Search PubMed⌕ Search

Biomedical subjects

V Shankar

Publications and source records attributed to V Shankar.

At least 37 records · Page 2Linked to original sources
PubMed1999

Extracellular deoxyribonuclease production by a thermophile, Streptomyces thermonitrificans.

A thermophilic bacterial strain, Streptomyces thermonitrificans, produced high levels of extracellular deoxyribonuclease (DNase) when grown on NBG medium (containing 1% peptone, 0.3% beef extract, 1% glucose and 0.5% NaCl). Maximum DNase activity (140 U x ml(-1)) was obtained, in 24 h, when the culture was grown on modified NBG medium (containing 1.3% beef extract, 1% glucose, 0.5% NaCl and 50 microM Mn2+ at 45 degrees C. The crude enzyme showed higher activity on native DNA than on sonicated and heat denatured DNA. Moreover, addition of Mn2+ in the assay mixture resulted in a significant stimulation (10-15 fold) of the enzyme activity.

Deoxyribonucleases↗
PubMed1999

Infection-derived Enterococcus faecalis strains are enriched in esp, a gene encoding a novel surface protein.

We report the identification of a new cell wall-associated protein of Enterococcus faecalis. Studies on the distribution of the gene encoding this novel surface protein, Esp, reveal a significant (P < 0.001) enrichment in infection-derived E. faecalis isolates. Interestingly, the esp gene was not identified in any of 34 clinical E. faecium isolates or in 4 other less pathogenic enterococcal species tested. Analysis of the structural gene among various E. faecalis isolates reveals the existence of alternate forms of expression of the Esp protein. The deduced primary structure of the Esp protein from strain MMH594, inferred to be 1,873 amino acids (aa) with a predicted mass of approximately 202 kDa, reveals a core region consisting of repeat units that make up 50% of the protein. Esp bears global organizational similarity to the Rib and C alpha proteins of group B streptococci. Identity among Esp, Rib, and C alpha proteins is strikingly localized to a stretch of 13 aa within repeats of similar length. The high degree of conservation of this 13-residue sequence suggests that it plays an important role in the natural selection for this trait among infection-derived E. faecalis and group B streptococcal isolates.

Adolescent↗
PubMed1998

Extracellular ribonuclease from Rhizopus stolonifer: characteristics of an atypical--guanylic acid preferential--enzyme from ribonuclease T2 family.

An extracellular ribonuclease from Rhizopus stolonifer (designated as RNase Rs) was purified to homogeneity by chromatography on DEAE-cellulose followed by CM-cellulose. The Mr of the purified enzyme determined by gel filtration and SDS-PAGE is 25,000 and 28,200, respectively. RNase Rs is a glycoprotein and contains 10.5% neutral sugar. It is an acidic protein with a pI of 5.0 and has a blocked N-terminus. The optimum pH and temperature are 5.5 and 45 degrees C, respectively. RNase Rs shows high stability between pH 6.0-10.0. Divalent cations like Zn2+, Hg2+ and Cu2+ inhibit the enzyme activity whereas, mononucleotides does not have any significant effect. The enzyme cleaves RNA to 3'-mononucleotides via 2',3'-cyclic nucleotides, with preferential liberation of 2',3'-cyclic GMP, suggesting that RNase Rs is a guanylic acid preferential cyclizing RNase. Moreover, cyclic nucleotides generated are highly resistant to further hydrolysis.

Cations, Divalent↗
PubMed1997

Modeling accident frequencies as zero-altered probability processes: an empirical inquiry.

This paper presents an empirical inquiry into the applicability of zero-altered counting processes to roadway section accident frequencies. The intent of such a counting process is to distinguish sections of roadway that are truly safe (near zero-accident likelihood) from those that are unsafe but happen to have zero accidents observed during the period of observation (e.g. one year). Traditional applications of Poisson and negative binomial accident frequency models do not account for this distinction and thus can produce biased coefficient estimates because of the preponderance of zero-accident observations. Zero-altered probability processes such as the zero-inflated Poisson (ZIP) and zero-inflated negative binomial (ZINB) distributions are examined and proposed for accident frequencies by roadway functional class and geographic location. The findings show that the ZIP structure models are promising and have great flexibility in uncovering processes affecting accident frequencies on roadway sections observed with zero accidents and those with observed accident occurrences. This flexibility allows highway engineers to better isolate design factors that contribute to accident occurrence and also provides additional insight into variables that determine the relative accident likelihoods of safe versus unsafe roadways. The generic nature of the models and the relatively good power of the Vuong specification test used in the non-nested hypotheses of model specifications offers roadway designers the potential to develop a global family of models for accident frequency prediction that can be embedded in a larger safety management system.

Accidents, Traffic↗
PubMed1997

A recombinant vaccinia-rabies virus in the immunocompromised host: oral innocuity, progressive parenteral infection, and therapeutics.

