Search PubMed⌕ Search

Biomedical subjects

Y Endo

Publications and source records attributed to Y Endo.

At least 307 records · Page 17Linked to original sources
PubMed1997

Function of angiotensin II type 2 receptor in the postglomerular efferent arteriole.

The balance of vasucular tone between afferent (Af-Art) and efferent arterioles (Ef-Art) is a critical determinant of the glomerular hemodynamics. We recently reported that selective activation of angiotensin II type 2 receptor (AT-2R) causes dilation in the Af-Art. However, the functional role of AT-2R in the Ef-Art has not been defined. In the present study, we microperfused rabbit Ef-Art in vitro, and examined the effect of angiotensin II (Ang II; 10(-11) to 10(-8) M) on the luminal diameter in the presence or absence of an AT-2R antagonist PD123319 (PD; 10(-7) M). Angiotensin II caused dose-dependent constriction in Ef-Arts, with a significant constriction occurring at 10(-11) M; at 10(-10) M the diameter decreased by 28 +/- 4% (N = 6). Pretreatment with PD significantly (P < 0.0125) augmented vasoconstrictor action of Ang II; at 10(-10) M the diameter decreased by 44 +/- 4% (N = 6). We then examined whether blockade of Ang II type 1 receptor (AT-1R) uncovers vasodilator action of Ang II mediated by AT-2R. Efferent arterioles were preconstricted by about 40% with norepinephrine and AT-1R was blocked with its selective antagonist CV11974 (CV; 10(-8) M). Angiotensin II added to preconstricted and CV-pretreated Ef-Arts caused a dose-dependent dilation; at 10(-8) M diameter increased by 28 +/- 3% (N = 5). The dilation was completely abolished by simultaneous pretreatment with PD (N = 4). Our results demonstrate that in the Ef-Art selective activation of AT-2R causes vasodilation, which opposes the vasoconstrictor action of Ang II.

Angiotensin II↗
PubMed1997

Psoriasis vulgaris coexistent with epidermolysis bullosa acquisita.

Autoimmune bullous diseases, such as bullous pemphigoid or pemphigus vulgaris, occasionally develop in psoriatic patients. In addition, a novel subepidermal bullous disease with autoantibodies against a lower lamina lucida antigen of 200 kDa has recently been reported in association with psoriasis. We describe here a patient with psoriasis vulgaris who developed epidermolysis bullosa acquisita (EBA). Direct immunofluorescence revealed linear deposition of IgG and C3 at the basement membrane zone. The patient's serum bound to the dermal side of salt-split normal human skin. However, immunoblot analysis demonstrated that the patient's serum reacted with an EBA antigen of 290 kDa. EBA should be included in the list of autoimmune diseases associated with psoriasis vulgaris.

Adult↗
PubMed1997

[Factors affecting the continuation of at home treatment].

Study of 125 terminal patients with malignancies who received our SECOM Home Medical Service revealed that the duration of at-home treatment was positively correlated with pain control, absence of ascites and the good performance status scale, but not with the patients wish to be treated at home, information of the malignancy or the medical treatment modalities. These results suggest that terminal patients could be encouraged to return home for at-home treatment as soon as the symptoms are controlled even if not perfectly.

Adult↗
PubMed1997

Mechanism of substrate recognition by the ribotoxin, alpha-sarcin.

The substrate recognition and catalytic mechanisms of alpha-sarcin were explored with kinetic method by using synthetic 25-mer RNA mimicking the alpha-sarcin/ricin loop in 23S rRNA of E. coli ribosomes. The oligomer containing deoxy-G at the site of alpha-sarcin (G14) was a potent competitive inhibitor. The RNA having deoxy-G8 however, increases the Kcat value by about five times but without significant alteration on Km. Surprisingly, the deletion of G8 makes the oligomer become a strong noncompetitive inhibitor of the enzyme. These results suggested that there are at least two sites in the RNA substrate which are recognized by alpha-sarcin, one is the G8 bulge or at around its neighbor and the other is the GAGA in the sarcin/ricin loop of the rRNA.

Base Sequence↗
PubMed1997

In vitro selection of aptamers that bind to ribosome-inactivating toxins.

Ribosome-inactivating proteins, such as ricin, pepocin and gypsophilin, catalyze the hydrolysis of a single N-glycosidic bond at a specific position in rRNAs. Aptamers targeting pepocin were selected from a random sequence RNA pool that spanned 30 positions. After 8 rounds, the anti-pepocin aptamers were sequenced and a conserved hairpin motif was identified. Interestingly, the selected motif is quite different from the toxin-binding domains of rRNAs.

