Search PubMed⌕ Search

Biomedical subjects

Y Hashimoto

Publications and source records attributed to Y Hashimoto.

At least 901 records · Page 50Linked to original sources
PubMed1993

Developmental changes in paramesonephric and mesonephric ducts and the external genitalia in swine fetuses during sexual differentiation.

The paramesonephric (Müllerian) duct was first observed in the vicinity of the mesonephric (Wolffian) duct in 30-day-old swine fetuses of both sexes at the level close to the gonad. The paramesonephric duct extended caudally in parallel with the mesonephric duct on day 35 of gestation. By day 40 the paramesonephric duct reached the urogenital sinus. At this stage, the paramesonephric duct began to degenerate in the male, while it continued to develop in the female. This suggests that an anti-Müllerian duct hormone (AMH) is produced before day 40 of gestation. By day 45 of gestation, the mesonephric duct began to decrease in diameter and was accompanied with the involution of the mesonephros in both sexes. By day 60, the male and female mesonephric ducts reduced in their diameter by 70%. Thereafter, the female mesonephric ducts disappeared, while the male ducts developed again. The sex differences was first observed on day 35 in the differentiation of the external genitalia when a small circular urogenital orifice and the anogenital raphe appeared at the sites caudal to the genital tubercle in the male. Such structures were not present in the female. These results suggest that the fetal pig testis is activated to secrete androgen before day 35 of gestation.

Animals↗
PubMed1993

A simple method of hybridohistochemistry for detection of renin mRNA in the mouse kidney.

Hybridohistochemistry was applied for the detection of renin mRNA in the mouse kidney with a digoxigenin-labeled probe, synthesized as the sense and antisense RNAs from Ren-1 cDNA in the presence of digoxigenin-dUTP. Renin mRNA was detected in the juxtaglomerular cells located in the vicinity of the glomerular vascular poles of the kidney using the digoxigenin-labeled antisense RNA as a probe. Using the sense RNA as a probe, no signal was detected anywhere. In neighboring serial sections, the same cells reacted immunohistochemically to rabbit anti-mouse submandibular gland renin serum as in hybridohistochemistry. As we used the probe labeled with digoxigenin as a non-radioisotopic marker, there was no need for special handling other than that in immunohistochemistry. It was concluded that the simple procedure given in the present study is useful for the detection of mRNA.

Animals↗
PubMed1993

Distribution of T cell subsets in chicken lymphoid tissues.

The distributions of T cell subsets in chicken lymphoid tissues were investigated immunohistochemically using monoclonal antibodies (Lc-6, Lc-4) with specificity for chicken CD4 and CD8, respectively. In thymic tissues, CD8+ cells were found only in the cortex, while CD4+ cells were detected not only in the cortex but also in the medulla. The cortex just below the capsule demonstrated no immunoreactivity to either antibody. In the cecal tonsile, CD8+ cells were found restrictly in the subepithelial lamina propria. It was noted that the germinal centers were clearly surrounded with many CD4+ cells in the mid and deep portions of the lamina propria. In the spleen, clusters of CD8+ cells were observed only in the red pulp. Most lymphocytes in the periarteriolar lymphatic tissue and perivenous lymphatic tissue showed a CD4-positive reaction. No lymphocyte in the germinal centers reacted with these two monoclonal antibodies. No immunoreactivity for either CD8 or CD4 was detected anywhere else in the bone marrow or bursa of Fabricius. In the case of exposure to the protein antigen (alum-precipitated bovine serum albumin), CD4+ cells were demonstrated in some germinal centers, which were increased in size, while the areas expressing CD8 in the red pulp were decreased in size. These results suggest that the preferential distributions of T cell subsets are inherent in chicken lymphoid tissues.

Animals↗
PubMed1993

[Effects of various histamine H2-receptor antagonists on gastrointestinal motility and gastric emptying].

Effects of various histamine H2-receptor antagonists (H2-RA) on gastrointestinal motility and gastric emptying were investigated. Ranitidine, nizatidine and cimetidine dose dependently induced contractions over the entire gastrointestinal tract, and the order of their effects was ranitidine > nizatidine > cimetidine. Roxatidine or famotidine had no effects on motility of the gastrointestinal tract. Ranitidine and nizatidine also induced contractions during the postprandial period and facilitated gastric emptying, while cimetidine, roxatidine or famotidine did not influence gastric emptying. Since acid reduction is thought to be the most important element of the treatment of peptic ulcer and reflux esophagitis, it was inferred that administration of a H2-RA selected with consideration of its property of facilitating gastrointestinal motility is effective in the treatment of patients with abnormal gastrointestinal motility.

Animals↗
PubMed1993

Pharmacokinetics of succinylcholine in man.

