Search PubMed⌕ Search

Biomedical subjects

Thomas C Bruice

Publications and source records attributed to Thomas C Bruice.

At least 37 records · Page 2Linked to original sources
PubMed2005

Comparison of positively charged DNG with DNA duplexes: a computational approach.

Molecular dynamics is used to investigate the structural properties of the cationic DNA analogue deoxynucleic guanidine (DNG), in which a guanidinium group replaces the phosphate moiety of DNA. This study examines the DNG duplex dodecamers d(Ag)(12).d(Tg)(12) and d(Gg)(12).d(Cg)(12), as well as their DNA counterparts. Watson-Crick base-pairing is maintained in the solvated DNG duplex models during the 5ns simulations. The idealized DNG dodecamers assume many parameters characteristic of the corresponding native DNA, assuming B-DNA conformations. Several helical parameters are rather unique to DNG, including buckle, slide, inclination, propeller, and X-displacement. Fewer transitions in backbone torsions occur in the DNG duplexes compared to those of the DNA, which may result from the greater rigidity of the sp(2) hybridized guanidinium group verses the flexible sp(3) phosphate group. The DNG helices have exceptionally shallow major grooves and very deep minor grooves. The major and minor groove widths of DNG are narrower than those of the respective DNA counterparts.

DNA↗
PubMed2005

Computational study of IAG-nucleoside hydrolase: determination of the preferred ground state conformation and the role of active site residues.

The mechanism of action of inosine-adenosine-guanosine nucleoside hydrolase (IAG-NH) has been investigated by long-term molecular dynamics (MD) simulation in TIP3P water using stochastic boundary conditions. Special attention has been given to the role of leaving group pocket residues and conformation of the bound substrate at the active site of IAG-NH. We also describe the positioning of the residues of an important flexible loop at the active site, which was previously unobservable by X-ray crystallography due to high B-factors. Five MD simulations have been performed with the Enzyme x Substrate complexes: Enzyme x anti-Adenosine with Asp40-COOH [E(40H) x Ade(a)], Enzyme x anti-Adenosine with Asp40-COO- [E(40) x Ade(a)], Enzyme x syn-Adenosine with Asp40-COOH [E(40H) x Ade(s)], Enzyme x syn-Adenosine with Asp40-COO- [E(40) x Ade(s)], and Enzyme x anti-Inosine with Asp40-COO- [E(40) x Ino(a)]. Overall, the structures generated from the MD simulation of E(40H) x Ade(s) preserve the catalytically important hydrogen bonds as well as electrostatic and hydrophobic interactions to provide a plausible catalytic structure. When deprotonated Asp40 (Asp4-COO-) is present, the active site is open to water solvent which interferes with the base stacking between Trp83 and nucleobase. A calculation using Poisson-Boltzmann equation module supports that Asp40 indeed has an elevated pK(app). Solvent accessible surface area (SASA) calculations on all the five MD structures shows that systems with protonated Asp40, namely, E(40H) x Ade(a) and E(40H) x Ade(s), have zero SASA. It is found that a water molecule is hydrogen-bonded to the N7 of the nucleobase and is probably the essential general acid to protonate the departing nucleobase anion. The N7-bonded water is in turn hydrogen-bonded to waters in a channel, held in place by the residues of the flexible loop, Tyr257, His247, and Cys245. Using normal-mode analysis with elastic network model, we find that the flexible loop explores a conformational space much larger than in the MD trajectory, leading to a "gating"-like motion with respect to the active site.

Adenosine↗
PubMed2005

Statistical coevolution analysis and molecular dynamics: identification of amino acid pairs essential for catalysis.

Molecular dynamics (MD) simulations of HhaI DNA methyltransferase and statistical coupling analysis (SCA) data on the DNA cytosine methyltransferase family were combined to identify residues that are coupled by coevolution and motion. The highest ranking correlated pairs from the data matrix product (SCA.MD) are colocalized and form stabilizing interactions; the anticorrelated pairs are separated on average by 30 A and form a clear focal point centered near the active site. We suggest that these distal anti-correlated pairs are involved in mediating active-site compressions that may be important for catalysis. Mutants that disrupt the implicated interactions support the validity of our combined SCA.MD approach.

Binding Sites↗
PubMed2005

Focal-point conformational analysis of ethanol, propanol, and isopropanol.

