Search PubMed⌕ Search

Biomedical subjects

Y Hayakawa

Publications and source records attributed to Y Hayakawa.

At least 19 recordsLinked to original sources
PubMed2003

Expression of Cotesia kariyai polydnavirus genes in lepidopteran hemocytes and Sf9 cells.

The parasitic wasp Cotesia kariyai carries polydnavirus (CkPDV) which is an indispensable factor for the successful parasitization by the wasp. One of its surface proteins has been identified as an immunoevasive mediator from the cellular defense reactions of the host armyworm Pseudaletia separata, thereby it was named immunoevasive protein (IEP). In the present study, we demonstrated that anti-IEP antibody did not suppress the CkPDV infection of Sf9 cells but decreased its infection of P.separata hemocytes, thus indicating that IEP is not essential for CkPDV to enter into the target cells but is important for evading from the attack of the hemocytes. Three genes of CkPDV expressed in Sf9 cells were isolated and characterized. Two of them (CkV0.8, CkV0.9) are novel genes but another one (CkV2.0) is the same gene with the one we previously identified in the parasitized armyworm larvae. Although these genes reside in different DNA segments of CkPDV genome, all of them are expressed in the hemocytes of the parasitized armyworm larvae. These gene transcripts are first detected at 2 h after parasitization, and the expressions of CkV0.8 and CkV0.9 were gradually decreased after reaching the maximum level at 4 h after parasitization. However, the expression of CkV2.0 continues to be increased at least for 10 h after parasitization.

Amino Acid Sequence↗
PubMed2003

A critical period for retinoic acid teratogenesis and loss of neurophilic migration of pontine nuclei neurons.

Abnormalities in the pontine nuclei (PN) and inferior olive are hallmarks of human retinoic acid (RA) teratogenesis. This study shows that RA exposure of the mouse at a specific embryonic stage alters morphological structures that derive from the wall of the IVth ventricle to form components of the precerebellar system (the inferior olivary nucleus and the PN). The study employs both normal and a RAREhspLacZ transgenic RA reporter mouse. It is shown that abnormalities in the PN and inferior olive result from exposure at a critical period of embryonic day 9.5 and 10.5. The abnormalities in the PN are due to a failure in their usual neurophilic migration. The compact stream of cells that leads from the anterior rhombic lip to the ventral pons is instead scattered widely over the anterior medulla. Given that the RA exposure occurs after the resolution of rhombomere identity this suggests that teratogenic RA interferes with a regulatory event that overlays this original pattern.

Abnormalities, Drug-Induced↗
PubMed2003

Isolation and characterization of a dopa decarboxylase cDNA and the induction of its expression by an insect cytokine, growth-blocking peptide in Pseudaletia separata.

Parasitization by the wasp, Cotesia kariyai, elevates the concentration of an insect cytokine, growth-blocking peptide (GBP), in hemolymph of last instar Pseudaletis separata larvae. The increase of epidermal and hemolymph dopamine level is associated with the GBP increase. Both GBP and dopamine disturb host development and metamorphosis (Hayakawa, 1995). Dopa decarboxylase (DDC) converts Dopa to dopamine, and its cDNA was isolated from P. separata, and the deduced amino acid sequence showed that it was highly homologous to other lepidopteran DDCs, showing 96, 90 and 86% identity with those of Mamestra brassicae, Bombyx mori, and Manduca sexta, respectively. A 3.2 kb DDC mRNA transcript was constitutively expressed at low levels in the epidermis, brain-nerve cord and hemocytes, and the expression was enhanced by injection of GBP in these tissues. Detailed characterization of the DDC mRNA expression in the epidermis showed that its expression reached a plateau 3 hr after the injection. DDC activity and DDC protein (55 kDa) level mirrored the mRNA expression. Immunocytochemistry with anti-DDC antibody confirmed that the enhanced DDC expression was localized in the epidermal cells. Dopamine concentration in the epidermis gradually increased and reached maximum 6 hr after the injection. When the epidermis of Day 1 last instar larvae was cultured in vitro in the presence of GBP, DDC mRNA increased, indicating that GBP acted on the epidermal cells directly to induce expression of the DDC gene.

Amino Acid Sequence↗
PubMed2002

[Contralateral pneumothorax after pneumonectomy for bronchogenic carcinoma; report of a case].

A case of contralateral pneumothorax after pneumonectomy was reported. Intrathoracic drainage was performed and pneumothorax was healed. Recurrent pneumothorax was occurred in this patient and intrathoracic drainage was performed again and pneumothorax was healed. We suspected that bulla was the cause of pneumothorax and thought that contralateral pneumothorax after pneumonectomy must be carefully follow-up.

Aged↗
PubMed2002

[Multiple lung cancer with cavity; report of a case].

