Biomedical subjects

Wendy C Brown

Publications and source records attributed to Wendy C Brown.

At least 37 records · Page 2Linked to original sources

PubMed2005

Identification of vaccine candidate peptides in the NcSRS2 surface protein of Neospora caninum by using CD4+ cytotoxic T lymphocytes and gamma interferon-secreting T lymphocytes of infected holstein cattle.

Previously, our laboratory showed that Holstein cattle experimentally infected with Neospora caninum develop parasite-specific CD4+ cytotoxic T lymphocytes (CTL) that lyse infected, autologous target cells through a perforin-granzyme pathway. To identify specific parasite antigens inducing bovine CTL and helper T-lymphocyte responses for vaccine development against bovine neosporosis, the tachyzoite major surface proteins NcSAG1 and NcSRS2 were targeted. In whole tachyzoite antigen-expanded bovine T-lymphocyte lines, recombinant NcSRS2 induced potent memory CD4+- and CD8+-T-lymphocyte activation, as indicated by proliferation and gamma interferon (IFN-gamma) secretion, while recombinant NcSAG1 induced a minimal memory response. Subsequently, T-lymphocyte epitope-bearing peptides of NcSRS2 were mapped by using overlapping peptides covering the entire NcSRS2 sequence. Four experimentally infected cattle with six different major histocompatibility complex (MHC) class II haplotypes were the source of immune cells used to identify NcSRS2 peptides presented by Holstein MHC haplotypes. NcSRS2 peptides were mapped by using IFN-gamma secretion by rNcSRS2-stimulated, short-term T-lymphocyte cell lines, IFN-gamma enzyme-linked immunospot (ELISPOT) assay with peripheral blood mononuclear cells, and 51Cr release cytotoxicity assay of rNcSRS2-stimulated effector cells. Four N. caninum-infected Holstein cattle developed NcSRS2 peptide-specific T lymphocytes detected ex vivo in peripheral blood by IFN-gamma ELISPOT and in vitro by measuring T-lymphocyte IFN-gamma production and cytotoxicity. An immunodominant region of NcSRS2 spanning amino acids 133 to 155 was recognized by CD4+ T lymphocytes from the four cattle. These findings support investigation of subunit N. caninum vaccines incorporating NcSRS2 gene sequences or peptides for induction of NcSRS2 peptide-specific CTL and IFN-gamma-secreting T lymphocytes in cattle with varied MHC genotypes.

Amino Acid Sequence↗

PubMed2004

CD80 and CD86, but not CD154, augment DNA vaccine-induced protection in experimental bovine tuberculosis.

DNA vaccination is known to elicit robust cellular and humoral responses to encoded antigen. The co-administration of costimulatory molecules CD80 (B7-1), CD86 (B7-2) and CD154 (CD40L) has been shown to enhance immune responses in several murine models. The role of specific costimulatory molecules in non-rodent species remains incompletely characterized. In these studies, we demonstrate that the co-administration of CD80 and CD86, but not CD154, to an existing candidate subunit DNA vaccine (ESAT-6) against bovine tuberculosis, enhances protection after aerosol challenge with virulent Mycobacterium bovis. Additionally, we have shown that vaccination with M. bovis BCG is protective against tuberculosis following aerosol challenge in cattle. Two independent trials were conducted in cattle to determine the adjuvant effect of encoded antigen + CD80/CD86 and directly compare the adjuvant activities of CD80/CD86 to those of CD154. Co-administration of either CD80/CD86 or CD154 enhanced ESAT-6-specific IFN-gamma responses as compared to animals vaccinated with ESAT-6 DNA alone. However, following aerosol challenge, only animals vaccinated with CD80/CD86 possessed decreased pathology of the lungs and associated lymph nodes, as measured by gross examination, radiographic lesion morphometry and bacterial recovery. Collectively, these results demonstrate that the co-administration of costimulatory molecules with a protective antigen target enhances bovine immune responses to DNA vaccination, and that CD80/CD86 is superior to CD154 in augmenting DNA vaccine-induced protection in experimental bovine tuberculosis.

Adjuvants, Immunologic↗

PubMed2004

The CD4+ T cell immunodominant Anaplasma marginale major surface protein 2 stimulates gammadelta T cell clones that express unique T cell receptors.