Conformational analysis of three small alcohols--ethanol, propanol, and isopropanol--was carried out by systematically improving the basis set and the level of electron correlation. Correlation energy contributions to conformational energies are strongly basis-set-dependent but accurate energy contributions can be obtained by extrapolation to the basis-set limit. At the basis-set limit, second- and third-order electron correlation effects play a significant role for rotations around the CC-OH, HC-CO, and CC-CO bonds. Specifically, second- and third-order correlation effects strongly stabilize structures in which the hydroxylic hydrogen eclipses with the adjacent carbon; a lesser stabilization is present in structures where the CC-OH moiety is in the gauche form. Fourth-order correlation effects to the CC-OH rotation are small due to a partial cancellation of the singles, doubles, and quadruples contribution by the triples contribution. Electron correlation significantly lowers barriers for methyl-group rotations in ethanol and isopropanol, and in these cases the fourth-order correlation effects are noticeable. The relatively large overall importance of third-order correlation energy contributions raises a concern that the inability to accurately estimate this slowly converging contribution may become a limiting factor when highly accurate conformational energies in larger molecules are sought.

Journal Article↗
PubMed2004

Probing the Ser-Ser-Lys catalytic triad mechanism of peptide amidase: computational studies of the ground state, transition state, and intermediate.

Peptide amidase (Pam), a hydrolytic enzyme that belongs to the amidase signature (AS) family, selectively catalyzes the hydrolysis of the C-terminal amide bond (CO-NH(2)) of peptides. The recent availability of the X-ray structures of Pam, fatty acid amide hydrolase, and malonamidase E2 has led to the proposal of a novel Ser-Ser-Lys catalytic triad mechanism for the amide hydrolysis by the AS enzymes. The molecular dynamics (MD) simulations using the CHARMM force field were performed to explore the catalytic mechanism of Pam. The 1.8 A X-ray crystal structure of Pam in complex with the amide analogue of chymostatin was chosen for the initial coordinates for the MD simulations. The five systems that were investigated are as follows: (i) enzyme.substrate with Lys123-NH(2), (ii) enzyme.substrate with Lys123-NH(3)(+), (iii) enzyme.substrate with Lys123-NH(3)(+) and Ser226-O(-), (iv) enzyme.transition state, and (v) enzyme.tetrahedral intermediate. Our data support the presence of the hydrogen bonding network among the catalytic triad residues, Ser226, Ser202, and Lys123, where Ser226 acts as the nucleophile and Ser202 bridges Ser226 and Lys123. The MD simulation supports the catalytic role of the crystallographic waters, Wat1 and Wat2. In all the systems that have been studied, the backbone amide nitrogens of Asp224 and Thr223 create an oxyanion hole by hydrogen bonding to the terminal amide oxygen of the substrate, and stabilize the oxyanion tetrahedral intermediate. The results from both our computational investigation and previously published experimental pH profile support two mechanisms. In a mechanism that is relevant at lower pH, the Lys123-NH(3)(+)-Ser202 dyad provides structural support to the catalytic residue Ser226, which in turn carries out a nucleophilic attack at the substrate amide carbonyl in concert with Wat1-mediated deprotonation and stabilization of the tetrahedral transition state by the oxyanion hole. In the mechanism operating at higher pH, the Lys123-NH(2)-Ser202 catalytic dyad acts as a general base to assist addition of Ser226 to the substrate amide carbonyl. The results from the MD simulation of the tetrahedral intermediate state show that both Ser202 and Lys123 are possible candidates for protonation of the leaving group, NH(2), to form the acyl-enzyme intermediate.

Amidohydrolases↗
PubMed2004

Mechanisms of ammonia activation and ammonium ion inhibition of quinoprotein methanol dehydrogenase: a computational approach.

The mechanism of methanol oxidation by quinoprotein methanol dehydrogenase (MDH.PQQ) in combination with methanol (MDH.PQQ.methanol) involves Glu-171--CO2(-) general base removal of the hydroxyl proton of methanol in concert with hydride equivalent transfer to the >C5=O quinone carbon of pyrroloquinoline quinone (PQQ) and rearrangement to hydroquinone (PQQH2) with release of formaldehyde. Molecular dynamics (MD) studies of the structures of MDH.PQQ.methanol in the presence of activator NH3 and inhibitor NH4(+) have been carried out. In the MD structure of MDH.PQQ.methanol.NH3, the hydrated NH3 resides at a distance of approximately 24 A away from methanol and the ortho-quinone portion of PQQ. As such, influence of NH3 on the oxidation reaction is not probable. We find that NH4(+) competes with the substrate by hydrogen-bonding to Glu-171CO2(-) such that the MDH.PQQ.methanol.NH4(+) complex is not reactive. Ammonia readily forms imines with quinone. Imines are present in solution as neutral (>C5=NH) and protonated (>C5=NH2(+)) species. MD simulations establish that the >C5=NH2(+) derivative of MDH.PQQ(NH2(+).methanol structure is unreactive because of the nonproductive means of methanol binding. The structure obtained by the MD simulations with the neutral >C5=NH imine of MDH.PQQ(NH).methanol structure is similar to the reactive MDH.PQQ.methanol complex. This active site geometry allows for catalysis of hydride equivalent transfer to the >C5=NH of PQQ(NH) by concerted Glu-171CO(2)(-) general-base removal of the H-OCH3 proton and Arg-324H+ general-acid proton transfer to the imine nitrogen. Enzyme-bound <C5(H)NH2 derivative of PQQ [PQQ(NH)] and CH(2)O product are formed.