A case of multiple lung cancer with cavity was reported. Chest X-ray and chest computed tomography (CT) showed two abnormal shadows with consolidation in the right S1 and S2b. The shadow in S2b had a cavity. Right upper lobectomy and right middle lobe partial resection was performed and the histopathological examination revealed adenocarcinoma. This case deserves attention of difficulty in differentially diagnosis on the chest X-ray and chest CT from pulmonary tuberculosis.

Adenocarcinoma↗
PubMed2001

Involvement of tumor necrosis factor-related apoptosis-inducing ligand in NK cell-mediated and IFN-gamma-dependent suppression of subcutaneous tumor growth.

Natural killer (NK) cells and interferon- (IFN) gamma have been implicated in immune surveillance against tumor development. Here we show tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), which is a type II membrane protein belonging to the TNF family and plays a critical role in the NK cell-mediated and IFN-gamma-dependent suppression of subcutaneous growth of TRAIL-sensitive tumors. Administration of a neutralizing monoclonal antibody against TRAIL promoted outgrowth of subcutaneously inoculated TRAIL-sensitive tumors (L929, LB27.4, and Renca) but not TRAIL-resistant tumors (P815 and B16). Such a protective effect of TRAIL against TRAIL-sensitive tumors was abrogated in NK cell-depleted or IFN-gamma-deficient mice. These results suggested a substantial role of TRAIL as the effector molecule that eliminates subcutaneously developing TRAIL-sensitive tumors.

Animals↗
PubMed2001

Acid/azole complexes as highly effective promoters in the synthesis of DNA and RNA oligomers via the phosphoramidite method.

The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3'-(allyl N,N-diisopropylphosphoramidite)s or 3'-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3'-O-(tert-butyldimethylsilyl)ribonucleoside 2'-(N,N-diisopropylphosphoramidite)s or 2'-O-(tert-butyldimethylsilyl)ribonucleoside 3'-(N,N-diisopropylphosphoramidite)s used for the formation of 2'-5' and 3'-5' internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5'-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, (5')CGACACCCAATTCTGAAAAT(3') (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3'-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3'-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as (5')AGCUACGUGACUACUACUUU(3') (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5'-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2'-5')adenylyl(2'-5')adenosine (2-5A core).

DNA↗
PubMed2001

Molecular cloning of silkworm paralytic peptide and its developmental regulation.

The silkworm paralytic peptide (PP) is a member of the ENF peptide family that exerts multiple biological activities involved in defense reaction and growth regulation. We isolated its cDNA and examined mRNA expression profiles. cDNA encoded 131 amino acids from which the 23-residue PP sequence was found at the C-terminal portion. Immunoblot analysis and paralytic activity assay indicated that inactive pro-protein in larval hemolymph was processed into active peptide immediately after bleeding. In the last larval instar, 0.6-kb PP mRNA was expressed in various tissues, of which the fat body was predominant. Its expression in the fat body decreased during the feeding period and then increased during metamorphic process. Juvenile hormone and 20-hydroxyecdysone upregulated its expression. At the embryonic stage, 1.5-kb mRNA, in addition to 0.6-kb mRNA, was expressed from 1 day after oviposition to hatching. PP was thus expressed stage-specifically under hormonal control.

Amino Acid Sequence↗
PubMed2001

Characterization of receptors of insect cytokine, growth-blocking peptide, in human keratinocyte and insect Sf9 cells.

Insect cytokine, growth-blocking peptide (GBP), enhances cell proliferation of human keratinocyte cells with a potency almost equivalent to that of human epidermal growth factor (EGF). GBP consists of 25 amino acid residues containing a core region that shows a striking similarity to the C-terminal beta-loop domain of EGF and disordered N and C termini. The present study demonstrates that, although GBP lacks the N-terminal half-portion of EGF molecule, at least five amino acids of the disordered N-terminal six-amino acid region are indispensable for affecting the cell growth activity of GBP. Upon stimulating mitogenesis in keratinocyte cells, GBP directly binds and activates their EGF receptors. GBP also effects proliferative activity on insect Sf9 cells through the binding and activation of the specific receptor, which consists of a heterodimeric complex: a binding subunit (60 kDa) and a tyrosine phosphorylation subunit (58 kDa). These results indicate that GBP enhances cell proliferation of human keratinocyte and insect Sf9 cells through the activation of EGF and GBP receptors, respectively.

Animals↗
PubMed2001

Effects of noise coherence on stochastic resonance enhancement in a bithreshold system.

We identify a method for optimizing the stochastic resonance (SR) in a symmetric bithreshold device: by varying the coherence of the added noise series. To show SR enhancement via this method, we compare the performance of the system using noise sources with different coherence at normalized amplitude. The normalization of the noise amplitude is based on the mean threshold crossing rate of the Gaussian white noise, which is considered as the standard noise in SR studies, at optimal variance. The amplitude for optimal performance of the Gaussian white noise is determined using a signal-to-noise ratio (Q). The Q measure is also used to compare and examine the system performance for different noise cases. This measure is used because it is particularly sensitive to the effects of coherence on the quality of the output power spectrum.

