Gastric foreign body in a horse.
Explore the source record for details and available documents.
Animals↗
Biomedical subjects
W D Wilson
Publications and source records attributed to W D Wilson.
Oligonucleotide N3'-->P5' phosphoramidates.
Synthetic oligonucleotides and their analogs have attracted considerable interest recently. These compounds may lead to highly specific therapeutic agents, as well as to powerful diagnostic tools. Here, we present the synthesis of uniformly modified oligodeoxyribonucleotide N3'-->P5' phosphoramidates containing 3'-NHP(O)(O-)O-5' internucleoside linkages and the study of their hybridization properties. Thermal dissociation experiments show that these compounds form very stable duplexes with single-stranded DNA, RNA, and with themselves following Watson-Crick base pairing. The duplex thermal stability was enhanced by 2.2-2.6 degrees C per modified linkage compared with phosphodiesters. The structure of complexes formed by phosphoramidates closely resembles that of RNA oligomers and corresponds to an A form, as judged by CD spectroscopy. N3'-->P5' phosphoramidates also form stable triplexes with double-stranded DNA under near-physiological conditions when natural phosphodiesters fail to do so. Physicochemical characteristics of the amidates are similar to those of RNA oligomers, even though they are composed of 2'-deoxyfuranose-based nucleosides.
Amides↗
Footprinting studies on ligands which stabilize DNA triplexes: effects on stringency within a parallel triple helix.
We have examined the effect of four triplex-binding ligands on the interaction of the oligodeoxynucleotides T8NT8 (N = A, G, C, T) with DNA fragments containing the sequences A8XA8.T8YT8 (X = G, C, T; Y = C, G, A) by DNase I footprinting. The ligands form a series of quinoline derivatives with an alkylamine chain in the 4-position and different aryl substituents in the 2-position. By themselves these compounds do not alter DNase I digestion of the DNA duplexes at concentrations up to 100 microM. At a concentration of 10 microM they potentiate triplex formation, lowering the concentration of oligonucleotide required to produce a clear footprint by as much as 100-fold. As well as stabilizing triplexes which consist of well-characterized DNA triplets, they also promote the formation of complexes which contain central triplet mismatches. This reduction in the stringency of triple helix formation may be used to broaden the range of triplex target sequences and enable recognition at sites which contain short regions for which there are no good triplet matches.
Animals↗
Dicationic diarylfurans as anti-Pneumocystis carinii agents.
Seven dicationic 2,5-diarylfurans have been synthesized, and their interactions with poly(dA-dT) and the duplex oligomer d(CGCCAATTCGCG)2 were evaluated by Tm measurements. The inhibition of topoisomerase II isolated from Giardia lamblia, the inhibition of growth of G. lamblia in cell culture by these furans, and the effectiveness of these compounds against Pneumocystis carinii in the immunosuppressed rat model have been assessed. Strong binding affinities to poly(dA-dT) and to the oligomer were observed for the dicationic furans, and the interaction strength is directly correlated to the biological activity of the compounds. An X-ray structure for the complex of the dicationic amidine derivative, 2,5-bis(4-guanylphenyl)furan (1), with the oligomer demonstrates the snug fit of these compounds with the AATT minor-groove binding site and hydrogen bonds to AT base pairs at the floor of the minor groove. The stronger DNA binding molecules are the most effective inhibitors of topoisomerase II and G. lamblia in cell culture, and there is a correlation for both DNA interaction and topoisomerase II inhibition with the biological activity of these compounds against G. lamblia. Compound 1 is the most effective against P. carinii, it is more active and less toxic than pentamidine on intravenous administration and it is also effective by oral dosage. The results presented here suggest a model for the biological action of these compounds in which the dication first binds in the minor groove of DNA and forms a complex that results in the inhibition of the microbial topoisomerase II enzyme.
Animals↗
Small changes in cationic substituents of diphenylfuran derivatives have major effects on the binding affinity and the binding mode with RNA helical duplexes.