Major surface protein 2 (MSP2) of the bovine rickettsial pathogen Anaplasma marginale is an abundant, serologically immunodominant outer membrane protein. Immunodominance partially results from numerous CD4+ T cell epitopes in highly conserved amino and carboxy regions and the central hypervariable region of MSP2. However, in long-term cultures of lymphocytes stimulated with A. marginale, workshop cluster 1 (WC1)+ gammadelta T cells and CD4+ alphabeta T cells proliferated, leading to a predominance of gammadelta T cells. As gammadelta T cells proliferate in A. marginale-stimulated lymphocyte cultures, this study hypothesized that gammadelta T cells respond to the abundant, immunodominant MSP2. To test this hypothesis, gammadelta T cell clones were isolated from MSP2 vaccinates and assessed for antigen-specific proliferation and interferon-gamma secretion. Seven WC1+ gammadelta T cell clones responded to A. marginale and MSP2, and three of these proliferated to overlapping peptides from the conserved carboxy region. The gammadelta T cell response was not major histocompatibility complex-restricted, although it required antigen-presenting cells and was blocked by addition of antibody specific for the T cell receptor (TCR). Sequence analysis of TCR-gamma and -delta chains of peripheral blood lymphocytes identified two novel TCR-gamma chain constant (Cgamma) regions. It is important that all seven MSP2-specific gammadelta T cell clones used the same one of these novel Cgamma regions. The TCR complementarity-determining region 3 was less conserved than those of MSP2-specific CD4+ alphabeta T cell clones. Together, these data indicate that WC1+ gammadelta T cells recognize A. marginale MSP2 through the TCR and contribute to the immunodominant response to this protein.

Anaplasma marginale↗

PubMed2004

Identification of a novel Anaplasma marginale appendage-associated protein that localizes with actin filaments during intraerythrocytic infection.

The rickettsial pathogen Anaplasma marginale assembles an actin filament bundle during intracellular infection. Unlike other bacterial pathogens that generate actin filament tails, A. marginale infects mature erythrocytes, and the F-actin appendages are assembled on the cytoplasmic surface of a vacuole containing several organisms. To identify A. marginale molecules associated with these filaments, two complementary approaches were used: matrix-assisted laser desorption ionization-time-of-flight mass spectrometry and tandem mass spectrometry of A. marginale proteins identified with an appendage-specific monoclonal antibody and expression screening of an A. marginale phage library. Amino acid and nucleotide sequences were mapped to a full-length gene in the genome of the St. Maries strain of A. marginale; the correct identification was confirmed by expression of full-length recombinant protein and its reactivity with appendage-specific antibodies. Interestingly, there is marked variation in the abilities of diverse A. marginale strains to assemble the F-actin appendages. Comparison of four strains, the Florida, Illinois, St. Maries, and Virginia strains, revealed substantial polymorphism in the gene encoding the appendage-associated protein, with amino acid sequence identity of as low as 34% among strains. However, this variation does not underlie the differences in expression, as there is no specific polymorphism associated with loss of ability to assemble actin appendages. In contrast, the ability to assemble an actin filament bundle reflected dramatic strain-specific differences in the expression level of the appendage-associated protein. Understanding how this protein influences the cycle of invasion, replication, and egress in the host cell may provide new insights into pathogen-host interactions.

Actins↗

PubMed2004

Anaplasma marginale major surface protein 2 CD4+-T-cell epitopes are evenly distributed in conserved and hypervariable regions (HVR), whereas linear B-cell epitopes are predominantly located in the HVR.

Organisms in the genus Anaplasma express an immunodominant major surface protein 2 (MSP2), composed of a central hypervariable region (HVR) flanked by highly conserved regions. Throughout Anaplasma marginale infection, recombination results in the sequential appearance of novel MSP2 variants and subsequent control of rickettsemia by the immune response, leading to persistent infection. To determine whether immune evasion and selection for variant organisms is associated with a predominant response against HVR epitopes, T-cell and linear B-cell epitopes were localized by measuring peripheral blood gamma interferon-secreting cells, proliferation, and antibody binding to 27 overlapping peptides spanning MSP2 in 16 cattle. Similar numbers of MSP2-specific CD4(+) T-cell epitopes eliciting responses of similar magnitude were found in conserved and hypervariable regions. T-cell epitope clusters recognized by the majority of animals were identified in the HVR (amino acids [aa] 171 to 229) and conserved regions (aa 101 to 170 and 272 to 361). In contrast, linear B-cell epitopes were concentrated in the HVR, residing within hydrophilic sequences. The pattern of recognition of epitope clusters by T cells and of HVR epitopes by B cells is consistent with the influence of protein structure on epitope recognition.

