Biomedical subjects

X Zhang

Publications and source records attributed to X Zhang.

At least 469 records · Page 26Linked to original sources

PubMed2001

Two linked blood pressure quantitative trait loci on chromosome 10 defined by dahl rat congenic strains.

Aquantitative trait locus (QTL) for blood pressure was previously detected on rat chromosome 10 (RNO10) by linkage analysis and confirmed by the construction of congenic strains that encompass large regions of RNO10. In the present study, the rat RNO10 blood pressure QTL was dissected by the further construction of congenic substrains. The original congenic region was shown to contain 2 blood pressure QTLs (QTL 1 and QTL 2) approximately 24 cM apart. These were localized to a <2.6-cM region between markers D10Rat27 and D10Rat24 for QTL 1 and to a <3.2-cM region between D10Rat12 and D10Mco70 for QTL 2. Comparative mapping suggests that the rat RNO10 QTL 2 could be localized very close to a blood pressure QTL described by sib-pair analysis on human chromosome 17, but this is not definitively established because of multiple and complex chromosomal rearrangements between rodents and humans.

Animals↗

PubMed2001

Genomic growth hormone gene polymorphisms in native Chinese chickens.

Chicken growth hormone (cGH), a polypeptide hormone synthesized in and secreted by the pituitary gland, is involved in a wide variety of physiological functions such as growth, body composition, egg production, aging, and reproduction. Chicken growth hormone polymorphisms have been reported to be associated with certain phenotypes. Our objective is to investigate the GH gene polymorphism in selected strains of native Chinese chickens. Yellow Wai Chow GH gene was characterized by sequencing and was found to have one silent substitution, 31 insertions, and other substitutions spread among the introns. In addition, a novel Mspl site has been identified and characterized in the first intron. Allele frequencies of the intron 1 polymorphism were characterized among 28 populations of native Chinese chickens. Thus, polymorphism of the cGH gene may be useful in phylogenetic analysis, as well as in the design of breeding programs.

Alleles↗

PubMed2001

Somatostatin receptor-specific analogs: effects on cell proliferation and growth hormone secretion in human somatotroph tumors.

Somatostatin (SST) acts through a family of seven transmembrane domain G protein-coupled receptors to inhibit hormone secretion and cell proliferation in a variety of neuroendocrine tissues. In normal and neoplastic human pituitary somatotroph cells, SST-specific receptor types (SSTR) 1, 2, 3, and 5 are prevalently expressed, and SST and its analogs have been shown to inhibit GH secretion. However, in somatotroph adenomas, little is known regarding: 1) effects of SST and its analogs on pituitary tumor proliferation; 2) the relationship between the effects of SST analogs on GH secretion and tumor cell proliferation; and 3) whether SSTR expression predicts the antiproliferative effects of SST analogs in human somatotroph tumors. We investigated the effects of SST-14, lanreotide, and SSTR 2 (BIM-23190) and SSTR 5 (BIM-23268) specific analogs in 18 somatotroph pituitary adenomas in primary culture. Our results showed that cell proliferation was significantly inhibited by SST-14, lanreotide, BIM-23190, and BIM-23268 in 4, 7, 3, and 4 tumors, respectively (range of proliferation suppression 5-60%; median, 16%). Tumors that were responsive to SSTR 2- and 5-specific analogs were also responsive to lanreotide. SST-14 inhibited GH secretion in 8 of 13 tumors; lanreotide, BIM-23190, and BIM-23268 inhibited GH secretion in six tumors each (range of GH secretion inhibition 23-43%; median 33%). SSTR 2 and 5 messenger RNA was expressed in all tumors investigated, whereas SSTR 1 and 3 messenger RNA was expressed in 11 and 12 tumors, respectively. We observed a dissociation between the in vitro effects of SST-14 or lanreotide on tumor cell proliferation and the effects on GH secretion in human somatotroph tumors. Although differences in receptor concentration and the presence of other SST receptor subtypes may play a role, the presence of SSTR 2 and/or 5 did not have a predictive value. These data suggest that inhibition of cell proliferation occurs independently of effects on GH secretory pathways. Further studies are needed to clarify the mechanism of SST induced antiproliferative effects.