The interactions of dicationic, 2-4, and tetracationic, 5-7, diphenylfuran analogs of 1 (furamidine) with RNA have been analyzed by thermal melting, spectroscopic, viscometric, kinetic and molecular-modeling techniques. The results of these studies indicate that most of the furan derivatives bind to RNA duplexes by intercalation in contrast to their minor-groove binding mode in AT sequences of DNA, but similar to their binding mode in GC rich regions of DNA. The highest affinity for RNA is found for an imidazoline dication, 2. With some substituents which inhibit formation of a strong intercalation complex, the results suggest a non-intercalative type of binding occurs. The non-intercalative binding probably occurs through a complex with the furan derivative bound in the narrow, deep major groove of A-form RNA helices.
Amidines↗
Parasites of the Abert's squirrel (Sciurus aberti) and red squirrel (Tamiasciurus hudsonicus) of New Mexico.
Between 1989 and 1991, 29 Abert squirrels (Sciurus aberti) and 45 red squirrels (Tamiasciurus hudsonicus) were collected in New Mexico and examined for parasites. Of 29 S. aberti examined, 86.2% (25/29) were infected with at least 1 parasite species. Helminths were found in 62.1% (18/29) of S. aberti; 37.9% (11/29) were infected with fleas and 37.9% (11/29) with the coccidian Eimeria tamiasciuri. Among T. hudsonicus, 82.5% of the squirrels examined were infected with at least 1 parasite. Helminths were found in 57.8% (26/45) of T. hudsonicus; 22.2% (10/45) were infected with fleas and 26.7% (12/45) with Eimeria tamiasciuri. Citellinema quadrivittati was found in squirrels of both species; 55.2% (16/29) of S. aberti were infected, with 57.8% (26/45) of T. hudsonicus carrying the parasite. Enterobius sciuri was only found in S. aberti with 17.2% (5/29) carrying the infection. One cestode, Hymenolepis sp., was found only in T. hudsonicus with 6.7% (3/45) carrying the infection. Four species of flea were found on squirrels of both species. Ceratophyllus vison was found on 6.9% (2/29) of S. aberti and 6.7% (3/45) of T. hudsonicus examined. Opisodasys robustus was found on 6.9% (2/29) of S. aberti and 8.8% (4/45) of T. hudsonicus examined. Orchopeas caedens caedens was found on 3.4% (1/29) of S. aberti and 6.7% (3/45) of T. hudsonicus examined. Orchopeas neotomae was found on 10.3% (3/29) of S. aberti and 6.7% (3/45) of T. hudsonicus examined. Two species of flea were only found on T. hudsonicus; Orchopeas leucopus was found on 2.2% (1/45) and Oropsylla idahoensis was found on 2.2% (1/45) of the T. hudsonicus examined.(ABSTRACT TRUNCATED AT 250 WORDS)
Animals↗
1D and 2D 1H NMR studies on bisantrene complexes with short DNA oligomers.
The binding of bisantrene to four DNA tetramers, d(CGCG)2, d(GCGC)2, d(CATG)2, and d(GTAC)2, was investigated by 1D and 2D NMR spectroscopy. Bisantrene is a well known anticancer drug and has been used clinically for years. DNA is believed to be one of its cellular targets. Results from both 1D and 2D 1H NMR are in agreement with an intercalation binding mode of bisantrene with the four DNA tetramers in this study. The results further indicate that a threading intercalation binding mode, in which one bisantrene side chain is in the minor groove and the other in the major groove of DNA, is preferred. The NMR results also suggest that bisantrene prefers binding at pyrimidine-(3',5')-purine intercalation sequences rather than at purine-(3',5')-pyrimidine sequences. The intramolecular and intermolecular NOE contacts of bisantrene-DNA tetramer complexes indicate that a C2'-endo uniform sugar pucker, rather than a mixed sugar conformation, is preferred by the intercalation site of both the 5'-(TA)-3' and the 5'-(CG)-3' binding steps.
Anthracenes↗
Effect of a triplex-binding ligand on parallel and antiparallel DNA triple helices using short unmodified and acridine-linked oligonucleotides.