Anaplasma marginale↗

PubMed2004

Conservation of Babesia bovis small heat shock protein (Hsp20) among strains and definition of T helper cell epitopes recognized by cattle with diverse major histocompatibility complex class II haplotypes.

Babesia bovis small heat shock protein (Hsp20) is recognized by CD4+ T lymphocytes from cattle that have recovered from infection and are immune to challenge. This candidate vaccine antigen is related to a protective antigen of Toxoplasma gondii, Hsp30/bag1, and both are members of the alpha-crystallin family of proteins that can serve as molecular chaperones. In the present study, immunofluorescence microscopy determined that Hsp20 is expressed intracellularly in all merozoites. Importantly, Hsp20 is also expressed by tick larval stages, including sporozoites, so that natural tick-transmitted infection could boost a vaccine-induced response. The predicted amino acid sequence of Hsp20 from merozoites is completely conserved among different B. bovis strains. To define the location of CD4+ T-cell epitopes for inclusion in a multiepitope peptide or minigene vaccine construct, truncated recombinant Hsp20 proteins and overlapping peptides were tested for their ability to stimulate T cells from immune cattle. Both amino-terminal (amino acids [aa] 1 to 105) and carboxy-terminal (aa 48 to 177) regions were immunogenic for the majority of cattle in the study, stimulating strong proliferation and IFN-gamma production. T-cell lines from all individuals with distinct DRB3 haplotypes responded to aa 11 to 62 of Hsp20, which contained one or more immunodominant epitopes for each animal. One epitope, DEQTGLPIKS (aa 17 to 26), was identified by T-cell clones. The presence of strain-conserved T helper cell epitopes in aa 11 to 62 of the ubiquitously expressed Hsp20 that are presented by major histocompatibility complex class II molecules represented broadly in the Holstein breed supports the inclusion of this region in vaccine constructs to be tested in cattle.

Amino Acid Sequence↗

PubMed2004

CD4+ T lymphocytes from Anaplasma marginale major surface protein 2 (MSP2) vaccinees recognize naturally processed epitopes conserved in MSP3.

Major surface protein 2 (MSP2) and MSP3 of the persistent bovine ehrlichial pathogen Anaplasma marginale are immunodominant proteins that undergo antigenic variation. The recently completed sequence of MSP3 revealed blocks of amino acids in the N and C termini that are conserved with MSP2. This study tested the hypothesis that CD4+ T cells specific for MSP2 recognize naturally processed epitopes conserved in MSP3. At least one epitope in the N terminus and two in the C terminus of MSP2 were also processed from MSP3 and presented to CD4+ T lymphocytes from MSP2-immunized cattle. This T-lymphocyte response to conserved and partially conserved epitopes may contribute to the immunodominance of MSP2 and MSP3.

Amino Acid Sequence↗

PubMed2003

CpG ODN 2006 and IL-12 are comparable for priming Th1 lymphocyte and IgG responses in cattle immunized with a rickettsial outer membrane protein in alum.

Immunostimulatory oligodeoxynucleotides containing unmethylated CpG dinucleotides (CpG ODN) stimulate IL-12-dependent Th1 dominated cytokine and enhanced IgG responses when co-delivered with antigen to mice. However, the CpG ODN sequences that are optimal for each mammalian species may differ. Previously, we demonstrated that a CpG ODN containing the GTCGTT motif was optimal for stimulating bovine B cell proliferation, and induced IL-6, IL-12 and IFN-gamma production by peripheral blood mononuclear cells (PBMC). The current study was designed to test the hypothesis that the nuclease resistant phosphorothioate modified ODN 2006 (TCGTCGTTTTGTCGTTTTGTCGTT) would induce antigen-specific type 1 cytokine and enhanced IgG responses similar to those induced by IL-12. To test this adjuvant effect, calves were immunized with Anaplasma marginale major surface protein 2 (MSP2) with alum alone or combined with CpG ODN 2006, non-CpG ODN R2006 or IL-12. MSP2-specific IgG1 and IgG2 responses developed more rapidly in calves given IL-12, ODN 2006 or ODN R2006, but the highest IgG1 titers were obtained in CpG ODN-immunized calves. Antigen-specific lymphocyte proliferation and frequency of IFN-gamma-secreting cells were significantly increased in CpG ODN 2006- or IL-12-treated calves, and antigen-stimulated PBMC from these calves also expressed higher levels of IFN-gamma transcripts and lower levels of IL-4 transcripts. No differences in IL-10 mRNA expression were detected among the groups. These results indicate that CpG ODN 2006 is an effective vaccine adjuvant for stimulating both antibody and IFN-gamma mediated cellular immune responses in cattle.