Acromegaly↗

PubMed2001

The bacterium Burkholderia gladioli strain CHB101 produces two different kinds of chitinases belonging to families 18 and 19 of the glycosyl hydrolases.

Two genes (chiA and chiB) coding for chitanases A and B (ChiA and ChiB) were isolated from the chitinolytic bacterium, Burkholderia gladioli strain CHB101. chiA contains an open reading frame that encodes a protein of 343 amino acids, whereas chiB encodes a protein of 307 amino acids. The deduced amino acid sequence of ChiA showed a high similarity to those of microbial chitinases belonging to family 18 of the glycosyl hydrolases, while ChiB showed significant sequence similarity to plant chitinases and Streptomyces spp. chitinases belonging to family 19.

Journal Article↗

PubMed2001

Estrogen inhibits lipopolysaccharide-induced tumor necrosis factor-alpha release from murine macrophages.

During their reproductive years, female have a lower risk for atherosclerosis as compared with age-matched males, although the mechanisms behind this are not clearly understood. Cytokines, including TNF-alpha play an important role in the pathogenesis of atherosclerosis. We therefore evaluated whether or not there was any difference between 17 beta-estradiol and testosterone in modulating TNF-alpha release from murine bone marrow-derived macrophages (BMM) in vitro. Cells were incubated with or without physiological concentrations (10(-10)-10(-8) M) of 17 beta-estradiol or testosterone for 48 h, followed by an additional 6 h in the absence or presence of lipopolysaccharide (LPS; 10 micrograms/ml). The amount of TNF-alpha released into the culture medium was determined with radioimmunoassay. We found that 17 beta-estradiol or testosterone alone did not affect TNF-alpha release from BMM as compared to untreated controls. Preincubation with 17 beta-estradiol significantly inhibited LPS-induced TNF-alpha release by 18.15% (p < 0.05). 25.28% (p < 0.05) and 40.83% (p < 0.01) for 10(-10), 10(-9) and 10(-8) M of 17 beta-estradiol, respectively, as compared to LPS alone. In contrast, testosterone tested for 3 concentrations did not significantly effect TNF-alpha release induced by LPS. The results indicate that 17 beta-estradiol, but not testosterone, inhibits TNF-alpha release from LPS-stimulated macrophages, which may be one of the mechanisms by which estrogen protects against atherosclerosis.

Animals↗

PubMed2001

Preonset studies of spondyloepiphyseal dysplasia tarda caused by a novel 2-base pair deletion in SEDL encoding sedlin.

Spondyloepiphyseal dysplasia tarda (SEDT), an X-linked recessive skeletal disorder, presents with disproportionate short stature and "barrel-chest" deformity in affected (hemizygous) adolescent boys. In four reported families to date, mutations in a gene designated SEDL (spondyloepiphyseal dysplasia late) cosegregate with SEDT. We diagnosed SEDT in a short-stature, kyphotic 15-year-old boy because of his characteristic vertebral malformations. Clinical manifestations of SEDT were evident in at least four previous generations. A novel 2-base pair (bp) deletion in exon 5 of SEDL was found in the propositus by polymerase chain reaction (PCR) amplification and sequencing of all four coding exons. The mutation ATdel241-242 cosegregated with the kindred's skeletal disease. The deletion is adjacent to a noncanonical splice site for exon 5 but does not alter splicing. Instead, it deletes 2 bp from the coding sequence, causing a frameshift. A maternal aunt and her three young sons were investigated subsequently. Radiographs showed subtle shaping abnormalities of her pelvis and knees, suggesting heterozygosity. X-rays of the spine and pelvis of her 8-year-old son revealed characteristic changes of SEDT, but her younger sons (aged 6 years and 3 years) showed no abnormalities. SEDL analysis confirmed that she and only her eldest boy had the 2-bp deletion. Molecular testing of SEDL enables carrier detection and definitive diagnosis before clinical or radiographic expression of SEDT. Although there is no specific treatment for SEDT, preexpression molecular testing of SEDL could be helpful if avoiding physical activities potentially injurious to the spine and the joints proves beneficial.

