Biomedical subjects

W David Wilson

Publications and source records attributed to W David Wilson.

At least 19 recordsLinked to original sources

PubMed2006

Synthesis and antiparasitic evaluation of bis-2,5-[4-guanidinophenyl]thiophenes.

A series of bis-2,5-[4-guanidinophenyl]thiophenes were prepared in a five step process starting from 2,5-bis[trimethylstannyl]thiophene. The compounds were evaluated in vitro against Trypanosoma brucei rhodesiense (T. b. r.), Plasmodium falciparum (P. f.), Leshmania donovani (L. d.) and Trypanasoma cruzi (T. c.), and in vivo against T. b. r. Certain compounds show promising in vitro activity against T. b. r. and P. f. and have superior in vivo activity against T. b. r. to that of pentamidine and furamidine.

Animals↗

PubMed2006

Synthesis, DNA affinity, and antiprotozoal activity of linear dications: Terphenyl diamidines and analogues.

Diamidines 10a-g and 18a,b were obtained from dinitriles 9a-g and 15a,b by treatment with lithium trimethylsilylamide or upon hydrogenation of bis-O-acetoxyamidoximes. Dinitriles 9a-g were prepared via Suzuki reactions between arylboronic acids and arylnitriles. Potential prodrugs 12a-f and 17 were prepared via methylation of the diamidoximes 11a-f and 16a. Significant DNA affinities for rigid-rod molecules were observed. Compounds 10a, 10b, 10d, 18a, and 18b show IC50 values of 5 nM or less against Trypanosoma brucei rhodesiense (T. b. r.) and 10a, 10b, 10e, 18a, and 18b gave similar ones against Plasmodium falciparum (P.f.). The dications, 10a, 10d, 10f, and 10g are more active than furamidine in vivo. The prodrugs are only moderately effective on oral administration. Mouse liver microsome bioconversion of the methamidoxime prodrugs is significantly reduced from that of pafuramidine and suggests that the in vivo efficacy of these prodrugs is, in part, due to poor bioconversion.

Administration, Oral↗

PubMed2006

Dicationic DNA-targeted antiprotozoal agents: naphthalene replacement of benzimidazole.

A series of naphthalene analogues of highly active benzimidazole diamidines were synthesized using sequential Stille and Suzuki coupling reactions for preparation of the bis-nitrile intermediates. All of the diamidines showed strong DNA affinities as judged by high DeltaTm values with poly(dA-dT). The dicationic compounds were quite active in vitro versus Trypanosoma brucei rhodesiense (T. b. r.) exhibiting IC50 values ranging from 4 to 98 nM. These compounds were also active versus Plasmodium falciparum (P. f.) giving IC50 values ranging from 4 to 33 nM. Two of the compounds showed good activity in vivo in the STIB900 model for acute African trypanosomiasis; one gave 3/4 cures and the other gave 4/4 cures on ip dosage of 20 mg/kg for 4 days. The amidoxime prodrugs of the naphthalene analogues were essentially ineffective.

Animals↗

PubMed2006

A high-throughput, high-resolution strategy for the study of site-selective DNA binding agents: analysis of a "highly twisted" benzimidazole-diamidine.

A general strategy for the rapid structural analysis of DNA binding ligands is described as it was applied to the study of RT29, a benzimidazole-diamidine compound containing a highly twisted diphenyl ether linkage. By combining the existing high-throughput fluorescent intercalator displacement (HT-FID) assay developed by Boger et al. and a high-resolution (HR) host-guest crystallographic technique, a system was produced that was capable of determining detailed structural information pertaining to RT29-DNA interactions within approximately 3 days. Our application of the HT/HR strategy immediately revealed that RT29 has a preference for 4-base pair (bp), A.T-rich sites (AATT) and a similar tolerance and affinity for three A-T-bp sites (such as ATTC) containing a G.C bp. On the basis of these selectivities, oligonucleotides were designed and the host-guest crystallographic method was used to generate diffraction quality crystals. Analysis of the resulting crystal structures revealed that the diphenyl ether moiety of RT29 undergoes conformational changes that allow it to adopt a crescent shape that now complements the minor groove structure. The presence of a G.C bp in the RT29 binding site of ATTC did not overly perturb its interaction with DNA-the compound adjusted to the nucleobases that were available through water-mediated interactions. Our analyses suggest that the HT/HR strategy may be used to expedite the screening of novel minor groove binding compounds leading to a direct, HR structural determination.

Base Pairing↗

PubMed2006

Structure-specific recognition of quadruplex DNA by organic cations: influence of shape, substituents and charge.