Adjuvants, Immunologic↗

PubMed2003

The hypervariable region of Anaplasma marginale major surface protein 2 (MSP2) contains multiple immunodominant CD4+ T lymphocyte epitopes that elicit variant-specific proliferative and IFN-gamma responses in MSP2 vaccinates.

Major surface protein 2 (MSP2) is an immunodominant outer membrane protein of Anaplasma marginale and Anaplasma phagocytophilum pathogens that cause bovine anaplasmosis and human granulocytic ehrlichiosis, respectively. MSP2 has a central hypervariable region (HVR) flanked by highly conserved amino and carboxyl termini. During A. marginale infection, dynamic and extensive amino acid sequence variation in MSP2 occurs through recombination of msp2 pseudogenes into the msp2 expression site, followed by sequential segmental gene conversions to generate additional variants. We hypothesized that MSP2 variation leads to significant changes in Th cell recognition of epitopes in the HVR. T cell epitopes were mapped using T cells from native MSP2-immunized cattle and overlapping peptides spanning the most abundant of five different MSP2 HVRs in the immunogen. Several epitopes elicited potent effector/memory Th cell proliferative and IFN-gamma responses, including those in three discreet blocks of sequence that undergo segmental gene conversion. Th cell clones specific for an epitope in the block 1 region of the predominant MSP2 variant type failed to respond to naturally occurring variants. However, some of these variants were recognized by oligoclonal T cell lines from MSP2 vaccinates, indicating that the variant sequences contain immunogenic CD4(+) T cell epitopes. In competition/antagonism assays, the nonstimulatory variants were not inhibitory for CD4(+) T cells specific for the agonist peptide. Dynamic amino acid sequence variation in MSP2 results in escape from recognition by some effector/memory MSP2-specific Th cells. Antigenic variation in MSP2 Th cell and B cell epitopes may contribute to immune evasion that allows long-term persistence of A. marginale in the mammalian reservoir.

Adjuvants, Immunologic↗

PubMed2003

Competitive enzyme-linked immunosorbent assay based on a rhoptry-associated protein 1 epitope specifically identifies Babesia bovis-infected cattle.

The competitive enzyme-linked immunosorbent assay (cELISA) format has proven to be an accurate, reliable, easily standardized, and high-throughput method for detecting hemoparasite infections. In the present study, a species-specific, broadly conserved, and tandemly repeated B-cell epitope within the C terminus of the rhoptry-associated protein 1 of the hemoparasite Babesia bovis was cloned and expressed as a histidine-tagged thioredoxin fusion peptide and used as antigen in a cELISA. The assay was optimized with defined negative and positive bovine sera, where positive sera inhibited the binding of the epitope-specific monoclonal antibody BABB75A4. The cELISA accurately differentiated animals with B. bovis-specific antibodies from uninfected animals and from animals with antibodies against other tick-borne hemoparasites (98.7% specificity). In addition, B. bovis-specific sera from Australia, Argentina, Bolivia, Puerto Rico, and Morocco inhibited the binding of BABB75A4, confirming conservation of the epitope. The assay first detected experimentally infected animals between 13 and 17 days postinfection, and with sera from naturally infected carrier cattle, was comparable to indirect immunofluorescence (98.3% concordance). The assay appears to have the characteristics necessary for an epidemiologic and disease surveillance tool.

Animals↗

PubMed2003

Stimulation of T-helper cell gamma interferon and immunoglobulin G responses specific for Babesia bovis rhoptry-associated protein 1 (RAP-1) or a RAP-1 protein lacking the carboxy-terminal repeat region is insufficient to provide protective immunity against virulent B. bovis challenge.

