Modifications of a telomeric repeat amplification protocol (TRAP) result in increased reliability, linearity and sensitivity.
Explore the source record for details and available documents.
Base Sequence↗
Biomedical subjects
W E Wright
Publications and source records attributed to W E Wright.
Use of reiterative selection for defining protein-nucleic acid interactions.
Nucleic acids not only code for proteins, but also play a role in a multitude of biological processes, where they act as structural supports, binding sites, co-factors, or catalysts. Recently, an array of techniques has been developed in which molecules that are best fit to perform a given task are selected from a pool of randomized RNA or DNA molecules. These techniques can provide information about the structure/function relationship governing the various biochemical properties of RNA and DNA, including their interaction with proteins. Immediate applications are found not only in the field of transcriptional regulation, but also in the field of RNA-based catalysis.
Animals↗
Time, telomeres and tumours: is cellular senescence more than an anticancer mechanism?
Normal diploid cells, by definition, have a limited life span: they senesce after a set number of divisions both in vivo and in culture. It has been hypothesized that the molecular mechanism that measures the life span of a cell probably involves the shortening of telomeres that occurs with each round of DNA replication. This loss of telomeres is thought to induce antiproliferative signals that result in the induction of cellular senescence. In this article, Woodring Wright and Jerry Shay present a hypothesis for the mechanisms by which telomere shortening regulates cellular physiology and argue that cellular senescence is not only an anticancer mechanism but is also the cause of many of the degenerative changes of aging.
Journal Article↗
Specific association of human telomerase activity with immortal cells and cancer.
Synthesis of DNA at chromosome ends by telomerase may be necessary for indefinite proliferation of human cells. A highly sensitive assay for measuring telomerase activity was developed. In cultured cells representing 18 different human tissues, 98 of 100 immortal and none of 22 mortal populations were positive for telomerase. Similarly, 90 of 101 biopsies representing 12 human tumor types and none of 50 normal somatic tissues were positive. Normal ovaries and testes were positive, but benign tumors such as fibroids were negative. Thus, telomerase appears to be stringently repressed in normal human somatic tissues but reactivated in cancer, where immortal cells are likely required to maintain tumor growth.
Base Sequence↗
Preferred sequences for DNA recognition by the TAL1 helix-loop-helix proteins.
Tumor-specific activation of the TAL1 gene is the most common genetic alteration seen in patients with T-cell acute lymphoblastic leukemia. The TAL1 gene products contain the basic helix-loop-helix (bHLH) domain, a protein dimerization and DNA-binding motif common to several known transcription factors. A binding-site selection procedure has now been used to evaluate the DNA recognition properties of TAL1. These studies demonstrate that TAL1 polypeptides do not have intrinsic DNA-binding activity, presumably because of their inability to form bHLH homodimers. However, TAL1 readily interacts with any of the known class A bHLH proteins (E12, E47, E2-2, and HEB) to form heterodimers that bind DNA in a sequence-specific manner. The TAL1 heterodimers preferentially recognize a subset of E-box elements (CANNTG) that can be represented by the consensus sequence AACAGATGGT. This consensus is composed of half-sites for recognition by the participating class A bHLH polypeptide (AACAG) and the TAL1 polypeptide (ATGGT). TAL1 heterodimers with DNA-binding activity are readily detected in nuclear extracts of Jurkat, a leukemic cell line derived from a patient with T-cell acute lymphoblastic leukemia. Hence, TAL1 is likely to bind and regulate the transcription of a unique subset of subordinate target genes, some of which may mediate the malignant function of TAL1 during T-cell leukemogenesis.
Amino Acid Sequence↗
The frequency of immortalization of human fibroblasts and mammary epithelial cells transfected with SV40 large T-antigen.