Combining structure-specific recognition of nucleic acids with limited sequence reading is a promising method to reduce the size of the recognition unit required to achieve the necessary selectivity and binding affinity to control function. It has been demonstrated recently that G-quadruplex DNA structures can be targeted by organic cations in a structure-specific manner. Structural targets of quadruplexes include the planar end surfaces of the G-tetrad stacked columns and four grooves. These provide different geometries and functional groups relative to duplex DNA. We have used surface plasmon resonance and isothermal titration calorimetry to show that binding affinity and selectivity of a series of quadruplex end-stacking molecules to human telomeric DNA are sensitive to compound shape as well as substituent type and position. ITC results indicate that binding is largely enthalpy driven. Circular dichroism was also used to identify a group of structurally related compounds that selectively target quadruplex grooves.

Calorimetry↗

PubMed2006

DNA binding affinity of bisguanidine and bis(2-aminoimidazoline) derivatives with in vivo antitrypanosomal activity.

A new antitrypanosomal hit compound that cures an acute (STIB 900) mouse model of Trypanosoma brucei rhodesiense trypanosomiasis is described. This bis(2-aminoimidazolinium) dicationic compound proved to be an excellent DNA minor groove binder, suggesting a possible mechanism for its trypanocidal activity. From these studies, the 4,4'-diaminodiphenylamine skeleton emerged as a good scaffold for antitrypanosomal drugs.

Animals↗

PubMed2006

Temporal detection of equine herpesvirus infections of a cohort of mares and their foals.

The objectives of this study were to estimate the prevalence of equine herpesviruses (EHV) 1-5 in the nasal secretions (NS) of a cohort of 12 mares and their foals from birth to 6 months of age, estimate the prevalence of EHV-1-5 infection of peripheral blood mononuclear cells (PBMC) of selected foals, and investigate phylogenetic relationships amongst the various strains of EHV-2 and 5. Virus-specific PCR assays were used to detect EHV-1-5 in NS and PBMC. A homologous portion of the glycoprotein B (gB) gene of the various strains of EHV-2 and 5 was sequenced and compared. EHV-2, 4, and 5 were all detected in NS from the horses, but only EHV-4 was associated with respiratory disease (P=0.005). EHV-2 and 5 infections were both common, but foals shed EHV-2 in their NS earlier in life than EHV-5 (P=0.01). Latent EHV-2 and 5 infections were detected in the PBMC of 75 and 88%, respectively, of the foals at approximately 6 months of age. The strains of EHV-2 shed in the NS of individual horses were more genetically heterogeneous than the strains of EHV-5 (95.5-99.3% versus 98.8-99.3% nucleotide identity, respectively). One-month-old foals typically shed strains of EHV-2 that were identical to those infecting their dams whereas older foals often shed virus strains that were different from those of their dams. Although herpesvirus infections were ubiquitous in this cohort of horses, there were distinct clinical consequences and clear epidemiological differences between infections with the different viruses.

Aging↗

PubMed2006

Binding of netropsin and 4,6-diamidino-2-phenylindole to an A2T2 DNA hairpin: a comparison of biophysical techniques.

Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies.

Amidines↗

PubMed2006

Trisubstituted acridines as G-quadruplex telomere targeting agents. Effects of extensions of the 3,6- and 9-side chains on quadruplex binding, telomerase activity, and cell proliferation.

The synthesis is reported of a group of 3,6,9-trisubstituted acridine compounds as telomeric quadruplex-stabilizing ligands with systematic variations at the 3-, 6-, and 9-positions. A new microwave-assisted methodology has been developed for trisubstituted acridine synthesis. Structure-activity relationships are reported using surface plasmon resonance and a fluorescence melting assay to examine quadruplex binding, together with a telomerase inhibition assay. These reveal relationships between G-quadruplex stabilization and telomerase inhibition and optimal 3,6- and 9-substituent side-chain lengths for maximal activity. Qualitative molecular modeling using molecular dynamics simulations has been undertaken on four quadruplex-DNA complexes. Long-term exposure of MCF7 cancer cells to a subset of the most active compounds, at doses lower than the IC(50) values, showed that one compound produced a marked decrease in population growth, accompanied by senescence, which is consistent with telomere targeting by this agent.

Acridines↗

PubMed2006

3D QSAR on a library of heterocyclic diamidine derivatives with antiparasitic activity.