Journal Article↗
PubMed2001

N-terminal residues of plasmatocyte-spreading peptide possess specific determinants required for biological activity.

Plasmatocyte-spreading peptide (PSP) is a 23-amino acid cytokine that activates a class of insect immune cells called plasmatocytes. The tertiary structure of PSP consists of an unstructured N terminus (residues 1-6) and a well structured core (residues 7-23). A prior study indicated that deletion of the N terminus from PSP eliminated all biological activity. Alanine substitution of the first three residues (Glu(1)-Asn(2)-Phe(3)) further indicated that only replacement of Phe(3) resulted in a loss of activity equal to the N-terminal deletion mutant. Here, we characterized structural determinants of the N terminus. Adding a hydroxyl group to the aromatic ring of Phe(3) (making a Tyr) greatly reduced activity, whereas the addition of a fluorine (p-fluoro) did not. Substitutions that changed the chirality or replaced the aromatic ring of Phe(3) with a branched aliphatic chain (making a Val) also greatly decreased activity. The addition of a methylene group to Val (making a Leu) partially restored activity, whereas the removal of a methylene group from Phe (phenyl-Gly) eliminated all activity. These results indicated that a branched carbon chain with a methylene spacer at the third residue is the minimal structural motif required for activity. The deletion of Glu(1) also eliminated activity. Additional experiments identified the charged N-terminal amine and backbone of Glu(1) as key determinants for activity.

Amines↗
PubMed2001

Structure and activity of the insect cytokine growth-blocking peptide. Essential regions for mitogenic and hemocyte-stimulating activities are separate.

Growth-blocking peptide (GBP) is a 25-amino acid insect cytokine found in Lepidopteran insects that possesses diverse biological activities such as larval growth regulation, cell proliferation, and stimulation of immune cells (plasmatocytes). The tertiary structure of GBP consists of a structured core that contains a disulfide bridge and a short antiparallel beta-sheet (Tyr(11)-Arg(13) and Cys(19)-Pro(21)) and flexible N and C termini (Glu(1)-Gly(6) and Phe(23)-Gln(25)). In this study, deletion and point mutation analogs of GBP were synthesized to investigate the relationship between the structure of GBP and its mitogenic and plasmatocyte spreading activity. The results indicated that deletion of the N-terminal residue, Glu(1), eliminated all plasmatocyte spreading activity but did not reduce mitogenic activity. In contrast, deletion of Phe(23) along with the remainder of the C terminus destroyed all mitogenic activity but only slightly reduced plasmatocyte spreading activity. Therefore, the minimal structure of GBP containing mitogenic activity is 2-23 GBP, whereas that with plasmatocyte spreading activity is 1-22 GBP. NMR analysis indicated that these N- and C-terminal deletion mutants retained a similar core structure to wild-type GBP. Replacement of Asp(16) with either a Glu, Leu, or Asn residue similarly did not alter the core structure of GBP. However, these mutants had no mitogenic activity, although they retained about 50% of their plasmatocyte spreading activity. We conclude that specific residues in the unstructured and structured domains of GBP differentially affect the biological activities of GBP, which suggests the possibility that multifunctional properties of this peptide may be mediated by different forms of a GBP receptor.

Amino Acid Sequence↗
PubMed2001

Differential regulation of Th1 and Th2 functions of NKT cells by CD28 and CD40 costimulatory pathways.

Valpha14 NKT cells produce large amounts of IFN-gamma and IL-4 upon recognition of their specific ligand alpha-galactosylceramide (alpha-GalCer) by their invariant TCR. We show here that NKT cells constitutively express CD28, and that blockade of CD28-CD80/CD86 interactions by anti-CD80 and anti-CD86 mAbs inhibits the alpha-GalCer-induced IFN-gamma and IL-4 production by splenic Valpha14 NKT cells. On the other, the blockade of CD40-CD154 interactions by anti-CD154 mAb inhibited alpha-GalCer-induced IFN-gamma production, but not IL-4 production. Consistent with these findings, CD28-deficient mice showed impaired IFN-gamma and IL-4 production in response to alpha-GalCer stimulation in vitro and in vivo, whereas production of IFN-gamma but not IL-4 was impaired in CD40-deficient mice. Moreover, alpha-GalCer-induced Th1-type responses, represented by enhanced cytotoxic activity of splenic or hepatic mononuclear cells and antimetastatic effect, were impaired in both CD28-deficient mice and CD40-deficient mice. In contrast, alpha-GalCer-induced Th2-type responses, represented by serum IgE and IgG1 elevation, were impaired in the absence of the CD28 costimulatory pathway but not in the absence of the CD40 costimulatory pathway. These results indicate that CD28-CD80/CD86 and CD40-CD154 costimulatory pathways differentially contribute to the regulation of Th1 and Th2 functions of Valpha14 NKT cells in vivo.

