Search PubMed⌕ Search

Biomedical subjects

W F Doolittle

Publications and source records attributed to W F Doolittle.

At least 127 records · Page 7Linked to original sources
PubMed1983

Genes for tRNAIle and tRNAAla in the spacer between the 16S and 23S rRNA genes of a blue-green alga: strong homology to chloroplast tRNA genes and tRNA genes of the E. coli rrnD gene cluster.

A 6.3 kbp Eco RI-Bam HI fragment which carries most of one of the two rRNA gene clusters of the blue-green alga Anacystis nidulans was cloned into plasmid pBR322. Sequence analysis of the spacer region between the 16S and 23S rRNA genes reveals the presence of genes for tRNAIle and tRNAAla. The 16S rRNA gene is separated from the tRNAIle gene by a 162 bp spacer which shows significant homology to the comparable region in Zea mays plastids. The spacer between the two tRNA genes is 33 bp long and can be folded into a 9 bp stem and loop structure. The 5' portion of the tRNAIle gene is 60% homologous to a "pseudogene"-like sequence which maps beyond the 5S rRNA gene.

Cyanobacteria↗
PubMed1982

Two thraustochytrid 5S ribosomal RNAs.

The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs.

Base Sequence↗
PubMed1982

Nucleotide sequences of 5S ribosomal RNA from four oomycete and chytrid water molds.

The nucleotide sequences of the 5S rRNAs of the oomycete water molds Saprolegnia ferax and Pythium hydnosporum and of the chytrid water molds Blastocladiella simplex and Phlyctochytrium irregulare were determined by chemical and enzymatic partial degradation of 3' and 5' end-labelled molecules, followed by gel sequence analysis. The two oomycete sequences differed in 24 positions and the two chytrid sequences differed in 27 positions. These pairs differed in a mean of 44 positions. The chytrid sequences clearly most resemble the sequence from the zygomycete Phycomyces, while the oomycete sequences appear to be allied with those from protozoa and slime molds.

Base Sequence↗
PubMed1982

High-frequency genomic rearrangements involving archaebacterial repeat sequence elements.

Halobacterium halobium is an obligately halophilic archaebacterium of interest to molecular biologists for many reasons, one of which is the unexplained high frequency (10(-4)-10(-2) mutants per cell plated) at which it yields readily identifiable and unstable mutants. We showed previously that the genome of H. halobium contains many (greater than 50) families of repeated sequences whose members are dispersed on both chromosome and plasmid. Here we report that most if not all of the members of most of these repeat sequence families effect or are affected by spontaneous genomic rearrangements. Quantitative analyses show that such repeat sequence-associated rearrangements (which may be of several kinds) occur at high frequencies (greater than 4 x 10(-3) events per family per cell generation), while unique-sequence DNAs are physically stable. The presence of so many families of elements of such great instability in the halobacterial genome gives it an unusual degree of structural and perhaps functional plasticity.

Genes, Bacterial↗
PubMed1982

The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron.

The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are (formula: see text), respectively. Specific phylogenetic relationships of P. denitrificans with purple non-sulphur bacteria, and of Prochloron with cyanobacteria are demonstrated, and unique features of potential secondary structure are described.

Base Sequence↗
PubMed1982

Unusual physical organization of the Halobacterium genome.

The genomes of the extremely halophilic bacteria, Halobacterium halobium and Halobacterium volcanii, contain many repeated sequences. These sequences comprise many families, seem to be highly mobile and are arranged in both clustered and dispersed fashions within these genomes. At least some repeated sequences are more strongly conserved between the two species than are unique sequence DNAs.

Biological Evolution↗
PubMed1982

Comparative sequence analysis as an approach to evaluating structure, function, and evolution of 5S and 5.8S ribosomal RNAs.

Nucleotide sequences of nine eukaryotic and nine eubacterial 5S rRNAs have been selected for their diversity and subjected to analysis of primary and potential secondary structure. This analysis has allowed the quantitative confirmation of several previously made observations concerning 5S rRNA structure: (i) these two 5S rRNAs are derived from a common ancestor and probably perform essentially the same function in protein synthesis; (ii) one domain of 5S rRNA has undergone considerable divergence of structure (and presumably function) since the separation of the eukaryotic and eubacterial lineages; and (iii) single-stranded regions are more highly conserved than double-stranded regions. In addition, this analysis leads us to propose that (i) some of the highly conserved nucleotide residues in single-stranded regions interact in a specific manner with protein components of the translational apparatus, and (ii) repetitive folding and unfolding of helical regions occurs in two regions of eukaryotic 5S rRNA and one region of eubacterial 5S rRNA. In the context of these observations and propositions we also consider the potential secondary structure of plant mitochondrial 5S rRNA. Nucleotide sequences of 5.85 rRNAs have yielded less information about secondary structure and possible functional interactions. However, we have identified highly conserved and variable regions within this molecule and we show (in contrast to the situation with 5S rRNA) that these do not correlate well with proposed single-stranded and helical regions in a current model of 5.8S secondary structure.

Animals↗
PubMed1981

Nucleotide sequences of Acanthamoeba castellanii 5S and 5.8S ribosomal ribonucleic acids: phylogenetic and comparative structural analyses.

Sequences of 5S and 5.8S rRNAs of the amoeboid protist Acanthamoeba castellanii have been determined by gel sequencing of terminally-labeled RNAs which were partially degraded with chemical reagents or ribonucleases. The sequence of the 5S rRNA is (formula, see text). This sequence is compared to eukaryotic 5S rRNA sequences previously published and fitted to a secondary structure model which incorporates features of several previously proposed models. All reported eukaryotic 5S rRNAs fit this model. The sequence of the 5.8S rRNA is (formula, see text). This sequence does not fit parts of existing secondary structure models for 5.8S rRNA, and we question the significance of such models.

Amoeba↗
PubMed1980

Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.

The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S RNAs, and thought to be involved in interactions with tRNAs. Comparisons to other eukaryotic cytosol 5S ribosomal RNA sequences indicate that the four major eukaryotic kingdoms (animals, plants, fungi, and protists) are about equally remote from each other, and that the latter kingdom may be the most internally diverse.

Animals↗
PubMed1980

Selfish genes, the phenotype paradigm and genome evolution.

Natural selection operating within genomes will inevitably result in the appearance of DNAs with no phenotypic expression whose only 'function' is survival within genomes. Prokaryotic transposable elements and eukaryotic middle-repetitive sequences can be seen as such DNA's and thus no phenotypic or evolutionary function need be assigned to them.

Base Sequence↗