Rhoptry-associated protein 1 (RAP-1) is a targeted vaccine antigen for Babesia bovis and Babesia bigemina infections of cattle. The 60-kDa B. bovis RAP-1 is recognized by antibodies and T lymphocytes from cattle that recovered from infection and were immune to subsequent challenge. Immunization with native or recombinant protein was reported to reduce parasitemias in challenged animals. We recently reported that the NT domain of B. bovis RAP-1 contained immunodominant T-cell epitopes, whereas the repeat-rich CT domain was less immunostimulatory for T lymphocytes from cattle immune to B. bovis. The present study was therefore designed to test the hypothesis that the NT region of RAP-1, used as a vaccine with interleukin-12 and RIBI (catalog no. R-730; RIBI Immunochem Research, Inc., Hamilton, Mont. [now Corixa, Seattle, Wash.]) adjuvant to induce a type 1 response, would prime calves for antibody and T-helper cell responses comparable to or greater than those induced by full-length RAP-1 containing the C-terminal repeats. Furthermore, a type 1 immune response to RAP-1 was hypothesized to induce protection against challenge. Following four inoculations of either recombinant full-length RAP-1 or RAP-1 NT protein, RAP-1-specific immunoglobulin G (IgG) titers, T-lymphocyte proliferation, and gamma interferon production were similar. Similar numbers of NT region peptides were recognized. However, in spite of the presence of strong RAP-1-specific IgG and CD4(+)-T-lymphocyte responses that were recalled upon challenge, neither antigen stimulated a protective immune response. We conclude that successful priming of calves with recombinant RAP-1 and adjuvants that elicit strong Th1 cell and IgG responses is insufficient to protect calves against virulent B. bovis challenge.

Amino Acid Sequence↗

PubMed2002

DNA-encoded fetal liver tyrosine kinase 3 ligand and granulocyte macrophage-colony-stimulating factor increase dendritic cell recruitment to the inoculation site and enhance antigen-specific CD4+ T cell responses induced by DNA vaccination of outbred animals.

DNA-based immunization is a contemporary strategy for developing vaccines to prevent infectious diseases in animals and humans. Translating the efficacy of DNA immunization demonstrated in murine models to the animal species that represent the actual populations to be protected remains a significant challenge. We tested two hypotheses directed at enhancing DNA vaccine efficacy in outbred animals. The first hypothesis, that DNA-encoding fetal liver tyrosine kinase 3 ligand (Flt3L) and GM-CSF increases dendritic cell (DC) recruitment to the immunization site, was tested by intradermal inoculation of calves with plasmid DNA encoding Flt3L and GM-CSF followed by quantitation of CD1(+) DC. Peak DC recruitment was detected at 10-15 days postinoculation and was significantly greater (p < 0.05) in calves in the treatment group as compared with control calves inoculated identically, but without Flt3L and GM-CSF. The second hypothesis, that DNA encoding Flt3L and GM-CSF enhances immunity to a DNA vector-expressed Ag, was tested by analyzing the CD4(+) T lymphocyte response to Anaplasma marginale major surface protein 1a (MSP1a). Calves immunized with DNA-expressing MSP1a developed strong CD4(+) T cell responses against A. marginale, MSP1a, and specific MHC class II DR-restricted MSP1a epitopes. Administration of DNA-encoding Flt3L and GM-CSF before MSP1a DNA vaccination significantly increased the population of Ag-specific effector/memory cells in PBMC and significantly enhanced MSP1a-specific CD4(+) T cell proliferation and IFN-gamma secretion as compared with MHC class II DR-matched calves vaccinated identically but without Flt3L and GM-CSF. These results support use of these growth factors in DNA vaccination and specifically indicate their applicability for vaccine testing in outbred animals.

Adjuvants, Immunologic↗

PubMed2002

Type 1 and type 2 responses in regulation of Ig isotype expression in cattle.

Regulation of humoral immune responses is multifactorial involving appropriate activation, costimulation and the presence of specific soluble factors. Polarized type 1 or type 2 humoral responses in the laboratory mouse have been linked to expression of specific cytokines and thus can be used to provide insight into the type of response generated by infection. For example, IFN-gamma has been linked to IgG2a and IgG3 production, IL-4 to IgG1 and IgE production and TGF-beta to IgA production. Unlike the laboratory mouse, generally housed under defined conditions, highly skewed isotype expression patterns generally occur in cattle in chronic infections. A few examples of polarized responses have been noted in chronic experimental or naturally occurring infections including F. hepatica, M. paratuberculosis, C. parvum and B. abortus. In vitro studies using purified bovine B cells and various forms of costimulation and cytokines have demonstrated that isotype responses can be polarized under certain experimental conditions in vitro. That is, IgG1 expression is positively regulated by IL-4 and IgG2 expression is positively regulated by IFN-gamma. Other as yet unidentified factors may play pivotal roles in regulating humoral immune responses in large ruminant species in vivo. This possibility is best exemplified by recent studies using DNA vaccines in cattle that have been demonstrated in the mouse to be generally polarizing to a type 1 response. Surprisingly, studies in cattle using plasmid DNA as vaccination material show an almost exclusive IgG1 response. Based on a number of studies using T cell clones and various biological assays, it is clear that the classical roles of many cytokines in the laboratory mouse do not extrapolate entirely or at all to cattle. Thus, the design of adjuvants and immune modulators should be based on studies done in cattle or using bovine cells. Based on studies to date, several "holes" in the cytokine repertoire exist and these roles may be assumed by unique factors or activities of other known cytokines.