The pharmacokinetics of succinylcholine (SCh) 1 or 2 mg/kg was studied in 14 anesthetized patients. Arterial blood concentrations of SCh were measured using a high-performance liquid chromatographic assay. The arterial concentration vs. time data were analyzed by log-linear regression and fitted to an one-compartment model. The pharmacokinetic parameters were (SCh 1, n = 8 and 2 mg/kg, n = 6): apparent volume of distribution (16.4 +/- 14.7 and 5.6 +/- 6.8 ml/kg, mean +/- S.D.), total body clearance (40.5 +/- 38.7 and 15.0 +/- 14.8 liter/min), area under the plasma concentration-time curve (124.3 +/- 163.2 and 695.3 +/- 1008.9 min.micrograms/ml), and elimination half-life (16.6 +/- 4.8 and 11.7 +/- 4.5 sec). The rapid disappearance of SCh from the blood may be due to diffusion out of the blood vessel.

Adult↗
PubMed1993

Time and theophylline concentration help explain the recovery of peak flow following acute airways obstruction. Population analysis of a randomised concentration controlled trial.

Peak expiratory flow rate, adverse effects and serum theophylline concentration were measured during treatment of episodes of severe airways obstruction. 174 patients were randomised to target theophylline concentrations of 10 mg/L or 20 mg/L. The recovery of peak flow rate towards normal values was explicable in terms of time and theophylline concentration using semiparametric and parametric nonlinear regression models. In the absence of theophylline, recovery takes place with a half-time of 16 hours. Theophylline is less effective in achieving recovery than the passage of time but achieves 50% of possible recovery at a concentration of 11 mg/L. The action of theophylline is most marked at the start of treatment. It may no longer have important beneficial effects after 72 hours. The incidence of adverse effects increased at theophylline concentrations > 20 mg/L.

Adult↗
PubMed1993

Pharmacological induction of physiologically active nerve growth factor in rat peripheral nervous system.

Intraperitoneal administration of 4-methylcatechol, which is one of the potent stimulators of nerve growth factor (NGF) synthesis in vitro, induced an increase in NGF protein and NGF mRNA in the adult rat heart and submaxillary gland. The increase in NGF protein was successively translocated from the sciatic nerve to sensory or sympathetic ganglia. Repetitive administration of 1,2-diacetoxypropylbenzene, an acetylated form of 4-methylcatechol analog, caused significant elevations of substance P levels in sensory ganglia and tyrosine hydroxylase activity in superior cervical ganglia of infant rats. These observations suggest that both compounds could stimulate NGF synthesis in vivo and that the induced NGF had physiological effects on peripheral neurons.

Animals↗
PubMed1993

Determination by PCR-RFLP of apo E genotype in a Japanese population.

We analyzed apolipoprotein E (apo E) genotypes of 104 randomly sampled Japanese subjects by using the polymerase chain reaction-restriction fragment length polymorphism method in which the apo E genomic DNA was amplified between bases 2849 and 3071. We compared the results thus obtained with their corresponding phenotypes assessed by isoelectric focusing (IEF). The overall frequencies of the genotypes were as follows: epsilon 2:2.4%, epsilon 3:86.5%, and epsilon 4:11.1%, which are essentially identical to those previously reported when the IEF method has been used. The phenotypes and genotypes were identical in all but five cases. We could not determine the phenotypes of four cases by IEF because of an atypical IEF pattern presumably caused by sialylation. In one other case the phenotype initially did not correlate with its genotype but eventually did after neuraminidase treatment. These results indicate that apo E polymorphism of most Japanese people can be determined by analyzing the apo E genome between bases 2849 and 3071.

Apolipoproteins E↗
PubMed1993

Meso-oligodeoxyribonucleotides.

Meso-DNAs, containing L-sugar and D-sugar in an alternate sequence as the backbone [Fig. 1, designated as LD-(dN)n], were prepared as a modificated oligonucleotides of natural- and enantio-DNA. The characteristics of meso-DNAs were analyzed, focusing on LD-(dA)n and LD-(dT)n. These L-sugar containing oligomers show resistancy to phosphodiesterases. Though both LD-(dA)n and LD-(dT)n bound their corresponding complementary homopolymers, apparent differences of the interaction mode between these two meso-DNAs were observed: [1] Concerning the complex formation with the complementary homopolymers, LD-(dA)n favors a triplex formation while LD-(dT)n forms only duplex, and [2] Concerning DNA/RNA selectivity for the complex formation, LD-(dA)n interacted with poly U more strongly than poly dT (RNA-selective), while LD-(dT)n showed stronger interaction with poly dA than poly A (DNA-selective). The similarities in CD-spectra of LD-oligomer/natural polymer complexes to natural complexes suggest that the conformation possesses a structure close to a natural right-handed helix conformation.

Adenine↗
PubMed1993

A method of computing the intersurface distance between opposing teeth.

Conventional methods of clinically evaluating tooth occlusion, employing articulating papers and bite impression materials, do not permit a quantitative analysis the occlusion. To overcome this, the shapes of opposing teeth are digitized in three-dimensions and intersurface distances are evaluated in detail. Computational geometry deals with this as a closest-point problem, i.e. the closest points from each surface point must be found by scanning the opposing surface. This process is, in most cases, quite time consuming. In order to expedite the computations required, we present here an algorithm for this determination, whereby the scan area is successively reduced without complicating the scanning procedure, thus accelerating the search. The efficiency of this algorithm was experimentally proved by comparing its computation time with that of the algorithm previously used.

