.05). In group B, adverse reactions were more frequently observed (p less than 0.01), and AZT was withdrawn or the dose was reduced more frequently (p less than 0.05). These results suggest that AZT at a dose of 400 mg/day is less toxic, and is more beneficial for long-term treatment.

Adolescent↗
PubMed1992

Transient increase in deformability of stressed red blood cells and role of plasma proteins.

In the context of possible fatigue and eventual destruction of red blood cells (RBCs) in the circulation, changes in deformability (filterability) were studied in RBCs which had just undergone deformation. Fresh human RBCs suspended in media of varying protein concentrations were stressed by causing them to pass through a 5-microns Nuclepore filter. Resultant changes in their deformability were assessed from their mean pore passage time in a subsequent filter passage. Contrary to the expectation, that deformability would be reduced, shortened passage times were observed for those stressed RBCs. The changes were, however, transient and, like the initial passage times, were an increasing function of the protein concentration in the suspending fluid. These results appeared to be consistently explicable by assuming release due to stresses and readsorption in time for plasma protein molecules normally adsorbed on cell surfaces. An analysis, furthermore, yielded acceptable estimates for magnitude of the cell-plasma protein interaction, number of protein molecules normally adsorbed on a cell, and also cell membrane viscosity and its apparent change due to the protein adsorption.

Adsorption↗
PubMed1992

Malignant lymphoma of the central nervous system presenting with central neurogenic hyperventilation. Case report.

The case is described of a 72-year-old woman who presented with a progressive right hemiparesis and central neurogenic hyperventilation. Pathological and radiological studies revealed diffuse infiltration of a malignant lymphoma into the entire central nervous system and the upper spinal cord. The authors review 12 cases of tumor-induced central neurogenic hyperventilation and discuss the pathophysiology of this condition.

Aged↗
PubMed1992

[Cytokinetic effects of cisplatin on cisplatin-resistant ovarian cancer cell lines].

Cytokinetic effects of cisplatin on human ovarian cancer cell lines with natural cisplatin-resistance was examined by means of flow cytometry. These ovarian cancer cell lines derived from patients with clear cell carcinoma and serous cystadenocarcinoma were established and designated "KK" and "MH", respectively. Both KK and MH cells have shown resistance to cisplatin and IC50 of them were 0.95 microM and 3.28 microM, respectively. Cisplatin inhibited cell cycle progression at G2 +M phase up to IC50 of each cell from the analysis of cell cycle. Similar results had been obtained in the case of "KF" cell which was sensitive to cisplatin. Further studies of these cells should be performed to elucidate the mechanism of cisplatin resistance.

Adenocarcinoma↗
PubMed1992

[Bronchial asthma].

In the first study, to clarify whether increased vagal afferent activity contributes to the increase in ventilatory response to CO2 in patients with asthma, we examined the effects of prostaglandin E2 (PGE2) inhalation on the respiratory response to CO2 in seven normal subjects. After PGE2 inhalation, the ventilatory and occlusion pressure responses to CO2 increased significantly compared with those after saline inhalation, with no increase in respiratory resistance. These results suggest that increase in vagal afferent activity may play a role in the increased hypercapnic response during acute exacerbations of asthma. In the second study, to clarify the reduced respiratory chemosensitivity associated with asthma-related deaths, we examined the hypercapnic and hypoxic ventilatory responses in five patients with near-fatal asthma who were given artificial ventilation and/or became unconsciousness during an acute exacerbation of asthma. Hypoxic ventilatory response was significantly lower in these subjects than in patients with uncomplicated asthma and normal subjects, suggesting that lowered hypoxic ventilatory response may be related to death from asthma.

Asthma↗
PubMed1992

[Home oxygen therapy using liquid oxygen system].

Home oxygen therapy (HOT) for patients with chronic respiratory failure has been believed to increase the quality of life and to improve the prognosis of such patients. In Japan, HOT for chronic respiratory failure has been supported by health insurance since March 1985. Since then, patients with HOT have increased progressively, and it has been reported that there are now over 20,000 patients with HOT. The oxygen concentrator which extracts oxygen from atmospheric air has been commonly used as the oxygen delivery system. Recently the liquid oxygen system has provided an attractive, convenient source of oxygen. Since April 1990, HOT using liquid oxygen system has been supported by health insurance, and its use will become widespread in Japan. A major characteristic of this system is that oxygen condensed into a liquid form allows storage of a larger supply. This system consists of two parts: stationary type which stores the liquid oxygen, and a portable type which can easily be refilled with oxygen a larger source. In the present study, we examined the efficacy of portable liquid oxygen in 50 patients with chronic pulmonary diseases including patients with chronic respiratory failure who had PaO2 < 55 mmHg during air breathing. We measured changes of ten minutes walking distance (10 MD) and blood gas analysis with and without portable liquid oxygen. We also performed on estimation of efficacy of liquid oxygen by questionnaires in patients receiving liquid oxygen for HOT. We did not find a significant improvement of 10 MD with portable liquid oxygen, but found a significant improvement of arterial oxygen tension at the end of walking.(ABSTRACT TRUNCATED AT 250 WORDS)

Carbon Dioxide↗
PubMed1992

[A case report of multiple pulmonary tumors as a sole manifestation of synovial sarcoma].