We have used DNase I footprinting to investigate the effect of a triplex-binding ligand on the formation of intermolecular DNA triple helices at target sites that have been cloned into longer DNA fragments. In the presence of a triplex-binding ligand (N-[2-(dimethylamino)ethyl]-2-(2-naphthyl)quinolin-4-ylamine ), the concentrations of T5C5 and C5T5 required to generate DNase I footprints at the target sites A6G6.C6T6 and G6A6.T6C6, respectively, are reduced by at least 100-fold. Complexes with the acridine-linked oligonucleotides Acr-T5C5 and Acr-C5T5 are stabilized to a much lesser extent and produce footprints at concentrations similar to those of the unmodified oligonucleotides in the presence of the ligand. The stabilizing effects of acridine modification or the addition of a triplex-binding ligand are not additive. The position and length of the footprints produced by Acr-T5C5 and T5C5 at the target sequence A6G6.C6T6 are unaffected by the ligand. In contrast, footprints at the target site G6A6.T6C6 appear 3-4 bases shorter in the presence of the ligand, when viewed from the pyrimidine strand, and 1-2 bases longer on the purine strand. These results are explained by suggesting that the compound binds at T.AT triplets and prevents the transmission of any DNA structural changes into the flanking duplex. The compound has a smaller stabilizing effect on short antiparallel triplexes consisting of G.GC and T.AT triplets. Binding of Acr-G5T5 to A6G6.C6T6 is enhanced slightly by the compound, which increases the apparent footprinting site, probably by preventing fraying at the 3'-end of the third strand. The compound does not promote the binding of G5T5 to A6G6.C6T6 or that of Acr-T5G5 and T5G5 to G6A6.T6C6.
Acridines↗
Hairpin formation within the human enkephalin enhancer region. 2. Structural studies.
Receptor-mediated induction of the human proenkephalin gene has been mapped to an imperfect palindrome located between -104 and -86, upstream of the transcriptional start site. Several lines of evidence suggest that receptor-mediated transcription of proenkephalin involves a reversible conformational change from duplex to a hairpin state of the enhancer [McMurray, C.T., Wilson, W.D., & Douglass, J.O. (1991) Proc. Natl. Acad. Sci. U.S.A. 88, 666]. To determine the structure that would form if such a conformational change took place, we have synthesized two 23-bp oligonucleotides, d(GCTGGCGTAGGGCCTGCGTCAGC) and d(GCTGACGCAGGCCCTACGCCAGC), whose sequences are identical to the top and the bottom strands of the native enhancer. We have found that each oligonucleotide strand exists primarily as a hairpin structure over a wide range of oligonucleotide concentrations and a wide range of temperatures (0-45 degrees C). The assignment of each imino proton was carried out using 1D and 2D nuclear Overhauser effects (NOE) and by comparison with the spectra of hairpins containing single base substitutions. The hairpin structure for each oligonucleotide contains a 3-member loop, a 10-bp stem, and two mismatched pairs. The hairpin that forms from the top strand of the enhancer and contains two GT mispaired bases creates an alternative binding site for the cyclic adenosine monophosphate element binding protein (CREB), a transcription factor that binds to and regulates the human proenkephalin gene. Circular dichroism and 31P NMR indicate that, despite the presence of mismatched pairs, each oligonucleotide hairpin adopts a B-form conformation with no unusual bending or kinking. The structure of the hairpin may explain the effect on expression of point mutations within the enhancer.
Base Sequence↗
Sequence specific thermodynamic and structural properties for DNA.RNA duplexes.
DNA.RNA hybrid duplexes are found in many important biological processes and are involved in developing modes of disease treatment, such as antisense therapy, yet little is known about the sequence dependence of their structure and stability. The structure and thermodynamic stability of DNA.RNA hybrid model systems corresponding in composition and length and containing (1) all purine or all pyrimidine bases on each strand or (2) mixed purine and pyrimidine bases on each strand have been evaluated relative to pure RNA and DNA duplexes by thermal melting, CD, and electrophoresis analyses. The spread in free energies of denaturation of the homopurine.homopyrimidine systems covers over 14 kcal/mol of single strands, while the mixed sequence free energies vary by less than 4 kcal/mol. The RNA-homopurine.DNA-homopyrimidine hybrid resembles a corresponding pure RNA duplex in both structure and stability, whereas the DNA-homopurine.RNA-homopyrimidine hybrid resembles a corresponding pure DNA duplex. The mixed sequence hybrids show intermediate structure between the corresponding pure RNA and pure DNA duplexes and a stability closer to that of the pure DNA duplex. From these results and the evaluation of published hybrid data [Hall, K. B., & McLaughlin, L. W. (1991) Biochemistry 30, 10606-10613; Roberts, W. R., & Crothers, D. M. (1992) Science 258, 1463-1466], it can be predicted that a hybrid duplex containing more RNA purine bases will have a CD spectrum, and probably conformation, resembling that of A-form duplexes and will be more stable than a corresponding hybrid duplex with fewer RNA purine bases.