Base Sequence↗
PubMed1996

Purification, characterization and subcellular localization of a type-1 ribosome-inactivating protein from the sarcocarp of Cucurbita pepo.

The flesh of the fruit of Cucurbita pepo contains a type-1 ribosome-inactivating protein (RIP), which we named pepocin. Pepocin was purified to apparent homogeneity by acid fractionation, ion-exchange chromatography and adsorption chromatography. The protein was found to have a molecular mass of 26 kDa and a pI of about 9.9. It does not contain glycosidic linkages. The protein inhibits protein synthesis in a rabbit-reticulocyte lysate with an IC50 (concentration causing 50% inhibition) of 15.4 pM, and depurinates 28S rRNA in the ribosomes of the lysate in a manner identical to that of ricin A-chain and other RIP. The enzyme is also active on wheat-germ ribosomes and on Escherichia coli ribosomes. The sequence of the N-terminal 20 amino acids of the protein reveals a close relationship to other RIP. Immunoelectron-microscopic localization of pepocin in the sarcocarp shows that the protein is predominantly localized in intercellular spaces. In addition, the immunolocalized signals are observed in leaf intercellular spaces.

Amino Acid Sequence↗
PubMed1996

Structure and chromosomal assignment of the human cyclin G gene.

Human cDNA and genomic DNA encoding cyclin G were cloned and analyzed. The amino acid sequence of cyclin G is well conserved among mammals. Human cyclin G (295 amino acids) has one extra Thr at residue 6 compared with rat and mouse cyclin G (294 amino acids). The genomic DNA for human cyclin G consists of six exons, and in the first intron, one distinct putative binding site for the p53 tumor suppressor gene product (GCACAAGCCCAGGCTAGTCC) was detected. We performed chromosome mapping utilizing the fluorescence in situ hybridization (FISH) technique using both cDNA and genomic DNA for cyclin G. FISH localizes human cyclin G to the 5q32-q34 region. In the vicinity of the chromosomal location of human cyclin G, four cases of chromosomal translocations in human hematopoietic tumors have been reported, such as a subgroup of chronic myelomonocytic leukemia, non-Hodgkin lymphoma, and acute lymphocytic leukemia. It is therefore important to examine whether chromosomal translocations around this region cause aberrant cyclin G expression in a manner that is causally related to leukemia.

Amino Acid Sequence↗
PubMed1996

A role of peroxides in Ca2+ ionophore-induced apoptosis in cultured rat cortical neurons.

The implication of reactive oxygen species for the Ca2+ ionophore ionomycin-induced apoptosis was investigated in cultured cortical neurons from embryonic rats. Ionomycin increased the production of intracellular peroxides as measured by flow cytometric analysis with 6-carboxy-2'7'-dichorodihydrofluorescein diacetate, di(acetoxymethyl ester). Low doses of ionomycin increased the level of manganese-superoxide dismutase (Mn-SOD). In addition, N-acetyl-L-cysteine prevented apoptotic neuronal death induced by ionomycin in a dose-dependent manner. Buthionine sulfoximine suppressed the effect of N-acetyl-L-cysteine. These results suggest that peroxides and redox-regulation play an important role in the apoptosis of neurons induced by elevation of intracellular Ca2+ concentration.

Acetylcysteine↗
PubMed1996

Galanin-containing nerve terminals that are involved in a dual innervation of the striated muscles of the rat esophagus.

Galanin (GAL)-immunoreactive axon terminals on motor endplates of the esophageal striated muscles were demonstrated in mice, guinea-pigs and rats. The GAL-terminals innervated 33% of AChE-reactive motor endplates in mice and 6% of those in guinea-pigs. Double immunostaining revealed that separate GAL- and CGRP-positive terminals were localized within the same motor endplates in mice and rats. The GAL and CGRP terminals had different morphologies. No CGRP-immunoreactivity was found on motor endplates of the guinea-pig esophagus. Double immunostaining in rats showed that 68% of motor endplates with CGRP-nerve terminals were also supplied by GAL-nerve terminals, suggesting that the majority of esophageal striated muscles receive a dual innervation of GAL-and CGRP/ACh-containing terminals. By immuno-electronmicroscopy in the rat esophagus. GAL-immunoreaction was found in a small type of nerve terminals that possessed many large cored vesicles (90-130 nm) with intense immunoreaction. Larger GAL-negative nerve terminals with a cluster of small clear vesicle (40-50 nm), which seemed to be ACh-containing nerve terminals, were adjacent to a depression or slight protrusion of the sarcolemma and well-developed folds in the muscle fibers. At the motor endplates, the GAL-positive terminals made a synaptic contact via basement membrane with the sarcolemma of the muscle fibers, which was characterized by post-synaptic intense electron density. In most of all situations, in which the GAL-positive terminals and GAL-negative or -positive terminals were adjacent to each other and were also apposed to the striated muscles, the terminals were separated by attenuated sheet- or tongue-like cytoplasmic processes that appeared to originate from Schwann cells. Thus, the GAL-nerve terminals seem to provide a direct innervation of the striated muscle fibers rather than innervating the ACh-containing motor nerve terminals adjacent to the GAL-terminals.