A 47-year-old woman was admitted to our hospital for cough and dyspnea. Roentgenologic studies and bronchoscopy revealed multiple lung tumors one of which obstructed the right main bronchus. Right pneumonectomy was performed for the pending obstruction of the trachea. The tumor in the right S1 was found to be protruding into the trachea through the right B1 and the main bronchus in a polypoid fashion. The pathological diagnosis of synovial sarcoma was made on the basis of the characteristic biphasic structure composed of spindle cells and epithelioid cells forming gland-like spaces. Three years and eight months after the pneumonectomy, a nodule in the tendon of the extensor hallucis longus muscle became palpable. It was also a synovial sarcoma pathologically. Synovial sarcoma is a soft tissue sarcoma which usually arises in the extremities. It is very rare for pulmonary metastasis of this tumor to be found while the primary tumor is undetectable.

Female↗
PubMed1992

Urinary coagulation-fibrinolysis, kallirein-kinin systems and kininase in cases of preclampsia.

Urinary kallikrein and kallikrein activity significantly decreased in cases of preeclampsia (u-kall./CRE.index 42.39 +/- 9.66 ng/mg, u-kall. act./CRE.index 0.26 +/- 0.06 ng/min/mg), and urinary kininase II and kininase activity significantly increased (u-kininase/CRE.index 10.91 +/- 1.26 x 10(-3) IU/min/mg, u-kininase act./CRE.index 506.37 +/- 178.45 pg/min/mg) when compared with those of normal gravidas from 28 weeks to 42 weeks of gestation (u-kall./CRE.index 189.31 +/- 14.17 ng/mg, u-kall. act./CRE index 1.08 +/- 0.10 ng/min/mg, u-kininase/CRE.index 6.24 +/- 0.31 x 10(-3) IU/min/mg, u-kininase act./CRE.index 15.64 +/- 0.10 pg/min/mg). Urinary FPA, B beta 5-42, alpha 2-PI, and alpha 2PI-plasmin-complex (PIC) significantly increased in preeclampsia (u-FPA/CRE.index 23.59 +/- 8.47 ng/mg, u-B beta/CRE.index 105.26 +/- 29.30 ng/mg, u-alpha 2PI/CRE.index 121.53 +/- 43.57 ng/mg, u-PIC/CRE index 278.39 +/- 60.50 ng/mg) when compared with those of normal control group (u-FPA/CRE.index 0.92 +/- 0.04 ng/mg, u-B beta/CRE.index 12.15 +/- 0.44 ng/mg, u-alpha 2PI/CRE.index 4.18 +/- 0.33 ng/mg, u-PIC/CRE.index 5.98 +/- 1.15 ng/mg). Urinary urokinase markedly increased and urinary D-dimer was detected in severe cases of preeclampsia (u-UK/CRE.index 58.20 +/- 43.69 ng/mg, u-D-dimer 54.76 +/- 9.89 ng/ml) when compared with those of normal control group. These findings suggest that deficiency in urinary kinin excretion may induce hypertension in addition to the changes of urinary coagulation-fibrinolysis system that represents the occurrence of either the endothelial cell injury in the glomerulus or the renal tulbular damage in mild cases of preeclampsia, eventually resulting in the intra-renal vascular coagulation.

Female↗
PubMed1992

Investigation and research on classification of productive skills (1)--Actual work and skills in the car manufacturing industry.

A survey was conducted at a site for production which is in the process of technological innovation to examine and clarify the trend in current productive skills. In August 1991, a questionnaire survey was given to skilled workers of a car manufacturing company. The number of valid responses was 1,215. The survey included 133 items in the following three areas: (1) nature of workers' productive skills, 40 items; (2) human functions and vocational ability necessary for the work, 60 items; and (3) working conditions, 33 items. The characteristics of the productive skills required in each division were compared and examined based on the final results of the survey. Clear characteristics were found which reflect the actual productive skills introduced into the factories and sections through technological innovation. The nature of the product manufactured at each factory and the actual skills which reflect the work done at the factories are clarified. The survey items used for this research have effectively clarified the characteristic of the productive skills.

Automobiles↗