Base Sequence↗
Design and synthesis of RNA-specific groove-binding cations: implications for antiviral drug design.
As as initial step in the design of structure-specific RNA-interactive molecules as potential antiviral agents, we have focused on the synthesis of molecules that exhibit strong and preferential binding to duplex RNA. A series of polycationic ligands have been synthesized, and the degree of preferential binding to RNA has initially been determined by thermal denaturation (delta Tm) with both RNA [poly(A).poly(U)] and DNA [poly(dA).poly(dT)] polymers at a variety of pH values. Seven compounds from the series exhibit a substantial degree of RNA-selective binding. The relatively high delta Tm values obtained suggest a specific mode of interaction between these ligands and the RNA helix. By contrast, the much lower delta Tm values with poly(dA).poly(dT) DNA reflect a more nonspecific interaction mode. A viscometric titration study with poly(A).poly(U) confirms that they do not bind by intercalation. The results, combined with the known structure and electronegative potential of duplex RNA, suggest that these molecules bind in the major groove via specific electrostatic and/or hydrogen-bonded interactions.
Antiviral Agents↗
Solution structure of a GA mismatch DNA sequence, d(CCATGAATGG)2, determined by 2D NMR and structural refinement methods.
GA mismatches in DNA have drawn attention because of their special repair mechanisms, stability, and variety of conformations. A symmetric 10-base oligodeoxyribonucleotide duplex, d(CCATGAATGG)2, containing two GA mismatches has been investigated by one- and two-dimensional multinuclear NMR and molecular refinement procedures to ascertain the conformational details of the 5'-pyrimidine-GA-purine-3' sequence. A molecular model established from the NMR results has a B-type right-handed helix with each of the bases retaining the normal anti-glycosidic torsional angles. Type I mismatched base pairs have GNH2-AN7 and GN3-ANH2 (edge-to-edge) hydrogen bonds, while type II base pairs have GN1H-AN1 and GO6-ANH2 (face-to-face) bonds. The conformation at the GA mismatch site has type I GA base pairs and an unusual cross-strand stacking of the adjacent G5 and A6 bases, which causes significant overwinding of the helix at the mismatch site. Unusual shifts of the 31P resonances suggest that the phosphate linkage between G5 and A6 is no longer in the low-energy BI conformation. One-dimensional imino and phosphorus NMR studies were carried out on a number of DNA sequences containing adjacent 5'-GA-3' mismatched base pairs to investigate the sequence dependence of the conformations and base-pairing types. Type I and type II conformations have very different imino proton and 31P NMR spectral patterns that can be used to classify any sequence with adjacent GA mismatches by base-pairing and conformational type. The NMR results indicate that the conformation selected is dictated completely by the flanking sequence: 5'-pyrimidine-GA-purine-3' sequences adopt the type I conformation, while 5'-purine-GA-pyrimidine-3' sequences have the type II conformation.
Base Sequence↗
The interaction of substituted 2-phenylquinoline intercalators with poly(A).poly(U): classical and threading intercalation modes with RNA.