Adolescent↗

PubMed2001

Evidence for a direct role of cyclo-oxygenase 2 in implant wear debris-induced osteolysis.

Aseptic loosening is a major complication of prosthetic joint surgery and is manifested as chronic inflammation, pain, and osteolysis at the bone implant interface. The osteolysis is believed to be driven by a host inflammatory response to wear debris generated from the implant. In our current study, we use a selective inhibitor (celecoxib) of cyclo-oxygenase 2 (COX-2) and mice that lack either COX-1 (COX-1-/-) or COX-2 (COX-2-/-) to show that COX-2, but not COX-1, plays an important role in wear debris-induced osteolysis. Titanium (Ti) wear debris was implanted surgically onto the calvaria of the mice. An intense inflammatory reaction and extensive bone resorption, which closely resembles that observed in patients with aseptic loosening, developed within 10 days of implantation in wild-type and COX-1-/- mice. COX-2 and prostaglandin E2 (PGE2) production increased in the calvaria and inflammatory tissue overlying it after Ti implantation. Celecoxib (25 mg/kg per day) significantly reduced the inflammation, the local PGE2 production, and osteolysis. In comparison with wild-type and COX-1-/- mice, COX-2-/- mice implanted with Ti had a significantly reduced calvarial bone resorption response, independent of the inflammatory response, and significantly fewer osteoclasts were formed from cultures of their bone marrow cells. These results provide direct evidence that COX-2 is an important mediator of wear debris-induced osteolysis and suggests that COX-2 inhibitors are potential therapeutic agents for the prevention of wear debris-induced osteolysis.

Animals↗

PubMed2001

Distribution of trace elements in normal and tumor-bearing mice using the multitracer technique.

A multitracer solution obtained from the nuclear reaction of selenium with 25-MeV/nucleon 40Ar ions was orally administered to normal and tumor-bearing Balb/c male mice. After 96 h, the mice were sacrificed and the elemental distribution was determined in various tissues, organs, and blood. The uptake of Na, Rb, Ga, Sc, V, Cr, Mn, Co, Fe, Zn, Y, Zr, Tc, Ru, Ag, and In in normal and, except for zinc, in tumor-bearing mice was simultaneously detected. Most elements were distributed in about the same manner in the skin and liver of animals in both groups. The distribution of Rb, Ga, V, Cr, Tc, and In showed little or no significant differences between the two study groups. The distribution of Na, Mn, Fe, Ag, Sc, and Co showed significant differences between normal and tumor-bearing mice. In the blood, spleen, and kidney of the normal mice, there was good absorption of Na, Mn, Fe, Ag, Co, and Zn. In the heart, these elements were well absorbed, except for Na and Mn.

Animals↗

PubMed2001

Evaluating the effectiveness of student assistance programs in Pennsylvania.

This article presents data from an evaluation of the Pennsylvania Student Assistance Program (SAP). Focusing on both program process and effectiveness, the evaluation was conducted to determine the overall efficacy of SAPs in Pennsylvania and, more specifically, how SAP is currently being implemented. Five data collection strategies were employed: statewide surveys of SAP team members and county administrators, focus groups, site visits, and the Pennsylvania Department of Education SAP Database. A total of 1204 individual team members from 154 school buildings completed the team member survey. Fifty-three county administrators completed the county administrator survey. Focus groups were comprised of SAP coordinators, school board personnel and community agency staff. Site visits were conducted at five schools. The findings of the evaluation indicate that SAP in Pennsylvania is being implemented as designed. Recommended is the development of benchmarks and indicators that focus on the best SAP practices and the extent to which various indicators of the effectiveness of SAP are occurring at appropriate levels.

Adolescent↗

PubMed2001

Epidemiology of occupational asbestos-related diseases in China.