Alcohol Oxidoreductases↗
PubMed2004

Molecular dynamics studies of ground state and intermediate of the hyperthermophilic indole-3-glycerol phosphate synthase.

Indole-3-glycerol phosphate synthase catalyzes the terminal ring closure step in tryptophan biosynthesis. In this paper, we compare the results from molecular dynamics (MD) simulations of enzyme-bound substrate at 298, 333, 363, and 385 K and the enzyme-bound intermediate at 385 K, solvated in TIP3P water box with a CHARMM force field. Results from MD simulations agree with experimental studies supporting the observation that Lys-110 is the general acid. Based on its location in the active site during the MD simulations, Glu-210 warrants classification as the general base instead of the previously proposed Glu-159. We find that the relative population of the reactive enzyme-substrate Michaelis conformers [near attack conformers (NACs)] with temperature correlates well (correlation coefficient of 0.96) with the relative activity of this thermophilic enzyme. At higher temperature, the enzyme-substrate electrostatic interaction favors the binding of the substrate in NAC conformation, whereas, at lower temperature, the substrate is distorted and bound in a nonreactive conformation. This change is reflected in the approximately 1,100-fold increase in population of NACs at 385 K relative to 298 K. The easily determined population of NACs at given temperature tells much about the thermophilic property of the enzyme. Thus, the hyperthermophilic enzyme has evolved to have optimum activity at high temperatures, and, with lowering of the temperature, the electrostatic interaction at the active site is enhanced and the structure is deformed. This model can be regarded as a general explanation for the activity of hyperthermophilic enzymes.

Indole-3-Glycerol-Phosphate Synthase↗
PubMed2004

Anticorrelated motions as a driving force in enzyme catalysis: the dehydrogenase reaction.

Molecular dynamics and cross-correlation analysis of the horse liver alcohol dehydrogenase HLADH.NAD(+).PhCH(2)O(-) complex has established anticorrelated motions between the NAD(+)-binding domain and other portions of the enzyme. Four pairs of anticorrelated interactions are (i and ii) cofactor-binding domain: C(alpha) of V292 and the CG1 of V203 with C7 of PhCH(2)O(-); (iii) cofactor-binding domain: amide carbonyl oxygen of I318 with amide N of H67; and (iv) cofactor domain: C(alpha) of T178 with carbonyl oxygen of L141. The average distances between pairs are 9.2 A for i, 8.2 A for ii, 14.7 A for iii, and 18.2 A for iv. The motions of i and ii are most important in the approximately 0.5 A pushing of C4 of NAD(+) toward C7 of PhCH(2)O(-) to form push near-attack conformer (NACs). The motions of iv are less so, and those of iii are not important. Seventy-five quantum mechanics/molecular mechanics calculations of the energies of reaction were carried out without structural restrictions from different stages of the molecular dynamics trajectory. Of the 71 conformations, the 29 fulfilling NAC criteria were associated with the lowest energies of activation. Thus, anticorrelated motions from the NAD(+)-binding domain by way of the neighboring V292 and V203 have a pushing motion, which moves the C4 of NAD(+) toward the H-C7 of the substrate. Longer-range anticorrelated motions involving the cofactor-binding domain have no or very little influence on NAC formation.

Alcohol Dehydrogenase↗
PubMed2004

Multiple substrate binding states and chiral recognition in cofactor-independent glutamate racemase: a molecular dynamics study.