The interaction of a series of 2-phenylquinoline derivatives with RNA was investigated by means of viscometric, pKa, spectroscopic, binding, Tm, and kinetic methods. Compounds 1, 2, and 3 have a piperazyl substituent at the para, meta, or ortho position, respectively, while 4 has an unsubstituted phenyl ring. The pKa results suggest that 1 has three charges, 2 and 3 have more than two charges, and 4 has two charges at pH 6.2. Spectroscopic and Tm results indicate that 1 binds more strongly to RNA than 2-4. Kinetic and modeling results indicate that 1 is a threading intercalator while 2 and 4 are classical intercalators. All experimental results indicate that 3, which has a large twist between the phenyl and quinoline rings, binds weakly with RNA.
Antiviral Agents↗
The interaction of intercalators and groove-binding agents with DNA triple-helical structures: the influence of ligand structure, DNA backbone modifications and sequence.
The effects of ligand structure and properties, DNA backbone modifications and DNA sequence on the interaction of a variety of well-known groove-binding agents and intercalators with DNA duplexes and triplexes have been evaluated by thermal melting experiments and molecular modeling. Both methylphosphonate and phosphorothioate substitutions generally destabilize DNA duplexes and triplexes. Modified duplexes can be strongly stabilized by both groove-binding agents and intercalators whereas triplexes are primarily stabilized by intercalators. Of the compounds tested, the intercalators coralyne and quinacrine provide the largest stabilization of the triplex dT19.dA19.dT19. Molecular modeling studies suggest that the large intercalating ring system of coralyne stacks well with the triplex bases whereas the alkylamino side chain of quinacrine fits snugly into the remaining space of the major groove of dT19.dA19.dT19 triplex and forms extensive van der Waals contacts with the thymine methyl groups that line the groove. Converting some of the T.A.T base triples to C+.G.C (e.g. dT19.dA19.dT19 to d(T4C+)3T4.d(A4G)3A4.(T4C)3T4) causes very significant decreases in observed Tm increases for compounds such as quinacrine and coralyne. Although removal of thymine methyl groups and addition of positive charge on substitution of C+.G.C for T.A.T should reduce binding of cationic intercalators, the large difference observed between the pure AT and the mixed sequence triplexes suggest that they may also have differences in structure and properties.
Base Sequence↗
Biomphalaria glabrata hemolymph lectins: binding to bacteria, mammalian erythrocytes, and to sporocysts and rediae of Echinostoma paraensei.
Polyclonal antibodies were raised in rabbits to two groups of diffusely staining M line Biomphalaria glabrata plasma polypeptides, of 150-210 and 70-120 kDa, designated as Group 1 molecules (G1M) and group 2 molecules (G2M), respectively. G1M and G2M are known to increase in abundance and to become more diverse following infection of B. glabrata with the digenetic trematode Echinostoma paraensei. These antibodies were used in conjunction with immunoblotting and slot blotting procedures to document binding of G1M/G2M from plasma of unexposed control snails (C plasma) or plasma from snails with 8-day infections of E. paraensei (I plasma) to various targets. Binding of G1M/G2M to both gram-positive and gram-negative bacteria, human A, B, and O and rabbit erythrocytes, and to sporocysts and rediae of E. paraensei was documented. Immunoblots revealed that erythrocytes are bound by a particular G2M band of 100-120 kDa present in I plasma that is in low concentration or lacking in C plasma. This explains previous results indicating that I plasma agglutinates all 4 erythrocytes examined whereas C plasma agglutinates only rabbit erythrocytes. More G1M/G2M binding to sporocysts occurred if I plasma rather than C plasma was used for incubations. Also, monosaccharide inhibition of G1M/G2M binding to sporocysts was observed in I plasma but not in C plasma. The results indicate that infection with E. paraensei induces production by B. glabrata of unique plasma polypeptides and that molecules present in I plasma can bind to the surfaces of non-self objects including E. paraensei larvae in a lectin-like fashion.
Animals↗
Different binding mode in AT and GC sequences for unfused-aromatic dications.