In 1950s and 60s, asbestosis had been a major health hazard for asbestos exposed workers. In the late 1970s, lung cancers with or without asbestosis were found among asbestos workers. All cohort studies on asbestos workers and on chrysotile miners in China showed excess deaths from lung cancer. In a large scale of cohort study on asbestos workers, a synergistic effect was found between cigarette smoking and asbestos exposure in the production of lung cancer. There have been not so many cases of malignant mesotheliomas reported, so far. In the cohort of chrysotile miners, 4 cases of pleural mesothelioma were observed. In the large scale of cohort study on asbestos workers in 9 factories using only chrysotile only one case of pleural mesothelioma was detected for 10 years' observation. In another 2 cohort studies, 2 cases of peritoneal mesotheliomas were found, one in Shanghai asbestos factory where a small amount of crocidolite had been used in 1960s, and one in Anqing asbestos factory that was located near tremolite mine. Further study is needed especially for the relationship between exposure to Chinese chrysotile and malignant mesotheliomas.

Asbestos↗

PubMed2001

Tasco-Forage: I. Influence of a seaweed extract on antioxidant activity in tall fescue and in ruminants.

Seaweed (Ascophyllum nodosum) is a known source of plant growth regulators, and application to turfgrasses has increased activity of the antioxidant superoxide dismutase (SOD) and specific vitamin precursors. Increased antioxidant activity in both plants and animals diminishes oxidative stress. Two pasture experiments investigated effects of Tasco-Forage (a proprietary seaweed-based product) applied to tall fescue (Festuca arundinacea) on antioxidant activity in plants and in ruminants that grazed the forage. In Exp. 1, fescue was 70 to 100% infected with the endophyte fungus Neotyphodium coenophialum ([Morgan-Jones and Gams] Glenn, Bacon, and Hanlin). Twenty-four wether lambs (initial BW 41 kg; SD = 5) grazed fescue treated with 0, 1.7, or 3.4 kg Tasco/ha applied in April and July, 1994, with four replications per treatment. Grazing occurred for 26 d beginning April 21 and for 22 d beginning July 19. In July, there was a linear increase in daily gains (P < 0.05), and serum vitamin A (P < 0.13) and whole-blood Se (P < 0.10) tended to increase in lambs grazing Tasco-treated fescue. In Exp. 2,48 Angus and Angus x Hereford steers (initial BW 245 kg; SD = 20) grazed infected or uninfected tall fescue in Virginia that was treated (3.4 kg/ ha) or untreated with Tasco in April and July, 1995. Steers that grazed infected tall fescue had lower (P < 0.02) serum vitamin A and E and tended (P < 0.07) to have lower whole-blood Se in September compared with steers that grazed uninfected tall fescue. Tasco decreased (P < 0.06) serum vitamin E but tended to increase whole-blood Se (P < 0.10) in September and serum vitamin A in July (P < 0.12). During 1996 and 1997, the experiment was repeated in Virginia with Angus steers and was replicated at Prairie, MS, where 1/4 Brahman x 3/4 Angus steers were used. Forty-eight steers were included at each location in each year (n = 192 total steers for 1996 and 1997). Steers that grazed infected tall fescue in Mississippi had lower (P < 0.05) serum vitamin E by the end of the grazing season. At both locations Tasco increased (P < 0.05) activity of superoxide dismutase in both infected and uninfected fescue. The endophyte in tall fescue seemed to decrease antioxidant activity in grazing steers, whereas Tasco seemed to increase antioxidant activity in both the forage and the grazing ruminant. Tasco may provide opportunities to reduce oxidative stress in plants and animals.

Animal Feed↗

PubMed2001

Hoechst 33342-induced apoptosis is associated with intracellular accumulation of E2F-1 protein in BC3H-1 myocytes and HL-60 cells.