African trypanosomes, Trypanosoma brucei rhodesiense (TBR) and Trypanosoma brucei gambiense (TBG), affect hundreds of thousands of lives in tropical regions of the world. The toxicity of the diamidine pentamidine, an effective drug against TBG, necessitates the design of better drugs. An orally effective prodrug of the diamidine, furamidine (DB75), presently scheduled for phase III clinical trials, has excellent activity against TBG with toxicity lower than that of pentamidine. As part of an effort to develop additional and improved diamidines against African trypanosomes, CoMFA and CoMSIA 3D QSAR analyses have been conducted with furamidine and a set of 25 other structurally related compounds. Two different alignment strategies, based on a putative kinetoplast DNA minor groove target, were used. Due to conserved electrostatic properties across the compounds, models that used only steric and electronic properties did not perform well in predicting biological results. An extended CoMSIA model with additional descriptors for hydrophobic, donor, and acceptor properties had good predictive ability with a q2=0.699, r2=0.974, SEE, standard error of estimate=0.1, and F=120.04. The results have been used as a guide to design compounds that, potentially, have better activity against African trypanosomes.

Animals↗

PubMed2006

Synthesis and evaluation of an intercalator-polyamide hairpin designed to target the inverted CCAAT box 2 in the topoisomerase IIalpha promoter.

The synthesis and DNA-binding properties of a novel naphthalimide-polyamide hairpin (3) designed to target the inverted CCAAT box 2 (ICB2) site on the topoisomerase IIalpha (topoIIalpha) promoter are described. The polyamide component of 3 was derived from the minor-groove binder, 2, and tailored to bind to the 5'-TTGGT sequence found in and flanking ICB2. The propensity of mitonafide 4 to intercalate between G-C base pairs was exploited by the incorporation of a naphthalimide moiety at the N terminus of 2. Hybrid 3 targeted 5'-CGATTGGT and covered eight contiguous base pairs, which included the underlined ICB2 site. DNase I footprinting analysis with the topoIIalpha promoter sequence demonstrated that 3 bound selectively to the ICB2 and ICB3 sites. Thermal-denaturation studies confirmed these results, and the highest degree of stabilization was found for ICB2 and -3 in preference to ICB1 (4.1, 4.6, and 0.6 degrees C, respectively). CD studies confirmed minor-groove binding and suggested a 1:1 binding stoichiometry. Emission-titration experiments established intercalative binding. Surface plasmon resonance results showed strong binding to ICB2 (2.5x10(7) M(-1)) with no observable binding to ICB1. Furthermore, the binding constant of 3 to ICB2 was larger than that of the parent polyamide 2. The increased binding affinity was primarily due to a reduction in the dissociation-rate constant of the polyamide-DNA complex, which can be attributed to the N-terminal naphthalimide moiety. In addition, the binding site of 3 was larger than that of 2, which innately improved sequence selectivity. We conclude that the polyamide-naphthalimide 3 selectively binds to the ICB2 site by simultaneous intercalation and minor-groove binding, and warrants further investigation as a model compound for the regulation of topoIIalpha gene expression.

Base Sequence↗

PubMed2006

Indirect fluorescent antibody testing of cerebrospinal fluid for diagnosis of equine protozoal myeloencephalitis.

OBJECTIVE: To assess the use of CSF testing with an indirect fluorescent antibody test (IFAT) for diagnosis of equine protozoal myeloencephalitis (EPM) caused by Sarcocystis neurona. SAMPLE POPULATION: Test results of 428 serum and 355 CSF samples from 182 naturally exposed, experimentally infected, or vaccinated horses. PROCEDURE: EPM was diagnosed on the basis of histologic examination of the CNS. Probability distributions were fitted to serum IFAT results in the EPM+ and EPM-horses, and correlation between serum and CSF results was modeled. Pairs of serum-CSF titers were generated by simulation, and titer-specific likelihood ratios and post-test probabilities of EPM at various pretest probability values were estimated. Post-test probabilities were compared for use of a serum-CSF test combination, a serum test only, and a CSF test only. RESULTS: Post-test probabilities of EPM increased as IFAT serum and CSF titers increased. Post-test probability differences for use of a serum-CSF combination and a serum test only were < or = 19% in 95% of simulations. The largest increases occurred when serum titers were from 40 to 160 and pre-test probabilities were from 5% to 60%. In all simulations, the difference between pre- and post-test probabilities was greater for a CSF test only, compared with a serum test only. CONCLUSIONS AND CLINICAL RELEVANCE: CSF testing after a serum test has limited usefulness in the diagnosis of EPM. A CSF test alone might be used when CSF is required for other procedures. Ruling out other causes of neurologic disease reduces the necessity of additional EPM testing.

Animals↗

PubMed2006

Comparative analysis of cytokine gene expression in cerebrospinal fluid of horses without neurologic signs or with selected neurologic disorders.