Glutamate racemase (MurI) catalyzes the racemization of glutamate; two cysteine residues serve as catalytic acid and base. On the basis of the crystal structure of MurI from the hyperthermophilic bacterium Aquifex pyrophilus, we performed molecular dynamics (MD) simulations of six different systems to investigate stereochemistry, substrate ligation, and active site protonation state. The catalytic competence of individual systems was assessed by the abundance of reactive conformers. Only systems in which Cys70 is poised to deprotonate d-Glu were found to be catalytically competent (idem Cys178/l-Glu), in agreement with the experimentally observed stereochemistry of Lactobacillus fermentii MurI [Tanner, M. E. et al. (1993) Biochemistry 32, 3998-4006]. Only systems in which the alpha-amino group of l/d-Glu and the imidazole moiety of His are deprotonated are catalytically competent. The active site of MurI displays an unusual flexibility in substrate ligation, and several transitions between stable binding patterns were observed. In catalytically competent binding states, the conserved threonine residues 72, 114, and 117 ligate the alpha-carboxylate of Glu and the Asn71 amides ligate the alpha-amino group of Glu, whereas the delta-carboxylate of Glu is steered by electrostatic repulsion from the Asp7 and Glu147 side chain carboxylates. A network of hydrogen bonds controls the positioning of each thiol/thiolate. In what we term substrate flipping, Glu suddenly rotates into a binding pattern that resembles the post-racemization state of the other enantiomer, i.e., each enantiomer can be bound in two distinct states. Substrate flipping and unfavorable substrate binding successively trigger dissociation of the substrate, accompanied by an opening of the active site channel. We explain how the weak binding of Glu contributes to catalysis and suggest a mechanism by which binding mismatches are propagated into an opening of the active site.

Amino Acid Isomerases↗
PubMed2004

DNG cytidine: synthesis and binding properties of octameric guanidinium-linked deoxycytidine oligomer.

The synthesis of guanidinium-linked cytidyl oligomer (DNG-C(8)), a cationic DNA analog, and the corresponding cytidine monomers is described. The DNG monomer synthesis was streamlined to produce a shorter route to the final monomer than previously reported for thymidine and subsequent solid-phase synthesis produced an octameric cytidyl DNG strand. Because octameric deoxyguanosine would be used as the complementary strand in our studies, it was necessary to investigate guanosine self-association. Singular value decomposition was used to mathematically deconvolve the spectral data and confirm the presence of transitions due to DNA-G(8) self-association. Job plots show the binding stoichiometry of DNG-C(8) with DNA-G(8) to be 1:1. Thermal denaturation studies of the DNG-C(8).DNA-G(8) duplex established a T(m) > or = 90 degrees and a DeltaG degree = -13.3 kcal mol(-1), indicating the DNG-C(8).DNA-G(8) duplex is over 1000 times more stable than that of DNA-C(8).DNA-G(8).

Binding Sites↗
PubMed2004

DNA sequence recognition in the minor groove by hairpin pyrrole polyamide-Hoechst 33258 analogue conjugate.

A hairpin pyrrole polyamide conjugated to a Hoechst 33258 (Ht) analogue, PyPyPy-gamma-PyPyPy-gamma-Ht, was synthesized on solid-phase by adaptation of an Fmoc technique using a series of PyBOP/HOBt mediated coupling reactions. Sequence selectivity and complex stabilities were characterized by spectrofluorometric titrations and thermal melting studies. The polyamide of the conjugate was observed to bind in a hairpin motif forming 1:1 conjugate:dsDNA complexes. The conjugate is able to recognize nine contiguous A/T bps, discriminating from the sequences containing fewer than nine contiguous A/T bps.

Base Sequence↗
PubMed2004

Computational study of the ground state of thermophilic indole glycerol phosphate synthase: structural alterations at the active site with temperature.

Hyperthermophlic indole-3-glycerol phosphate synthase (IGPS) catalyzes the terminal ring-closure step in tryptophan biosynthesis. In this paper, we compare the results from the molecular dynamics (MD) simulation of enzyme-bound substrate at 298 K (E.S298) and 385 K (E.S385) solvated in the TIP3P water box using the CHARMM force field to address the question of the structural change of the Enzyme. Substrate complex with temperature. The population of the reactive Enzyme. Substrate conformers (near attack conformers or NACs) increases by approximately 1100-fold in going from room temperature (E.S298) to high temperature (E.S385). This increased population of NAC conformers in the Michaelis complex correlates well with the increase in rate in going from 298 to 385 K. The positioning of the two active site residues Lys53 and Lys110 controls binding of the substrate in the favorable orientation for general acid-catalyzed intramolecular ring formation reaction. It can be concluded that the NAC formation allowing general acid catalysis has much to do with the temperature dependence of the free energy of reaction.