SV40 T-antigen-expressing human cells generally have an extension of lifespan until a period called "crisis" begins. On rare occasions a clone of cells emerges from the population in crisis and gives rise to an immortalized cell line. The present study compares the frequency of immortalization of cells from two different human lineages, lung fibroblasts and mammary epithelial cells. Most of the T-antigen-transfected clones from both cell types failed to immortalize, however, within those clones which were immortalization-competent the frequency of escape from crisis was found to be much higher (10(-5)) in mammary epithelial cells than in human fibroblasts (3 x 10(-7)). The frequency of escape from crisis in fibroblasts could be increased by chemical mutagenesis or by infection with a defective retrovirus. T-antigen-transfected fibroblasts were uniformly highly aneuploid both before and after crisis. In contrast, many SV40 T-antigen- and human papilloma virus 16 E6- or E6/E7-transfected mammary epithelial clones maintained a subpopulation of pseudodiploid cells prior to crisis, and the immortal cells that emerged following crisis were generally pseudodiploid. The higher frequency of escape from crisis in mammary epithelial cells is best explained by postulating a mutational inactivation of one allele of a critical gene followed by the elimination of the remaining wild-type alleles, with a much higher frequency of this second event in mammary epithelial cells due to their reduced ploidy compared to that in T-antigen-transfected fibroblasts. The results are discussed in terms of the regulation of telomerase activity and the M1/M2 model of cellular senescence.
Antigens, Polyomavirus Transforming↗
Toward a molecular understanding of human breast cancer: a hypothesis.
A rate limiting step in most metastatic breast cancers is the development of unlimited proliferative potential by mammary epithelial cells. We describe mechanisms by which these cells can attain this state. The two independent mortality mechanisms controlling fibroblast senescence and immortalization (M1 and M2) are also found in human mammary epithelial cells. However, although both p53 and Rb are involved in the M1 mechanism of fibroblast cellular senescence, in human mammary epithelial cells only p53 is involved. The M1/M2 mechanisms may be induced by the gradual loss of telomere ends that occur as normal cells divide. Loss of telomere ends may result in genomic instability and in altered gene expression due to heterochromatin changes in subtelomeric regions. Events which can abrogate p53 functions are described, as is the current state of knowledge about the function of p53. All these factors are included in a molecular model for the onset of breast cancer.
Breast Neoplasms↗
CASTing for multicomponent DNA-binding complexes.
Degenerate oligonucleotides and polymerase chain reaction-based reiterative selection techniques have been used to define the consensus binding sites for an increasing number of transcription factors. The use of crude nuclear extracts rather than purified proteins permits multicomponent complexes to form, and allows the technique to generate information about the combinatorial interactions involved in gene regulation.
Base Sequence↗
Heterogeneity of transcriptional activity of mutant p53 proteins and p53 DNA target sequences.
Transcriptional activity of p53 was monitored by cotransfection of pCMV expression vectors containing wild-type and mutant p53 cDNAs into the p53-null H1299 lung cancer cells along with luciferase reporter plasmids containing different p53 target sequences in the 5' regulatory region: fragment A of the ribosomal gene cluster (RGC); p53 consensus sequence (p53CON); or a tandemly linked RGC+p53CON sequence. Our results show: (1) wild-type p53 stimulates the transcription of reporter genes with p53CON and RGC in their 5' region while most p53 mutants occurring in human cancers have lost this activity; (2) the R273H mutant retains transcriptional activity for the p53CON sequence but not RGC; (3) some mutants are temperature-sensitive for the transcriptional activity with the p53CON but not the RGC sequence; (4) p53 mutants vary in their ability to inhibit wild-type p53 transactivation but there is no difference between p53CON and RGC sequences; (5) lung cancer cells with endogenous mutant p53 proteins (M246I in H23 cells and R248L in H322 cells) retain transcriptional activity for the p53CON but not the RGC sequence. We conclude that p53 DNA target sequences vary in their response to mutant p53 proteins, and that p53 mutants vary in several transactivation related functions.
Base Sequence↗
Novel DNA binding of p53 mutants and their role in transcriptional activation.
The protein product of the normal p53 gene binds to the DNA p53CON element (GGACATGCCCGGGCATGTCC, Funk et al., 1992), thereby activating transcription from adjacent promoters. Two mutants, 248 (Arg-->Trp) and 281 (Asp-->Gly), failed to bind p53CON and to activate transcription. However, in contrast to previous reports that all p53 mutants fail to bind to the other p53 binding elements, two p53 mutants, 143 (Val-->Ala) and 273 (Arg-->His), retained both p53CON binding and transcriptional activation functions. A third mutant 175 (Arg-->His) bound to the p53CON but did not activate transcription. These data suggest that the DNA binding and transcriptional activation functions of p53 mutants in tumor cells are dependent on the specific missense mutations acquired in the p53 gene and the target sequences of p53 in the genome.