CONTEXT: Hoechst 33342 induces apoptosis, inhibits topoisomerase I, and disrupts TATA box-binding protein/TATA box element binding in BC3H-1 myocytes and HL-60 cells. In contrast, Hoechst 33258 does not have any of these actions. OBJECTIVE: To determine if Hoechst 33342 or Hoechst 33258 treatment of BC3H-1 myocytes or HL-60 cells is associated with the intracellular accumulation of the nuclear transcription factor E2F-1, known to induce apoptosis. METHODS: The gel mobility shift assay was used to study the effect of the 2 compounds on the binding capacity of nuclear proteins extracted from the 2 cell lines to a 30-base pair double-stranded oligonucleotide that contained an E2F-1-binding element. The DNA sequence of the protein-binding region was determined by the protection footprinting method and the Maxam-Gilbert guanosine plus adenosine chemical sequencing reaction. RESULTS: Nuclear extracts from each cell line treated with 26.7 micromol/L Hoechst 33342 or Hoechst 33258 for 3 to 24 hours were incubated with [32P]-labeled 30-base pair oligonucleotide (5'GGCGCGGAGACTTGGAGAAATTTGGCGCGG3'). Three protein and DNA bands were altered by Hoechst 33342, but not by Hoechst 33258: band I, increased, then decreased in both cell lines; band II (2 adjacent bands) markedly decreased in both cell lines; band III markedly increased only in HL-60 cells. Footprinting and sequencing demonstrated that the nuclear protein-binding sequence was TTTGGCGC, an E2F-1 binding site. Hoechst 33342 treatment increased the concentration of E2F-1 protein after a 3-hour incubation in both cell lines. CONCLUSION: Hoechst 33342-induced apoptosis is associated with intracellular accumulation of E2F-1 protein, another step in this specific apoptotic pathway.

Animals↗

PubMed2001

[Study on the mode of inheritance for familial polycystic ovary syndrome].

OBJECTIVE: To investigate the mode of inheritance of polycystic ovary syndrome(PCOS). METHODS: The first female relatives with irregular cycle and the first male relatives with premature balding in each nuclear family were designated the affected. Their prevalence rates in families were respectively calculated. Analyses of segregation ratio were carried out among 139 nuclear families with PCOS by the methods of simple segregation and complex segregation of genetic epidemiology, respectively. RESULTS: The prevalence rates of irregular cycle among mothers and sisters with PCOS were 37.4% and 33.1% respectively, and the prevalence rates of premature balding among fathers and brothers of patients were 19.4% and 6.5%, respectively. The simple segregation analysis indicated that the segregation ratio of PCOS trait in siblings was 0.3023, the complex segregation analysis indicated that it fitted in with the inheritance model of co-dominant disorder with full penetrance and sporadic cases. The frequency of homozygote of disease gene in population was 0.046. CONCLUSION: PCOS presents the mode of co-dominant inheritance with complete penetrance.

Female↗

PubMed2001

[Study on apoE gene polymorphism in Chinese endogenous hypertriglyceridemia].

OBJECTIVE: To investigate apolipoprotein(apo) E polymorphism and its relationship with serum lipids and apolipoproteins in Chinese patients with endogenous hypertriglyceridemia(HTG). METHODS: apoE genotype was assayed by polymerase chain reaction- restriction fragment length polymorphism(PCR-RFLP), serum lipids were determined by enzyme method, and apolipoproteins were measured by radial immunodiffusion assay in 225 endogenous HTG patients whose fasting serum TG levels were > or = 2.26 mmol/L and in 230 healthy subjects whose fasting serum lipids levels were TG<1.82 mmol/L, TC<6.21 mmol/L from a population of Chinese Han nationality in Chengdu area. RESULTS: Compared with the controls, the values of BMI, TG, TC, nHDLC, apoB100, CII, CIII, E and TG/HDLC in HTG patients were significantly increased and the values of HDLC, apoAI and apoE/apoCIII were significantly decreased(P<0.001). apoE3/3 genotype and allele epsilon(3) frequency in HTG group and the control group were both the highest, and allele epsilon( 2) frequency in HTG group tended to increase than that in the control group(P>0.05). Both in HTG group and control group, the genotype of apoE2 had higher serum TG and apoE levels, lower LDLC level and decreased apoE/apoCIII ratio as compared with the genotype of apoE3 or apoE4(P<0.001). CONCLUSION: Allele epsilon(2) of apoE gene was associated with higher serum TG and apoE levels and lower serum LDLC level, and the lower ratio of apoE/apoCIII was associated with the higher serum level of TG in endogenous HTG.

Adult↗

PubMed2001

[Metastatic liver tumor arising from prostate cancer following transurethral resection of the prostate--a report of two cases].