Animals↗

PubMed2002

Stimulation of B lymphocytes, macrophages, and dendritic cells by protozoan DNA.

This review summarizes recent work from our laboratory demonstrating the activation of B lymphocytes, macrophages and dendritic cells by DNA from three different protozoan parasites of cattle and humans that is qualitatively similar to the now well-described effects of CpG-containing bacterial DNA. This novel mechanism of protozoan parasite recognition by the innate immune system could facilitate recovery from acute infection or contribute to infection-related pathology.

Animals↗

PubMed2002

Identification of broadly recognized, T helper 1 lymphocyte epitopes in an equine lentivirus.

Equine infectious anaemia virus (EIAV) is a horse lentivirus causing lifelong, persistent infection. During acute infection, CD8(+) cytotoxic T lymphocytes (CTL) are probably involved in terminating plasma viraemia. However, only a few EIAV CTL epitopes, restricted to fewer horse major histocompatibility complex (MHC) class I alleles, are known. As interferon-gamma (IFN-gamma)-secreting CD4(+), T helper 1 (Th1) lymphocytes promote CTL activity and help maintain memory CTL, identifying broadly recognized EIAV Th1 epitopes would contribute significantly to vaccine strategies seeking to promote strong CTL responses among horses with varying class I haplotypes. To this end, peripheral blood mononuclear cells (PBMC) from 10 MHC disparate, EIAV-infected horses were tested in T-lymphocyte proliferation assays for recognition of peptides from the Gag p26 capsid region and a portion of Pol. Both regions are highly conserved among EIAV isolates, and this Pol region is 51-63% homologous to other lentiviral Pol proteins. Seven of 10 horses recognized peptide Gag 221-245, and peptides Gag 242-261 and Pol 323-344 were recognized by five and four horses, respectively. Furthermore, the Gag peptides were recognized by two additional horses after resolving their initial plasma viraemia, indicating that these two peptides can be immunodominant early in infection. Gag peptide-responsive PBMC produced only IFN-gamma, indicating a Th1 response, while Pol 323-344-responsive PBMC produced IFN-gamma both with and without interleukin-4. PBMC from uninfected horses failed to either proliferate or secrete cytokines in response to peptide stimulation. Finally, CD4(+) T lymphocytes were required for proliferation responses, as shown by assays using CD4- versus CD8-depleted PBMC.

Animals↗

PubMed2002

Selective in vivo depletion of CD4(+) T lymphocytes with anti-CD4 monoclonal antibody during acute infection of calves with Anaplasma marginale.

To investigate the in vivo role of CD4(+) T lymphocytes during acute anaplasmosis, thymectomized calves were selectively depleted of CD4(+) T lymphocytes by treatment with anti-CD4 monoclonal antibody (MAb) and were then infected with the Florida strain of Anaplasma marginale in two sequential experiments (experiments 1 and 2). Treatment of thymectomized calves with a total of 5.0 mg of anti-CD4 MAb/kg of body weight during the 1st week followed by 0.3-mg/kg doses administered twice weekly for 7 weeks resulted in significant depletion of CD3(+) CD4(+) and CD4(+) CD45R(+) (naive) T lymphocytes from blood, spleen, and peripheral lymph nodes for the duration of the 8-week study, compared to the results for thymectomized control calves treated with a subclass-matched MAb. All calves became parasitemic and pyretic following experimental infection with A. marginale, and decreases in packed cell volume (PCV) coincided with peak parasitemia. No significant differences in PCV or parasitemia were observed between treatment groups. Thymectomized calves treated with anti-CD4 MAb were able to mount an anti-A. marginale antibody response, although in experiment 2, anti-CD4 MAb-treated calves had four- to sixfold lower immunoglobulin G1 (IgG1) and no detectable IgG2 anti-A. marginale major surface protein 2-specific antibody titers compared to thymectomized control calves treated with a subclass-matched MAb. At the level of CD4(+)-T-lymphocyte depletion achieved and experimental anaplasmosis induced, thymectomized anti-CD4 MAb-treated calves were able to control acute anaplasmosis. This was in contrast to the prediction that significant depletion of CD4(+) T lymphocytes would abrogate resistance to acute infection.