Amino Acid Sequence↗
E6 of human papillomavirus type 16 can overcome the M1 stage of immortalization in human mammary epithelial cells but not in human fibroblasts.
Immortalization is the consequence of the inactivation or bypass of two mortality stage mechanisms, M1 and M2, which are controlled by several genes including Rb and p53 in human fibroblasts. Abrogation of the M1 controls can be obtained through the activity of DNA tumor virus genes such as E6 and E7 of human papillomavirus 16 (HPV16). Fibroblasts expressing both E6 (which binds p53) and E7 (which binds Rb) bypass M1 and continue replicating (exhibit an extended lifespan) until an independent mechanism, M2, is activated. The inactivation of the M2 mechanism finally results in cell immortalization. The present study establishes a difference in the tissue-specific mechanisms for the control of the M1 stage of cellular senescence. The expression of HPV16 E6 was sufficient to bypass the M1 stage of cellular senescence and confer an extended lifespan in human mammary epithelial cells but not in fibroblasts. This implies that the M1 mechanism in human mammary epithelial cells does not involve the constitutive activation of Rb function as it does in fibroblasts. In addition, the results confirmed that the expression of HPV16 E6 (or both E6 and E7) did not directly immortalize the human mammary epithelial cells, since the inactivation of a second event, M2, was required to achieve immortalization. These observations are considered in the context of the telomere shortening model of cellular senescence.
Blotting, Northern↗
Cyclic amplification and selection of targets for multicomponent complexes: myogenin interacts with factors recognizing binding sites for basic helix-loop-helix, nuclear factor 1, myocyte-specific enhancer-binding factor 2, and COMP1 factor.
Myogenin is one of four muscle-specific basic helix-loop-helix regulatory factors involved in controlling myogenesis. We here describe various protein complexes that increase the affinity of myogenin for DNA. We mixed an oligonucleotide containing a degenerate center large enough to accommodate multiple binding sites with crude myotube nuclear extracts and used cyclic amplification and selection of targets with an antimyogenin monoclonal antibody to isolate protein-DNA complexes. Since each cycle of selection results in the enrichment for the sequences with the highest affinity, we isolated multicomponent sites in which myogenin binding was increased by its interaction with other DNA binding proteins. Myogenin interacts with members of the nuclear factor 1 family, the muscle-specific factor myocyte-specific enhancer-binding factor 2, and another factor, COMP1 (cooperates with myogenic proteins 1), that binds to the sequence TGATTGAC. Myogenin also exhibits cooperative binding with other proteins that recognize CANNTG motifs, and various constraints on spacing and orientation were observed. The application of this approach to other transcription factors should not only help identify the different functions of myogenin versus other members of the muscle basic helix-loop-helix regulatory family but also help define the general combinatorial mechanisms involved in eukaryotic gene regulation.
Base Sequence↗
Alternative multimeric structures affect myogenin DNA binding activity.
The native molecular weight of the basic helix-loop-helix (bHLH) proteins myogenin, MyoD, and E12 was calculated from their mobilities on sucrose gradients and molecular sieve chromatography. The muscle bHLH proteins associate to form a variety of higher order complexes, most of which are larger than dimers. Homodimers bind to DNA sequences such as the MEF-1 site in the creatine kinase enhancer whereas homotetramers and larger forms do not recognize this DNA sequence. The ubiquitous bHLH protein E12 forms monomers or homodimers with little evidence for higher order complexes. Mixtures of myogenin and E12 show some heterodimeric structures, but most of the myogenin remains in large complexes. This result using purified proteins is also obtained in nuclear extracts from differentiated myotubes, in which most of the myogenin is present in large complexes that do not bind to the creatine kinase enhancer. A fusion protein containing only the myogenin HLH region forms large homomeric complexes. A model is presented in which each helix associates with a different subunit to form chains or ring structures to explain these observations. The partition of myogenin in nuclear extracts into dimers that recognize known DNA sequences and higher order complexes that do not raises important new issues concerning the regulation of skeletal muscle bHLH protein activity during myogenesis.
Animals↗
Identification of skeletal muscle precursor cells in vivo by use of MyoD1 and myogenin probes.