Algorithms↗
PubMed1993

[Effect of continuous intravenous administration of midazolam and ketamine on respiratory pattern].

The purpose of the study was to investigate the effect of continuous IV administration of midazolam and ketamine on respiratory pattern in six adult volunteers. Midazolam 0.05 mg/kg and ketamine 0.5 mg/kg were given, and then 0.1 mg/kg/hr for midazolam and 1 mg/kg/hr for ketamine were administered continuously. We measured MV, RR and TV (OMR86036), and calculated duty ratio and mean inspiratory flow at the level of 0 and 5 cmH2O CPAP during spontaneous respiration of air with and without 5% CO2. Each parameter was obtained before and 1 hr after the start of IV administration of the drugs. With 5% CO2, MV decreased significantly from 15.5 +/- 1.5 l/min to 11.7 +/- 0.8 l/min at 0 cmH2O CPAP level and from 15.8 +/- 1.8 l/min to 12.6 +/- 1.5 l/min at 5 cmH2O CPAP level, and also mean inspiratory flow decreased significantly from 590 +/- 2 ml/sec to 421 +/- 30 ml/sec at 0 cmH2O CPAP level and from 606 +/- 53 ml/sec to 477 +/- 48 ml/sec at 5 cmH2O CPAP level. TV decreased significantly during sedation at both CPAP levels with or without 5% CO2, while RR and duty ratio tended to increase. It was thought that, when the respiration was stimulated with 5% CO2, the decrease in mean inspiratory flow greatly contributed to the fall in MV during administration of midazolam and ketamine.

Adult↗
PubMed1993

[ABO genotyping by polymerase chain reaction (PCR) and its application to paternity testing].

The authors describe the usefulness of ABO genotyping by polymerase chain reaction (PCR) in paternity testing. Blood samples were obtained from 80 unrelated Japanese (20 samples in each of phenotypes of the ABO blood group system) and 13 cases of disputed paternity. PCR amplification of DNA extracted from blood by a conventional extraction procedure was carried out using the primers (primer 1: CACCGTGGAAGGATGTCCTC; primer 2: AATGTCCACAGTCACTCGCC; primer 3: TGGAGATCCTGACTCCGCTG; primer 4: GTAGAAATCGCCCTCGTCCTT) described by Lee and Chang (J Forensic Sci, Vol. 37). The amplified DNA products using primer 1 and 2 and the amplified DNA products using primer 3 and 4 were digested with Kpn I and Alu I, respectively. The amplified and digested DNA products were then analysed by electrophoresis on polyacrylamide gels. The bands on gels stained with ethidium bromide were observed with UV light and with silver staining. In 20 samples of phenotype A, genotype AA was recognized in five samples and the others were genotype AO. In 20 samples of phenotype B, three samples were genotype BB and the others were genotype BO. According to this procedure, genotypes of phenotype AB and O were clearly and consistently confirmed. In 13 cases of disputed paternity, the paternity of six cases was excluded with some of red cell, serum protein, enzyme genetic markers and HLA systems except ABO phenotype. However, the paternity of three cases out of these six cases was excluded with ABO genotype. This study seems to support the usefulness of ABO genotyping by PCR in paternity testing.

ABO Blood-Group System↗
PubMed1993

[Anxiolytic effect of preoperative showing of "anesthesia video" for surgical patients].

Over 60% of preoperative surgical patients are reported to suffer from preoperative anxiety. Since 1986, an anesthesia video, explaining our routine anesthesia procedures has been shown to elective surgical patients preoperatively at our clinic. In 1990, as our anesthesia method was modified, we revised this video and evaluated the effect of this video on their preoperative anxiety. Female patients, in general, have much more anxiety than male patients, and the female patients of 30-59 years of age were the most anxious about their surgical operations not about anesthesia per se. The patients who were to undergo a major surgery, such as gynecological patients also belonged to the most anxious patient group. After demonstrating the video any patient group including gynecological patients of 30-59 years of age was less anxious about the upcoming anesthesia and surgery.

Adolescent↗
PubMed1993

[Combined spinal and epidural analgesia for caesarean section].

We compared the combined spinal and thoracic epidural analgesia with 2% lidocaine for caesarean section, with spinal analgesia using 2% lidocaine, tetracaine or dibucaine, and also with lumbar epidural analgesia. The analgesia at high thoracic level could be achieved with combined spinal and epidural analgesia more easily than with others. The frequency of side effects with the combined spinal and epidural analgesia, such as hypotension, decrease of fetal heart rate and so on, was less than that with others. In conclusion, the combined spinal and thoracic epidural analgesia with 2% lidocaine is more useful for caesarean section, than the spinal analgesia or the lumbar epidural analgesia alone.

Anesthesia, Epidural↗