Animals↗
PubMed2001

Variation of the agr locus in Staphylococcus aureus isolates from cows with mastitis.

Staphylococcus aureus isolates from mastitic cow's milk were examined for production of alpha-hemolysin and protein A and their accessory gene regulator (agr locus) was analyzed. An inverse relationship between alpha-hemolysin and protein A production was found in most of the 76 isolates, suggesting that the isolates tested may be classified into group I (high alpha-hemolysin/low protein A), II (low alpha-hemolysin/high protein A), or III (low alpha-hemolysin/low protein A). The agr locus, which consists of hld, agrB, agrD, agrC, and agrA, was detected in most of the 78 isolates including two reference strains (Wood 46 and Cowan I) by polymerase chain reaction (PCR). When the PCR products for agr locus of 22 isolates from groups I and II were digested with restriction enzyme MboI, seven bands of the expected lengths were recognized in strain Wood 46, but not in the other isolates tested. Nucleotide sequence analysis of PCR products from six isolates revealed that the agr locus sequence of strain Wood 46 corresponded to that of the published sequence data, but the other five isolates from groups I and II diverged at agrB and agrD sequences and thus the deduced amino acid sequences. These variations of agr locus in S. aureus bovine isolates differed from those reported by Ji et al. [Science 276 (1997) 2027].

Amino Acid Sequence↗
PubMed2001

Alanine-scanning mutagenesis of plasmatocyte spreading peptide identifies critical residues for biological activity.

Plasmatocyte spreading peptide (PSP) is a 23-amino acid cytokine that induces a class of insect immune cells called plasmatocytes to spread on foreign surfaces. The structure of PSP consists of a disordered N terminus (residues 1-6) and a well-defined core (residues 7-23) stabilized by a disulfide bridge between Cys(7) and Cys(19), hydrophobic interactions, and a short beta-hairpin. Structural comparisons also indicate that the core region of PSP adopts an epidermal growth factor (EGF)-like fold very similar to the C-terminal subdomain of EGF-like module 5 of thrombomodulin. To identify residues important for plasmatocyte spreading activity, we bioassayed PSP mutants in which amino acids were either replaced with alanine or deleted. Within the well-defined core of PSP, alanine replacement of Cys(7) and Cys(19) (C7.19A) eliminated all activity. Alanine replacement of Arg(13) reduced activity approximately 1000-fold in comparison to wild-type PSP, whereas replacement of the other charged residues (Asp(16), Arg(18), Lys(20)) surrounding Cys(19) diminished activity to a lesser degree. The point mutants Y11A, T14A, T22A, and F23A had activity identical or only slightly reduced to that of wild-type PSP. The mutant PSP-(7-23) lacked the entire unstructured domain of PSP and was found to have no plasmatocyte spreading activity. Surprisingly, E1A and N2A had higher activity than wild-type PSP, but F3A had almost no activity. We thus concluded that the lack of activity for PSP-(7-23) was largely due to the critical importance of Phe(3). To determine whether reductions in activity correlated with alterations in tertiary structure, we compared the C7.19A, R13A, R18A, and F3A mutants to wild-type PSP by NMR spectroscopy. As expected, the simultaneous replacement of Cys(7) and Cys(19) profoundly affected tertiary structure, but the R13A, R18A, and F3A mutants did not differ from wild-type PSP. Collectively, these results indicate that residues in both the unstructured and structured domains of PSP are required for plasmatocyte-spreading activity.

Alanine↗
PubMed2001

Transitions of macroscopic structures and self-induced chaos observed in plasmas by a dc hollow cathode discharge having features of nonlinear open systems.

A novel experimental investigation is presented on the connection between discontinuous transitions of macroscopic structures of plasma and self-induced chaotic oscillations characterized by the positive Lyapunov exponents lambda(L) through the period-doubling route in a dc hollow cathode discharge, which has features of nonlinear open systems. We have clarified experimentally that there appear different discharge modes accompanying the discontinuous transitions, and detailed qualitative explanations are presented about the mechanism of those transitions. It is shown that fundamental frequencies of the self-induced periodic oscillations with nonpositive lambda(L) change with the changes of discharge current, and the amplitude of chaotic oscillations with the positive lambda(L) jumps up almost one order higher than that of nonchaotic ones with the nonpositive lambda(L). The self-induced chaotic oscillations with the positive lambda(L) have been observed near two edges of discontinuous transitions of plasma structures, suggesting that the chaotic mode is associated with the discontinuous transition of macroscopic structures in some nonlinear open systems.

Journal Article↗