We herein present a report of metastatic liver tumor arising from prostate cancer following transurethral resection of the prostate (TUR) in two patients. The two patients were diagnosed as having moderately differentiated prostate adenocarcinoma, either stage C or B2, and underwent hormonal and/or radiation therapy. TUR was performed due to the patients' complaints of urinary outlet obstruction. Liver metastasis, without evidence of bone or pulmonary metastasis, was then noted 23 and 5 months later in the patients with stage C and B2 prostate cancer, respectively. It is possible that the process of TUR is related to the release of tumor cells from the prostate into the systemic circulation and involved in the development of liver metastasis.

Adenocarcinoma↗

PubMed2001

Hoechst 33342-induced apoptosis is associated with decreased immunoreactive topoisomerase I and topoisomerase I-DNA complex formation.

Hoechst 33342, but not Hoechst 33258, induces apoptosis and inhibits topoisomerase 1 activity in vivo. Topoisomerase I relaxes superhelical DNA through a single strand breakage/rejoining reaction in which the active site tyrosine links covalently to a 3' phosphate at the break site, forming a transient intermediate called a cleavable complex. The fate of cellular topoisomerase 1 in Hoechst 33342-induced apoptosis is unknown. We analyzed the binding capacity of topoisomerase 1 to 32P-labeled plasmid pCI DNA, the immunoreactive topoisomerase 1 concentration and topoisomerase 1 activity in BC3H-1 myocytes and HL-60 cells treated with Hoechst 33342 and Hoechst 33258 by using covalent transfer of 32P radioactivity from plasmid DNA to topoisomerase 1, Western blotting and topoisomerase 1-mediated plasmid relaxation assay, respectively. Hoechst 33342, but not Hoechst 33258, induced topoisomerase 1 dysfunction in both BC3H-1 myocytes and HL-60 cells measured by (1) a decrease in the topoisomerase 1 to DNA binding capacity or cleavable complex formation; (2) a decrease in intracellular concentration of immunoreactive topoisomerase 1; and (3) an inhibition of nuclear endogenous topoisomerase 1 activity. These results suggest that destruction of immunoreactive topoisomerase 1 and topoisomerase 1-DNA complexes or cleavable complexes results in inhibition of topoisomerase 1 activity, a key step in the Hoechst 33342-induced apoptotic process.

Animals↗

PubMed2001

Combustion synthesis of porous materials for bone replacement.

Production of highly porous composite materials by traditional materials processing is limited by difficult processing techniques. However, combustion or self-propagating high-temperature synthesis (SHS) allows many porous ceramic, intermetallic, glass, and metallic systems to be formed with relative ease. Examination of the SHS reaction parameters that control the extent of porosity further increases the feasibility of producing novel composites for such uses as bone implant applications. Combustion Synthesis of porous Ti-TiBx and NiTi composite materials have been studied with respect to the sensitivity to the SHS reaction parameters of stoichiometry, green density, gasifying agents, and gravity. The main objective of this research program is to engineer the required porosity and mechanical properties into the composite materials to meet the requirements of a consumer, such as for the application of bone replacement materials. Biomedical results indicated strongly that there is natural bone ingrowth with no apparent immune response in the composite materials produced by this process.

Alloys↗

PubMed2001

Combustion synthesis of porous glasses and ceramics for bone repair.

Porous bioactive materials with constituents such as CaO, P2O5, SiO2, MgO, K2O, Na2O implanted in bone can activate a biologic response to enhance bone healing. These biomaterials are currently formed utilizing wet chemistry, plasma spray, D-gun, sintering, and diffusion bond techniques. This work investigates the use of self propagating high temperature combustion synthesis (SHS) in the creation of porous bioactive glasses for bone repair. The use of combustion synthesis has many advantages over the methods mentioned previously. The primary advantages are the ability to control the process to provide specified porosity (% porosity, pore size distribution, interconnected pores, functionally grading of porosity), structural mechanical properties, together with rapid production of the material. The focus of this project is the investigation of combustion synthesis reactions based on the reaction system 3CaO + P2O5==>Ca3(PO4)2 and incorporating other known biocompatible constituents into the reaction.

Alloys↗