Animals↗
PubMed1996

Cloning and characterization of the human lectin P35 gene and its related gene.

We previously cloned a novel human lectin, designated P35, with both collagen-like and fibrinogen-like domains. P35 recognizes GlcNAc residues and is opsonic toward microorganisms. The overall structure of P35 closely resembles those of two pig ficolins that are putative TGF-beta 1-binding proteins. In this study, we analyzed the exon-intron structure and chromosomal location of the P35 gene as well as its structural relationship to splicing variants. In addition, we isolated another distinct genomic clone corresponding to the upstream region of a P35-related gene that has an exon organization closely resembling that of the P35 gene. The sequences of exons in the P35-related gene were identical to the cDNA sequence reported for "human ficolin." Northern blotting revealed that the P35 gene is expressed mainly in liver, whereas the P35-related gene is expressed in lung and peripheral blood leukocytes, demonstrating tissue-specific expression of these two genes. Both genes were assigned to a closely related region of chromosome 9 at 9q34.

Amino Acid Sequence↗
PubMed1996

Cloning of a novel signal-transducing adaptor molecule containing an SH3 domain and ITAM.

We molecularly cloned a cDNA coding for a novel phosphotyrosine molecule with a 70 kDa molecular mass, named STAM (signal transducing adaptor molecule), which is tyrosine-phosphorylated rapidly after stimulation with various cytokines such as IL-2, IL-3, IL-4, IL-7, GM-CSF, EGF and PDGF. STAM contains an SH3 (Src-homology 3) domain and the ITAM (immunoreceptor tyrosine-based activation motif), suggesting that STAM acts as an adaptor molecule involved in signal transducing pathways from the cytokine receptors.

Adaptor Proteins, Signal Transducing↗
PubMed1996

PIG-B, a membrane protein of the endoplasmic reticulum with a large lumenal domain, is involved in transferring the third mannose of the GPI anchor.

Many eukaryotic cell surface proteins are bound to the membrane via the glycosylphosphatidylinositol (GPI) anchor that is covalently linked to their carboxy-terminus. The GPI anchor precursor is synthesized in the endoplasmic reticulum (ER) and post-translationally linked to protein. We cloned a human gene termed PIG-B (phosphatidylinositol glycan of complementation class B) that is involved in transferring the third mannose. PIG-B encodes a 554 amino acid, ER transmembrane protein with an amino-terminal portion of approximately 60 amino acids on the cytoplasmic side and a large carboxy-terminal portion of 470 amino acids within the ER lumen. A mutant PIG-B lacking the cytoplasmic portion remains active, indicating that the functional site of PIG-B resides on the lumenal side of the ER membrane. The PIG-B gene was localized to chromosome 15 at q21-q22. This autosomal location would explain why PIG-B is not involved in the defective GPI anchor synthesis in paroxysmal nocturnal hemoglobinuria, which is always caused by a somatic mutation of the X-linked PIG-A gene.

Amino Acid Sequence↗
PubMed1996

Cloning and characterization of the murine GPI anchor synthesis gene Pigf, a homologue of the human PIGF gene.

Many eukaryotic proteins are bound to the plasma membrane via a glycosylphosphatidylinositol (GPI) anchor. Its core backbone, which is conserved in different organisms, is synthesized in the endoplasmic reticulum by the sequential addition of glycan components to phosphatidylinositol. One of the human GPI synthesis genes, PIGF (phosphatidylinositol glycan complementation class F), which is involved late in the synthesis pathway, has been cloned. In this study, we isolated complementary and genomic clones of Pigf, a murine counterpart of PIGF. Pigf encodes a 219 amino acid protein that complements a class F mutation. The Pigf gene consists of six exons spanning 30 kb and was mapped to chromosome 17 at 17E4-E5. These features are very similar to PIGF, thus demonstrating the interspecies conservation of structure, function, gene organization, and genetic locus between these GPI synthesis genes. The results also extend a region in murine distal chromosome 17 that is syntenic to human chromosome 2p16-p22.