We have previously synthesized a 2,5-diphenylfuranamidine dication (4) and presented evidence that this compound binds to AT sequences in DNA by a minor-groove interaction mode but binds to GC sequences by intercalation (1,2). To probe these sequence-dependent binding modes in more detail, and particularly to obtain additional evidence for the binding mode in GC rich sequences, we have synthesized and studied the DNA complexes of 1-3 which have the furan ring of 4 replaced by 2,6-substituted pyridine (1), pyrimidine (2), or triazine (3) ring systems. The three compounds with a six-membered central ring system bind to AT DNA sequences more weakly than the furan compound, but retain the minor-groove binding mode. The pyridine and pyrimidine derivatives bind to GC sequences of DNA more strongly than the furan, but the triazine derivative binds more weakly. The aromatic proton signals of 1-3, as previously observed with 4 shift upfield by approximately 0.5 ppm or greater on complex formation with polyd(G-C)2. This and other spectroscopic as well as viscosity and kinetics results indicate that 1-4 bind to GC sites in DNA by intercalation. A nonclassical intercalation model, with the twisted-unfused, aromatic ring system intercalated into an intercalation site of matching structure can explain all of our and the literature results for the GC binding mode of these unfused, aromatic compounds.
Base Sequence↗
Effect of route of administration and age on the pharmacokinetics of amikacin administered by the intravenous and intraosseous routes to 3 and 5-day-old foals.
The suitability of the intraosseous (i.o.) route for drug administration to equine neonates was evaluated in a study comparing the pharmacokinetics of amikacin administered by the i.o. and intravenous (i.v.) routes. Using a cross-over study design amikacin sulphate (7 mg/kg bwt) was administered i.o. or i.v. to 6 healthy foals at 3 and 5 days of age. Amikacin was instantaneously and completely absorbed after i.o. administration, achieving a mean +/- sd peak concentration (34.17 +/- 3.54 micrograms/ml) in the first sample collected 3 min after administration which was not significantly different from the mean +/- sd peak concentration (32.92 +/- 2.63 micrograms/ml) achieved after i.v. administration. The plasma amikacin concentration-time profiles for the i.o. and i.v. routes were not different and both were appropriately described by a 2-compartment open pharmacokinetic model. No significant differences attributable to route of administration were found in values for the major pharmacokinetic variables. The degree of inter-individual variation in values for indices of clearance was considerably greater than the degree of variation attributable to age. Despite this, values for body clearance (ClB) were significantly higher (P < 0.05) and values for area under the plasma amikacin concentration-time curve (AUC) and concentration of amikacin in plasma at 8 h [Cp(8h)] were significantly lower in 5- than in 3-day-old foals, indicating that amikacin was more rapidly cleared by the older foals. Technical difficulties were not encountered during i.o. needle placement in the medial aspect of the proximal tibia. Mild diffuse soft tissue swelling which developed at the i.o. site resolved completely within 1-2 months.(ABSTRACT TRUNCATED AT 250 WORDS)
Absorption↗
DNA triple-helix specific intercalators as antigene enhancers: unfused aromatic cations.
Triple-helical structures involving the interaction of an oligonucleotide third strand with a duplex nucleic acid sequence have recently gained attention as a therapeutic strategy in the "antigene" approach [cf. Helene, C. (1991) Eur. J. Cancer 27, 1466-1471]. This method utilizes the triple helix formed from the cellular duplex and an added third strand to directly regulate the activity of a selected gene. The limited stability of nucleic acid triple-helical interactions, particularly if the third strand has backbone modifications such as methylphosphonate or phosphorothioate substitutions, is a limiting condition for the use of this approach. We have designed and synthesized compounds, on the basis of the following three criteria, that we feel should provide selective interactions and significant stabilization of triplexes: appropriate aromatic surface area for stacking with triplex bases in an intercalation complex, positive charge, and limited torsional freedom in the aromatic system to match the propeller twist of the triple-base interactions in the triplex. A series of quinoline derivatives with an alkylamine side chain at the 4-position and with different aryl substituents at the 2-position has been synthesized as our first compounds. A 2-naphthyl derivative provides significant and selective stabilization of the triplex. In a 0.2 M NaCl buffer, the naphthyl derivative increased the Tm for the triplex (triplex to duplex and third strand transition) by approximately 30 degrees C more than the Tm increase for the duplex (duplex to single strands transition). Spectral changes and energy-transfer results indicate that the naphthyl compound and related derivatives bind to the triplex by intercalation.(ABSTRACT TRUNCATED AT 250 WORDS)
DNA↗