Acute Disease↗

PubMed2002

Major histocompatibility complex class II DR-restricted memory CD4(+) T lymphocytes recognize conserved immunodominant epitopes of Anaplasma marginale major surface protein 1a.

Native major surface protein 1 (MSP1) of Anaplasma marginale, composed of covalently associated MSP1a and MSP1b proteins, stimulates protective immunity in cattle against homologous and heterologous strain challenge. Protective immunity against pathogens in the family Anaplasmataceae involves both CD4(+) T cells and neutralizing immunoglobulin G. Thus, an effective vaccine should contain both CD4(+) T- and B-lymphocyte epitopes that will elicit strong memory responses upon infection with homologous and heterologous strains. Previous studies demonstrated that the predominant CD4(+) T-cell response in MSP1 vaccinates is directed against the MSP1a subunit. The present study was designed to identify conserved CD4(+) T-cell epitopes in MSP1a presented by a broadly represented subset of major histocompatibility complex (MHC) class II molecules that would be suitable for inclusion in a recombinant vaccine. Transmembrane protein prediction analysis of MSP1a from the Virginia strain revealed a large hydrophilic domain (HD), extending from amino acids (aa) 1 to 366, and a hydrophobic region extending from aa 367 to 593. The N terminus (aa 1 to 67) includes one 28-aa form A repeat and one 29-aa form B repeat, which each contain an antibody neutralization-sensitive epitope [Q(E)ASTSS]. In MSP1 vaccinates, recombinant MSP1a HD (aa 1 to 366) stimulated recall proliferative responses that were comparable to those against whole MSP1a excluding the repeat region (aa 68 to 593). Peptide mapping determined a minimum of five conserved epitopes in aa 151 to 359 that stimulated CD4(+) T cells from cattle expressing DR-DQ haplotypes common in Holstein-Friesian breeds. Peptides representing three epitopes (aa 231 to 266, aa 270 to 279, and aa 290 to 319) were stimulatory for CD4(+) T-cell clones and restricted by DR. A DQ-restricted CD4(+) T-cell epitope, present in the N-terminal form B repeat (VSSQSDQASTSSQLG), was also mapped using T-cell clones from one vaccinate. Although form B repeat-specific T cells did not recognize the form A repeat peptide (VSSQS_EASTSSQLG), induction of T-cell anergy by this peptide was ruled out. The presence of multiple CD4(+) T-cell epitopes in the MSP1a HD, in addition to the neutralization-sensitive epitope, supports the testing of this immunogen for induction of protective immunity against A. marginale challenge.

Amino Acid Sequence↗

PubMed2002

Expression of Anaplasma marginale major surface protein 2 operon-associated proteins during mammalian and arthropod infection.

The antigenically variant major surface protein 2 (MSP2) of Anaplasma marginale is expressed from a 3.5-kb operon that contains, in a 5'-to-3' direction, four open reading frames, opag3, opag2, opag1, and msp2. This operon structure was shown to be conserved among genotypically and phenotypically distinct A. marginale, A. ovis, and A. centrale strains. The individual OpAG amino acid sequences are highly conserved among A. marginale strains, with identities ranging from 95 to 99%. OpAG2 and OpAG3 were expressed by all examined A. marginale strains during the acute rickettsemia in the mammalian host and, like MSP2, localize to the bacterial surface. OpAG2 and OpAG3 were also expressed in an infected Ixodes scapularis tick cell line. In contrast, the same A. marginale strains expressed only OpAG2 in two different Dermacentor spp. during transmission feeding. OpAG1 expression was not detected in the infected mammalian host, the infected tick cell line, or within infected Dermacentor ticks. The differential expression of outer membrane proteins from within an operon is a novel finding in tick-transmitted bacteria, and the regulation of expression may be broadly applicable to understanding how the pathogen adapts to the mammalian host-tick vector transition.

Amino Acid Sequence↗