The activation of mononuclear muscle precursor cells after crush injury to mouse tibialis anterior muscles was monitored in vivo by in situ hybridization with MyoD1 and myogenin probes. These genes are early markers of skeletal muscle differentiation and have been extensively studied in vitro. The role in vivo of these regulatory proteins during myogenesis of mature muscle has not been studied previously. MyoD1 and myogenin mRNA were present in occasional mononuclear cells of uninjured muscle. Increased MyoD1 and myogenin mRNA sequences in mononuclear cells were detected as early as 6 h after injury, peaked between 24 and 48 h, and thereafter declined to pre-injury levels at about 8 days. The mRNAs were detected in mononuclear cells throughout the muscle, with the majority of cells located some distance from the site of crush injury. The presence of MyoD1 and myogenin mRNA at 6 to 48 h indicates that transcription of these genes is occurring at the same time as replication of muscle precursor cells in vivo. At no time were significant levels of mRNA for these genes detected in myotubes. MyoD1 and myogenin provide precise markers for the very early identification and study of mononuclear skeletal muscle precursor cells in muscle regenerating in vivo.
Animals↗
Cellular and molecular advances in elucidating p53 function.
The finding that in many human tumors there is allelic loss and/or mutations in p53, in combination with recognition that these events may play a role in multi-stage carcinogenesis, has focused considerable interest on this gene. To help keep abreast of this rapidly expanding field, recent experiments on the role and potential regulation of p53 are described: these include discussions of p53 as an anti-proliferative agent, the p53 mutations found in human tumors and tumor cell lines, the conformational states of p53, phosphorylation of p53 by p34cdc2, and signals for the nuclear localization of p53. p53 may act as a transcriptional activator and the specific DNA sequences to which p53 protein binds are also discussed as is the importance of abrogation of p53 function in overcoming cellular senescence.
Base Sequence↗
Telomere positional effects and the regulation of cellular senescence.
Normal cells have a limited capacity to proliferate but the molecular clock that regulates the onset of cellular senescence remains unidentified. The ends of chromosomes--telomeres--have been shown to shorten progressively with age in normal cells. Here, we present a working model of how telomeric shortening may induce programmed changes in the regulation of cellular proliferation.
Cell Death↗
Muscle basic helix-loop-helix proteins and the regulation of myogenesis.
Significant progress has been made in defining the structural motifs that distinguish the muscle-specific from other basic helix-loop-helix proteins. Evidence is accumulating for multiple levels of regulation of the expression and action of the muscle basic helix-loop-helix factors.
Animals↗
MyoD, myogenin independent differentiation of primordial myoblasts in mouse somites.
The accumulation of two myogenic regulatory proteins, MyoD and myogenin, was investigated by double-immunocytochemistry and correlated with myosin heavy chain expression in different classes of myoblasts in culture and during early myogenesis in vivo. During in vitro differentiation of fetal myoblasts, MyoD-positive cells were detected first, followed by the appearance of cells positive for both MyoD and myogenin and finally by the appearance of differentiated myocytes and myotubes expressing myosin heavy chain (MHC). A similar pattern of expression was observed in cultures of embryonic and satellite cells. In contrast, most myogenic cells isolated from newly formed somites, expressed MHC in the absence of detectable levels of myogenin or MyoD. In vivo, the appearance of both myogenin and MyoD proteins was only detected at 10.5 d postcoitum (d.p.c.), when terminally differentiated muscle cells could already be identified in the myotome. Parasagittal sections of the caudal myotomes of 10.5-d-old embryos showed that expression of contractile proteins preceded the expression of myogenin or MyoD and, when coexpressed, MHC and myogenin did not co-localize within all the cells of the myotome. In the limb bud, however, many myogenin (or MyoD) positive/MHC negative cells could be observed in the proximal region at day 11. During further embryonic development the expression of these proteins remained constant in all the muscle anlagens examined, decreasing to a low level during the late fetal period. Western and Northern analysis confirmed that the myogenin protein could only be detected after 10.5 d.p.c. while the corresponding message was clearly present at 9.5 d.p.c., strongly suggesting a posttranscriptional regulation of myogenin during this stage of embryonic development. These data show that the first myogenic cells which appear in the mouse myotome, and can be cultured from it, accumulate muscle structural proteins in their cytoplasm without expressing detectable levels of myogenin protein (although the message is clearly accumulated). Neither MyoD message or protein are detectable in these cells, which may represent a distinct myogenic population whose role in development remains to be established.
Animals↗