OBJECTIVE: To determine gene transcription for cytokines in nucleated cells in CSF of horses without neurologic signs or with cervical stenotic myelopathy (CSM), West Nile virus (WNV) encephalitis, equine protozoal myeloencephalitis (EPM), or spinal cord trauma. ANIMALS: 41 horses (no neurologic signs [n = 12], CSM [8], WNV encephalitis [9], EPM [6], and spinal cord trauma [6]). PROCEDURES: Total RNA was extracted from nucleated cells and converted into cDNA. Gene expression was measured by use of real-time PCR assay and final quantitation via the comparative threshold cycle method. RESULTS: Cytokine genes expressed by nucleated cells of horses without neurologic signs comprised a balance between proinflammatory tumor necrosis factor-alpha (TNF-alpha), anti-inflammatory cytokines (interleukin [IL]-10 and transforming growth factor [TGF]-beta), and Th1 mediators (interferon [IFN]-gamma). Cells of horses with CSM mainly expressed genes for TNF-alpha, TGF-beta, and IL-10. Cells of horses with WNV encephalitis mainly expressed genes for IL-6 and TGF-beta. Cells of horses with EPM mainly had expression of genes for IL-6, IL-8, IL-10, TNF-alpha, IFN-gamma, and TGF-beta. Cells from horses with spinal cord trauma had expression mainly for IL-6; IFN-gamma; TGF-beta; and less frequently, IL-2, IL-10, and TNF-alpha. Interleukin-8 gene expression was only detected in CSF of horses with infectious diseases. CONCLUSIONS AND CLINICAL RELEVANCE: Despite the small number of CSF samples for each group, results suggest distinct gene signatures expressed by nucleated cells in the CSF of horses without neurologic signs versus horses with inflammatory or traumatic neurologic disorders.

Animals↗

PubMed2005

Binding-linked protonation of a DNA minor-groove agent.

The energetics for binding of a diphenyl diamidine antitrypanosomal agent CGP 40215A to DNA have been studied by spectroscopy, isothermal titration calorimetry, and surface plasmon resonance biosensor methods. Both amidines are positively charged under experimental conditions, but the linking group for the two phenyl amidines has a pK(a) of 6.3 that is susceptible to a protonation process. Spectroscopic studies indicate an increase of 2.7 pK(a) units in the linking group when the compound binds to an A/T minor-groove site. Calorimetric titrations in different buffers and pH conditions support the proton-linkage process and are in a good agreement with spectroscopic titrations. The two methods established a proton-uptake profile as a function of pH. The exothermic enthalpy of complex formation varies with different pH conditions. The observed binding enthalpy increases as a function of temperature indicating a negative heat capacity change that is typical for DNA minor-groove binders. Solvent accessible surface area calculations suggest that surface burial accounts for about one-half of the observed intrinsic negative heat capacity change. Biosensor and calorimetric experiments indicate that the binding affinities vary with pH values and salt concentrations due to protonation and electrostatic interactions. The surface plasmon resonance binding studies indicate that the charge density per phosphate in DNA hairpins is smaller than that in polymers. Energetic contributions from different factors were also estimated for the ligand/DNA complex.

Amidines↗

PubMed2005

Out-of-shape DNA minor groove binders: induced fit interactions of heterocyclic dications with the DNA minor groove.

DB921 and DB911 are benzimidazole-biphenyl isomers with terminal charged amidines. DB911 has a central meta-substituted phenyl that gives it a shape similar to those of known minor groove binding compounds. DB921 has a central para-substituted phenyl with a linear conformation that lacks the appropriate radius of curvature to match the groove shape. It is thus expected that DB911, but not DB921, should be an effective minor groove binder, but we find that DB921 not only binds in the groove but also has an unusually high binding constant in SPR experiments (2.9 x 10(8) M(-)(1), vs 2.1 x 10(7) M(-)(1) for DB911). ITC thermodynamic analysis with an AATT sequence shows that the stronger binding of DB921 is due to a more favorable binding enthalpy relative to that of DB911. CD results support minor groove binding for both compounds but do not provide an explanation for the binding of DB921. X-ray crystallographic analysis of DB921 bound to AATT shows that an induced fit structural change in DB921 reduces the twist of the biphenyl to complement the groove, and places the functional groups in position to interact with bases at the floor of the groove. The phenylamidine of DB921 forms indirect contacts with the bases through a bound water. The DB921-water pair forms a curved binding module that matches the shape of the minor groove and provides a number of strong interactions that are not possible with DB911. This result suggests that traditional views of compound curvature required for minor groove complex formation should be reevaluated.