With the emergence of raccoons (Procyon lotor) as the primary rabies reservoir in the United States of America, a recombinant vaccinia-rabies glycoprotein (V-RG) virus vaccine was developed that protected raccoons by the oral route from rabies infection. Despite extensive laboratory evaluation, vaccine safety concerns remained about free-choice distribution for wildlife rabies control. In this study, the oral innocuity of V-RG virus was demonstrated in immunodeficient mice but parenteral exposure resulted in systemic and progressive infection, albeit significantly abrogated in severity in comparison to vaccinia virus. Treatment with vaccinia immune globulin and hydroxyphosphonylmethoxy-propyl-cytosine resulted in significantly longer survival and minimized V-RG viral gross lesions.

Administration, Oral↗
PubMed1997

Chromosomal localization of a human mucin gene (MUC8) and cloning of the cDNA corresponding to the carboxy terminus.

A partial cDNA (pAM1) encoding a major airway mucin glycoprotein with novel tandem repetitive sequence has recently been cloned (Shankar, V., M. S. Gilmore, R. C. Elkins, and G. P. Sachdev. 1994. Biochem. J. 300:295-298). In this article, we report additional new sequence derived by 3'-rapid amplification of cDNA ends technique. The sequence corresponds to a stop codon, 3'-untranslated region of 458 bp, a polyadenylation signal, and poly A+ tail, and represents the extreme carboxy terminus of MUC8. A plasmid construct (pAM3) in pBluescript was generated by in-frame ligation of pAM1 to the 479-bp 3'UTR of MUC8. A 5'-end 325-bp fragment of this cDNA subcloned into the protein fusion and expression vector pET28b(+) was used to generate fusion protein under the control of T7 promoter. The purified fusion protein as well as synthetic peptide corresponding to the MUC8 repeat sequence (TSCPRPLQEGTPGS) were used to raise polyclonal antibodies in rabbits. The antiserum to the fusion protein and to the synthetic peptide reacted with the deglycosylated major tracheobronchial mucin. Immunohistochemical studies using the above antibodies localized the MUC8 protein product to submucosal glands in human tracheal epithelium. Furthermore, the gene from which this cDNA is derived, was mapped to chromosome 12 using DNA from a panel of human-mouse somatic cell hybrids. Fluorescence in situ hybridization was used to assign the regional localization to 12q24.3. Since the eight known human mucin genes map to other chromosomes, we have named this gene MUC8, in accordance with mucin gene nomenclature.

Amino Acid Sequence↗
PubMed1996

Statistical analysis of accident severity on rural freeways.

The growing concern about the possible safety-related impacts of Intelligent Transportation Systems (ITS) has focused attention on the need to develop new statistical approaches to predict accident severity. This paper presents a nested logit formulation as a means for determining accident severity given that an accident has occurred. Four levels of severity are considered: (1) property damage only, (2) possible injury, (3) evident injury, and (4) disabling injury or fatality. Using 5-year accident data from a 61 km section of rural interstate in Washington State (which has been selected as an ITS demonstration site), we estimate a nested logit model of accident severity. The estimation results provide valuable evidence on the effect that environmental conditions, highway design, accident type, driver characteristics and vehicle attributes have on accident severity. Our findings show that the nested logit formulation is a promising approach to evaluate the impact that ITS or other safety-related countermeasures may have on accident severities.

Accidents, Traffic↗
PubMed1995

Effect of roadway geometrics and environmental factors on rural freeway accident frequencies.

This paper explores the frequency of occurrence of highway accidents on the basis of a multivariate analysis of roadway geometrics (e.g. horizontal and vertical alignments), weather, and other seasonal effects. Based on accident data collected in the field, a negative binomial model of overall accident frequencies is estimated along with models of the frequency of specific accident types. Interactions between weather and geometric variables are proposed as part of the model specifications. The results of the analysis uncover important determinants of accident frequency. By studying the relationship between weather and geometric elements, this paper offers insight into potential measures to counter the adverse effects of weather on highway sections with challenging geometrics.

Accidents, Traffic↗
PubMed1995

Opioids contribute to hypoxia-induced pial artery dilation through activation of ATP-sensitive K+ channels.

It has been previously observed that hypoxia increases cerebrospinal fluid (CSF) methionine enkephalin and leucine enkephalin levels, and these opioids contribute to hypoxia-induced pial artery vasodilation. The present study was designed to investigate whether the activation of ATP-sensitive K+ channels (KATP) mediates the contribution of opioids to the hypoxia-induced pial artery dilation. The closed-cranial window technique was used to measure pial diameter in newborn pigs. Glibenclamide (10(-6) M), a KATP inhibitor, attenuated the dilation resulting from moderate and severe hypoxia [23 +/- 1 and 33 +/- 2% vs. 7 +/- 1 and 18 +/- 2%, respectively, for moderate and severe hypoxia (arterial PO2 approximately 35 and 25 mmHg, respectively) in the absence vs. presence of glibenclamide]. In addition, glibenclamide attenuated the dilation produced by methionine enkephalin (10(-8) and 10(-6) M) (13 +/- 1 vs. 4 +/- 2% and 21 +/- 2 vs. 7 +/- 3%, respectively, for methionine enkephalin in the absence and presence of glibenclamide). Leucine enkephalin-induced dilation was similarly attenuated by glibenclamide. Cromakalim (10(-8) and 10(-6) M), a KATP agonist, produced dilation that was blocked by glibenclamide (12 +/- 1 and 25 +/- 1 vs. 3 +/- 1 and 5 +/- 1% before and after glibenclamide, respectively). These data show that activation of KATP contributes to methionine enkephalin- and leucine enkephalin-induced dilation. Furthermore, these observations suggest that opioids contribute to hypoxia-induced pial artery dilation via KATP activation.