Amino Acid Sequence↗
PubMed1996

A novel human serum lectin with collagen- and fibrinogen-like domains that functions as an opsonin.

Collectins are C-type animal lectins with both collagenous and carbohydrate recognition domains and are involved in the first line host defense against pathogens. We report here a novel Ca(2+)-dependent and GlcNAc-binding lectin consisting of subunits of 35 kDa (P35) with a collagen-like sequence. When P35 is isolated from human serum, it forms a homopolymer by means of intermolecular disulfide bonding, as is the case with collectins. P35 cDNA was cloned from a human liver cDNA library, and the deduced amino acid sequence of 313 residues revealed that the mature form of P35 consists mainly of collagen- and fibrinogen-like domains. The latter contained two potential Ca(2+)-binding sites that may be involved in carbohydrate binding. The overall sequence of P35 was highly homologous to porcine ficolins alpha and beta. Northern blots of various human tissues showed that the major product of the 1.3-kilobase-long P35 transcript is expressed in liver. P35 enhanced phagocytosis of Salmonella typhimurium by neutrophils, suggesting an opsonic effect via the collagen region. P35 was found to bind to GlcNAc-conjugated bovine serum albumin, a neoglycoprotein, as well as to neoglycolipids containing complex-type oligosaccharides derived from glycoproteins, suggesting that P35 recognizes GlcNAc residues such as those found in microbial glycoconjugates and complex-type oligosaccharides. Therefore, P35 represents a new type of GlcNAc-binding lectin with structural and functional similarities to collectins involved in innate immunity.

Acetylglucosamine↗
PubMed1996

Molecular cloning and characterization of murine IL-12 genes.

IL-12 is a heterodimeric cytokine composed of two covalently linked chains, p40 and p35. p40 expression appears to be restricted to monocytes/macrophages and B cells and is highly regulated, while p35 is more ubiquitously and constitutively expressed. To investigate the mechanism involved in the regulation of IL-12 expression, we molecularly cloned and characterized the murine p40 and p35 genes. The p40 gene spans over 14 kb, consists of eight exons and seven introns, and was shown to be localized on chromosome 11A5-B2 by fluorescence in situ hybridization. A single major transcription initiation site was detected by primer extension analysis, and a TATA box was found at approximately 30 bp upstream from the transcription initiation site. The 5' flanking region preceding the transcription initiation site induced the enhanced expression of a promoterless reporter gene after LPS stimulation when transfected into a macrophage-like cell line. In contrast, the p35 gene spans over 8 kb and consists of seven exons and six introns on chromosome 6C, and multiple transcription initiation sites were detected. The 5' flanking region lacks canonical TATA and CAAT boxes at the appropriate position, but, instead, contains GC-rich sequences and constitutively mediated promoter activity when placed upstream of a promoterless reporter gene and transfected into a B cell lymphoma cell line. Thus, the characteristics of promoter regions of p40 and p35 genes are quite different, and this would account for the different regulations of p40 and p35 expression.

Amino Acid Sequence↗
PubMed1996

Impairment of maze learning in rats following long-term glucocorticoid treatments.

The present study examined the influence of long-term glucocorticoid treatment on a maze learning task on a radial 8-arm maze in rats. Either 100 mg cholesterol (as a control), or corticosterone, bead was implanted in rats for a period of 3 months, beginning at 12 weeks of age. The effect of this treatment on the maze learning task was evaluated during or 4 weeks after the treatments. In both experiments, corticosterone-implanted rats showed an increase in number of trials to attain at least seven correct choices in the first eight choices in five consecutive trials (P < 0.05). We concluded that long-term glucocorticoid exposure resulted in an impairment of the hippocampal functions, i.e. learning and memory, similar to that found in aged hippocampus.

Animals↗
PubMed1996

A novel clonality assay for the mouse: application to hepatocellular carcinomas induced with diethylnitrosamine.

A polymerase chain reaction-based clonality assay was developed for mouse tumors and cellular proliferations of the mouse. This assay was based on a polymorphism of the phosphoglucokinase-1 (Pgk-1) gene on the X chromosome between two different mouse subspecies and the different methylation patterns of active and inactive X chromosomes. All 15 tumor cell lines examined showed one of the two allelic bands on gel electrophoresis, which is consistent with the theory that tumor cell lines are monoclonally derived. This suggests that the Pgk-1 system is useful for clonality studies that will give insight into cancer development. With this method, nine hepatocellular carcinomas were examined, and eight showed monoallelic patterns. The remaining tumor exhibited a biallelic pattern, which is suggestive of polyclonal origin; however, other possibilities are discussed.

Animals↗