Amidines↗

PubMed2005

Synthesis, DNA affinity, and antiprotozoal activity of fused ring dicationic compounds and their prodrugs.

Dicationic guanidine, N-alkylguanidine, and reversed amidine derivatives of fused ring systems have been synthesized from their corresponding bis-amines. DNA binding studies suggest that the diguanidines and the N-alkyl diguanidines fluorenes bind in the minor groove in a manner similar to that of the previously reported dicationic carbazole derivatives. The diguanidines and the N-alkyl diguanidines showed promising in vitro activity against both Trypanosoma brucei rhodesiense and Plasmodium falciparum. Promising in vivo biological results were obtained for the dicationic N-isopropylguanidino-9H-fluorene, giving 4/4 cures of the treated animals in the STIB900 animal model for African trypanosomiasis. The N-methyl analogue showed high activity as well. In addition, with the goal of enhancing the oral bioavailability, two novel classes of potential guanidine prodrugs were prepared. The N-alkoxyguanidine derivatives were not effective as prodrugs. In contrast, a number of the carbamates showed promising activity. The value of the carbamate prodrugs was clearly demonstrated by the results, which gave 4/4 cures on oral administration in the STIB900 mouse model.

Animals↗

PubMed2005

Dicationic near-linear biphenyl benzimidazole derivatives as DNA-targeted antiprotozoal agents.

A series of near-linear biphenyl benzimidazole diamidines 5a-h were synthesized from their respective diamidoximes (4a-h), through the bis-O-acetoxyamidoxime, followed by hydrogenation in glacial acetic acid/ethanol in the presence of Pd-C. Compounds 4a-h were obtained in three steps, starting with the Suzuki coupling reaction of the appropriate haloarylcarbonitriles 1a-g or 4-bromo-2-fluorobenzaldehyde with 4-formylphenylboronic acid or 4-cyanophenylboronic acid to form the anticipated 4-formylbiphenyl carbonitrile analogues 2a-h. Subsequent condensation of the formyl derivatives 2a-h with 3,4-diaminobenzonitrile in the presence of sodium bisulfite or 1,4-benzoquinone gave the desired dinitriles 3a-h, the precursors for 4a-h. All the diamidines showed strong DNA affinities, as judged by high Delta Tm values with poly(dA.dT)2) The compounds were quite active in vitro versus Trypanosoma brucei rhodesiense, giving IC50 values ranging from 3 to 37 nM. These compounds were even more active versus Plasmodium falciparum, exhibiting IC50 values ranging from 0.5 to 23 nM. The compounds showed moderate to good activity in vivo in the STIB900 model for acute African trypanosomiasis. The most active compounds 5b and e gave 3/4 cures on an IP dosage of 20 mg/kg.

Animals↗

PubMed2005

Evaluation of clinical characteristics, diagnostic test results, and outcome in horses with internal infection caused by Corynebacterium pseudotuberculosis: 30 cases (1995-2003).

OBJECTIVE: To determine clinical signs, results of diagnostic testing, and outcome in horses with internal Corynebacterium pseudotuberculosis infection. DESIGN: Retrospective study. ANIMALS: 30 horses. PROCEDURE: Information pertaining to clinical data, results of diagnostic tests, and costs of hospitalization and treatment was extracted from medical records of affected horses. RESULTS: Internal C. pseudotuberculosis infection was diagnosed on the basis of clinical signs, diagnostic imaging, and clinicopathologic data, including results of serologic tests and bacterial culture. The most common clinical signs were concurrent external abscesses, anorexia, fever, lethargy, weight loss, and signs of respiratory tract disease or abdominal pain. Clinicopathologic abnormalities included a geometric mean reciprocal serum synergistic hemolysin inhibition titer > or = 512, leukocytosis with neutrophilia, hyperglobulinemia, hyperfibrinogenemia, and anemia. Specific organ involvement was diagnosed in 27 of 30 horses. Affected organs included the liver (18 horses), lungs (12), kidneys (7), and spleen (3); multiple organs were affected in 10 horses. Treatment with antimicrobials for a median of 36 days (range, 7 to 97 days) was usually successful, yielding an overall survival rate of 71%. CONCLUSIONS AND CLINICAL RELEVANCE: Early diagnosis and long-term antimicrobial treatment were important for a successful outcome in horses with internal C. pseudotuberculosis infection. Ultrasonographic imaging was an important technique for identifying specific organs affected, aiding in obtaining samples for a definitive diagnosis, and monitoring response to treatment. Pregnant mares with internal infections are at risk for fetal loss. Preexisting chronic organ disease may be associated with a poor prognosis.

Animals↗