Search PubMed⌕ Search

Biomedical subjects

Y Campos

Publications and source records attributed to Y Campos.

At least 19 recordsLinked to original sources

NARP-MILS syndrome caused by 8993 T>G mitochondrial DNA mutation: a clinical, genetic and neuropathological study.

The 8993 T>G mutation in mitochondrial DNA has been associated with variable syndromes of differing severity ranging from maternally inherited Leigh's syndrome (MILS) to neuropathy, ataxia, retinitis pigmentosa (NARP), depending on the mutation loads in affected patients. We report a kindred with several members in the same generation suffering NARP or Leigh's syndrome due to a 8993 T>G mutation. Post-mortem studies of the brain in one affected member clinically presenting with a neurological disorder intermediate between adult Leigh's syndrome and NARP showed symmetrical lesions of the basal ganglia and brainstem closely resembling those usually described in typical Leigh's syndrome. Analysis of mtDNA in different tissues showed a high proportion of mutant genome in brainstem, cerebral cortex, putamen, cerebellum and thalamus. These observations illustrate the continuum of clinical and neuropathological manifestations associated with the 8993 T>G mutation of the mtDNA.

Adenosine Triphosphatases↗

Increased muscle nucleoside levels associated with a novel frameshift mutation in the thymidine phosphorylase gene in a Spanish patient with MNGIE.

We studied a patient with the cardinal features of mitochondrial gastrointestinal encephalomyopathy (MNGIE). Two of his siblings showed a similar clinical picture. Muscle histochemistry displayed ragged red fibres (RRF) which were COX negative and biochemistry revealed combined defects of complexes III and IV of the mitochondrial respiratory chain. Southern-blot analysis showed multiple mtDNA deletions. Molecular analysis of the ECGF1 gene revealed the presence of a homozygous deletion of 20 base pairs in exon 10, c.1460_1479delGACGGCCCCGCGCTCAGCGG, resulting in a frameshift and synthesis of a protein larger than the wild-type. Thymidine and deoxyuridine accumulation was detected in muscle, indicating loss-of-function of thymidine phosphorylase (TP).

Blotting, Southern↗

Four novel mutations in patients from the Middle East with the infantile form of GM1-gangliosidosis.

GM1-gangliosidosis is a lysosomal storage disorder caused by a deficiency of beta-galactosidase. It is mainly characterized by progressive neurodegeneration and in its most severe infantile form it leads to death before the age of four. We have performed molecular analysis of five patients with the infantile form of GM1-gangliosidosis originating from the Middle East (two from Saudi Arabia and three from the United Arab Emirates). We have identified four novel mutations and one previously reported mutation in the GLB1 gene. The first novel mutation found in the homoallelic state in a patient from Saudi Arabia, is a c.171C>G transversion in exon 2 which creates a premature stop codon. Northern blot analysis in fibroblasts from the patient showed no mRNA and expression studies in COS-1 cells showed complete absence of the 85kDa precursor protein and no catalytic activity. The second novel mutation is a splicing error in intron 2, c.245+1G>A. This mutation was found in the heteroallelic state in a patient from Saudi Arabia, the second mutation being the previously described c.145C>T mutation. The third novel mutation is a missense mutation in exon 4, c.451G>T, found in the homoallelic state in a patient from the United Arab Emirates. Expression studies of this mutation in COS-1 cells showed complete absence of the 85kDa precursor protein and no catalytic activity. The fourth novel mutation is a splicing mutation in intron 8, c.914+4A>G, found in the homoallelic state in two siblings from the United Arab Emirates. This study has revealed genetic heterogeneity of the beta-galactosidase deficiency in the Arabic population [corrected]

Animals↗

Myoglobinuria and COX deficiency in a patient taking cerivastatin and gemfibrozil.

The authors describe a patient who presented with myoglobinuria after starting cerivastatin-gemfibrozil therapy. Muscle histochemistry revealed ragged-red fibers and cytochrome c oxidase negative (COX) fibers, and biochemistry showed a defect of COX activity. Immunoblot analysis showed a 60% reduction of COX I and COX II polypeptides. Cerivastatin myotoxicity might be related to a depletion of essential metabolites needed to anchor COX subunit I to mitochondrial membrane.

Aged↗

Mutation analysis in 16 patients with mtDNA depletion.