Adenosine Triphosphate↗
PubMed1995

Single-strand-specific nucleases.

Single-strand-specific nucleases, which act on single-stranded nucleic acids and single-stranded regions in double-stranded nucleic acids, are multifunctional enzymes and are ubiquitous in distribution. They find wide application as analytical tools in molecular biology research, although enzymes such as P1 nuclease are also used for production of flavor enhancers such as 5' IMP and 5' GMP. Because these enzymes are mainly used as analytical tools, very little attention was paid to aspects relating to their structure-function relationships. However, during the last few years considerable developments have taken place in this area. Single-strand-specific nucleases, their purification, characteristics, biological role, and applications have been reviewed.

Animals↗
PubMed1995

Guillain Barre syndrome-electrodiagnostic features and therapeutic observations.

Thirty seven patients with Guillain Barre syndrome were studied. The most common electrophysiologic abnormalities were delayed or absent Median nerve F wave (93.3%), increase in posterior tibial nerve distal latency (91.9%) and delayed or absent posterior tibial nerve F waves (83.9%). Slowing of nerve conduction was associated with the F wave abnormality and distal latency prolongation in most cases. There was no definite relationship between the results of electrophysiological studies and the clinical grade. 15 patients were treated with steroids, 10 with plasmapheresis, 8 with both steroids and plasmapheresis and 3 with immunoglobulins. There was a greater degree of improvement in patients treated with plasmapheresis.

Adolescent↗
PubMed1994

Biophysical characterization of mucin components HTM-1 and HTM-2 from tracheobronchial secretions of cystic fibrosis patients.

Mucins present in the tracheobronchial secretions are responsible for the viscoelastic properties of the mucus. Any changes in the mucin structure may alter the physical properties of mucus and hence its function. Previous studies from this laboratory have reported the isolation and characterization of a major mucin component (HTM-1) and a minor, novel mucin component (HTM-2) from the tracheobronchial secretions of cystic fibrosis (CF) individuals. In the present study, the macromolecular properties of the CF mucin components HTM-1 and HTM-2 were further investigated using biophysical methods. Dynamic light scattering studies showed that CF HTM-1 and HTM-2 had a greater extended structure in buffer containing 0.10 and 0.15 M NaCl than that observed in the presence of 0.03 M NaCl. Also, CF HTM-1 had a compact configuration in the presence of 5 and 10 mM Ca2+, while under similar experimental conditions, the structure of CF HTM-2 was unaffected, indicating differences in the macromolecular properties of CF mucin components. Fluorescent probe binding studies revealed that CF HTM-1 had more hydrophobic probe binding domains than those observed for CF HTM-2. In summary, both biochemical and biophysical characterization suggests structural differences between the CF HTM-1 and HTM-2 components.

Bronchi↗
PubMed1994

A novel human airway mucin cDNA encodes a protein with unique tandem-repeat organization.

Highly specific affinity-purified polyclonal antibodies against deglycosylated human tracheobronchial mucin was used to select immunoreactive clones from a Uni-ZAP cDNA expression library prepared from normal human tracheal mRNA. The largest of three positive clones, designated pAM1, which reacted strongly with the polyclonal antibodies, was further characterized. Sequence analyses revealed a partial 941 bp cDNA that encoded a 313-amino-acid polypeptide. Bases 3-892 consisted of imperfect 41-nucleotide tandem repeats (CCAGGAGGGGACACCGGGTTCACGAGCTGCCCACGCCCTCT) that encoded a unique polypeptide with two types of consensus repeats, TSCPRPLQEGTRV and TSCPRPLQEGTPGSRAAHALSRRGHRVHELPTSSPGGDTGF. The overall composition of the deduced amino acid sequence matched that expected for a mucin protein core and is rich in serine, threonine, proline, glycine and alanine (approximately 51%). Northern blots probed with the mucin cDNA exhibited intense polydisperse hybridization bands with RNA isolated from normal human trachea and cystic-fibrosis bronchus. The data indicate that mucin encoded by clone pAM1 represents a unique type of peptide organization which has not been described in mucin cDNAs reported thus far.

Amino Acid Sequence↗