Sixteen unrelated Southern European patients with the mitochondrial depletion syndrome (MDS) were analyzed for mutations in the TK2 and DGUOK genes. Three novel mutations were identified in TK2 (R183G, R254X, and 142insG). When we analyzed additional genes involved in the dNTPs pool, such as SLC25A19 (DNC) and NT5M (d-NT2), we did not detect mutations. The current study suggest that scanning the TK2, DGUOK, SLC25A19, and NT5M genes is likely to help about 10% of MDS families in terms of genetic counseling. Also, our findings indicate that genotype-phenotype correlations are not straightforward in MDS.

Age of Onset↗

Two pathogenic mutations in the mitochondrial DNA tRNA Leu(UUR) gene (T3258C and A3280G) resulting in variable clinical phenotypes.

We studied two patients with ragged-red fibers and combined defects of the mitochondrial respiratory chain in their muscle biopsy. One had mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes, and harbored a T3258C transition in the tRNA(Leu(UUR)) gene. The other showed myopathy plus cardiomyopathy and had an A3280G mutation in the same gene. Both mutations were heteroplasmic, abundant in muscle of the patients, less abundant in blood, and still less abundant in blood from their maternal relatives. In both patients, single muscle fiber analysis revealed greater abundance of mutant genomes in ragged-red fibers than in normal fibers, supporting the pathogenicity of both mutations.

Acidosis, Lactic↗

New mutations in two Dutch patients with early infantile galactosialidosis.

Galactosialidosis is an autosomal recessive lysosomal storage disease caused by a combined deficiency of lysosomal beta-galactosidase and neuraminidase as a result of a primary defect in the protective protein/cathepsin A (PPCA). We report the first 2 Dutch cases of early infantile galactosialidosis, both presenting with neonatal ascites. The defect was identified in urine, leukocytes, and fibroblasts. Residual activity was determined with a modified assay for cathepsin A and was <5% in leukocytes and <1% in fibroblasts. Histological examination of the placenta in case 1 showed extensive vacuolization in all cell types. Northern blot analysis of RNA isolated from the patients' cultured fibroblasts showed substantially decreased levels of the PPCA transcript, which nevertheless had the correct size of 2 kb. Mutation analysis of both mRNA and genomic DNA from the patients identified two novel mutations in the PPCA locus. Case 1 was a compound heterozygote, with a single missense mutation in one allele, which resulted in Gly57Ser amino acid substitution, and a single C insertion at nucleotide position 899 in the second allele, which gave rise to a frame shift and premature termination codon. Case 2 was homozygous for the same C899 insertion found in case 1.

Base Sequence↗

Intestinal pseudo-obstruction and urinary retention: cardinal features of a mitochondrial DNA-related disease.

The syndrome of mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS) is a multisystemic disorder associated in most of the patients with an A to G transition at nucleotide position 3243 in the transfer RNA (tRNA)Leu(UUR) (A3243G) of the mitochondrial DNA. This syndrome is characterized by the preponderant involvement of skeletal muscle and central nervous system, but urinary or gastrointestinal symptoms are seldom documented. Here we report an unusual case of a 52-year-old woman with a clinical phenotype characterized by encephalopathy, left hemiparesis, urinary retention and gastrointestinal pseudo-obstruction. She had the classical A3243G mitochondrial DNA point mutation of MELAS syndrome. We also present a clinically heterogeneous multigenerational pedigree with several affected members in the maternal lineage.

Adult↗

Cosegregation of the mitochondrial DNA A1555G and G4309A mutations results in deafness and mitochondrial myopathy.

We report a patient with progressive external ophthalmoplegia (PEO), exercise intolerance, and deafness after aminoglycoside exposure, harboring two pathogenic mutations in her mtDNA: an A1555G in the 12S rRNA gene and a G4309A in the tRNA(Ile) gene. Muscle histochemistry showed abundant ragged-red fibers, and biochemistry revealed normal respiratory chain function. The A1555G mutation was homoplasmic in blood from the proband and from all maternal relatives. The G4309A mutation was abundant in the proband's muscle, less abundant in her blood, still less abundant in the mother's blood, and absent in blood from other maternal relatives. Family members were asymptomatic. Our data suggest that the former mutation resulted in aminoglycoside-induced deafness and the latter caused PEO plus exercise intolerance.

Adult↗

Molecular analysis of the superoxide dismutase 1 gene in Spanish patients with sporadic or familial amyotrophic lateral sclerosis.

We performed a genetic analysis of the Cu/Zn superoxide dismutase gene (SOD1) in Spanish patients with sporadic or familial amyotrophic lateral sclerosis (ALS). We found mutations in 2 of 11 families (18%) with ALS. In addition, 1 of the 87 sporadic ALS patients studied harbored a mutation in the same gene. We identified G37R in exon 2 of the SOD1 gene in 1 family. Another patient, with sporadic ALS, showed a novel N65S in exon 3. In addition, we found a novel I112M in exon 4 in another family. Our data highlight the genetic heterogeneity of patients with ALS harboring mutations in the SOD1 gene and confirm that families with autosomal dominant inheritance of the trait, regardless of their ethnic background, are more likely to carry mutations in such a gene.

Amino Acid Sequence↗

Mitochondrial DNA point mutation in the COI gene in a patient with McArdle's disease.

We studied a 57-year-old female patient with clinical and biochemical evidences of McArdle's disease. Her muscle biopsy also revealed signs of mitochondrial proliferation, scattered RRF, and a deficit in complex I of the respiratory chain. Molecular genetic analysis showed that the patient was heterozygous for the most common mutation at codon 49 in the myophosphorylase gene. Mitochondrial DNA analysis of muscle tissue revealed an additional G-to-A transition at nucleotide position 7444 in the cytochrome c oxidase subunit I (COI) gene.

Codon↗

Mitochondrial dysfunction associated with a mutation in the Notch3 gene in a CADASIL family.

BACKGROUND: Cerebral autosomal arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) is characterized by recurrent subcortical ischemic strokes and dementia caused by mutations in the Notch3 gene. In Drosophila melanogaster, Notch signaling has a pleiotropic effect, affecting most tissues of the organism during development. OBJECTIVE: To characterize a potential mitochondrial dysfunction associated with mutations in the Notch3 gene. METHODS: Biochemical, histochemical, molecular, and genetic analyses were performed on muscle biopsy specimens and fibroblasts obtained from patients of a Spanish family with CADASIL. Additional biochemical and molecular analyses of the N(55e11) mutant of D. melanogaster were performed. RESULTS: In muscle biopsy specimens, a significant decrease was found in the activity of complex I (NADH [reduced form of nicotinamide adenine dinucleotide] dehydrogenase), and in one patient, histochemical analysis showed the presence of ragged-red fibers with abnormal cytochrome c oxidase staining. Reduced fibroblast activity of complex V (ATP synthase) was found. Supporting data on patients with CADASIL, it was found that the mutation N(55e11) in Drosophila decreases the activity of mitochondrial respiratory complexes I and V. CONCLUSIONS: Mitochondrial respiratory chain activity responds, directly or indirectly, to the Notch signaling pathway. Mitochondrial dysfunction in patients with CADASIL may be an epiphenomenon, but results of this study suggest that the pathophysiology of the disease could include a defect in oxidative phosphorylation.

Adult↗

Early-onset multisystem mitochondrial disorder caused by a nonsense mutation in the mitochondrial DNA cytochrome C oxidase II gene.

We report the first nonsense mutation (G7896A) in the mtDNA gene for subunit II of cytochrome c oxidase (COX) in a patient with early-onset multisystem disease and COX deficiency in muscle. The mutation was heteroplasmic in muscle, blood, and fibroblasts from the patient and abundantly present in COX-deficient fibers, but less abundant in COX-positive fibers; it was not found in blood samples from the patient's asymptomatic maternal relatives. Immunoblot analysis showed a reduced concentration of both COX II and COX I polypeptides, suggesting impaired assembly of COX holoenzyme.

Child, Preschool↗

A new mtDNA mutation in the tRNA(Leu(UUR)) gene associated with ocular myopathy.

We studied a patient with ptosis, ophthalmoparesis, and exercise intolerance who showed in her muscle biopsy ragged-red fibers and combined defects of the complexes I and IV of the mitochondrial respiratory chain. Molecular analysis revealed a T3273C transition in the mitochondrial DNA tRNA(Leu(UUR)) gene. The mutation was heteroplasmic and very abundant in muscle from the proposita, less abundant in her other tissues studied, and still less abundant in blood from her maternal relatives. Single muscle fiber analysis showed significantly higher levels of mutant genomes in ragged-red fibers than in normal fibers. The T3273C mutation affects a strictly conserved base pair in the anticodon stem and was not found in controls, thus satisfying the accepted criteria for pathogenicity.

Base Sequence↗