Archaea↗
PubMed2004

Solid-phase synthesis of positively charged deoxynucleic guanidine (DNG) tethering a Hoechst 33258 analogue: triplex and duplex stabilization by simultaneous minor groove binding.

Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3' --> 5' direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5'-terminus using PyBOP/HOBt chemistry. The stability of (DNA)(2).DNG-H triplexes and DNA.DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5'-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3', respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5'-terminus of the DNG enhances the (DNA)(2).DNG-H triplex stability by a DeltaT(m) of 13 degrees C. The fluorescence emission studies of (DNA)(2).DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)(2).DNG triplex stability by 11 degrees C, whereas (DNA)(2).DNG-H triplex stability was decreased by 23 degrees C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 degrees C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA.DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA.DNG minor groove, and the duplex stability was enhanced by DeltaT(m) of 7 degrees C. The stability of (DNA)(2).DNG triplexes and DNA.DNG duplexes is independent of pH, whereas the stability of (DNA)(2).DNG-H triplexes decreases with increase in pH.

Base Sequence↗
PubMed2004

Mechanism of glucose oxidation by quinoprotein soluble glucose dehydrogenase: insights from molecular dynamics studies.

We have generated 3 ns molecular dynamic (MD) simulations, in aqueous solution, of the bacterial soluble glucose dehydrogenase enzyme.PQQ.glucose complex and intermediates formed in PQQ reduction. In the MD structure of enzyme.PQQ.glucose complex the imidazole of His144 is hydrogen bonded to the hydroxyl hydrogen of H[bond]OC1(H) of glucose. The tightly hydrogen-bonded triad Asp163-His144-glucose (2.70 and 2.91 A) is involved in proton abstraction from glucose concerted with the hydride transfer from the C1[bond]H of glucose to the >C5[double bond]O quinone carbon of PQQ. The reaction is assisted by Arg228 hydrogen bonding to the carbonyl oxygen of >C5[double bond]O. The rearrangement of [bond](H)C5(O-)[bond]C4([double bond]O)[bond] of II to [bond]C5(OH)[double bond]C4(OH)[bond] of PQQH(2) hydroquinone is assisted by general acid protonatation of the >C4[double bond]O oxygen by protonated His144 and hydrogen bonds of Arg228 to the oxyanion O5. The continuous hydrogen bonding of the amide side chain of Asn229 to >C4[double bond]O4 oxygen and that of the O5 oxygen of the cofactor to Wat89 is observed throughout the entire reaction.

Binding Sites↗
PubMed2004

Transition state stabilization by general acid catalysis, water expulsion, and enzyme reorganization in Medicago savita chalcone isomerase.

In aqueous solution, Medicago savita chalcone isomerase (CHI) enhances the reaction rate for the unimolecular rearrangement of chalcone (CHN) into flavanone by seven orders of magnitude. Conformations of CHN and their relative free energies in water and CHI were investigated by the thermodynamic perturbation method. In water, CHN adopts two conformations (I and II) with conformation I being higher in energy than conformation II by 3 kcal/mol. Only I can give rise to a near attack conformer (NAC) where the nucleophile O2' and the electrophile C9 are placed in proximity. In CHI, I binds less tightly than II by approximately 2 kcal/mol, resulting in the free energy for NAC formation being approximately 2 kcal/mol higher in the enzyme than in water. This unfavorable feature in the ground state of the CHI reaction requires the predominant catalytic advantage to be taken in the step of NAC --> transition state (TS). From the molecular dynamics simulations of apo-CHI, CHI complexed with CHN (CHI.CHN) and CHI.TS, we found: (i) Lys-97-general-acid catalysis of the O2'(-) nucleophilic addition; (ii) expulsion of three water molecules in the process of TS formation; (iii) release of enzyme structural distortion on TS formation. In the conclusion, CHI's remarkable efficiency of stabilizing the TS and its relatively poor ability in organizing the ground state is compared with chorismate mutase whose catalytic prowess, when compared with water, originates predominantly from the enhanced NAC population at the active site.

Binding Sites↗
PubMed2004

Determination of enzyme mechanisms by molecular dynamics: studies on quinoproteins, methanol dehydrogenase, and soluble glucose dehydrogenase.

Molecular dynamics (MD) simulations have been carried out to study the enzymatic mechanisms of quinoproteins, methanol dehydrogenase (MDH), and soluble glucose dehydrogenase (sGDH). The mechanisms of reduction of the orthoquinone cofactor (PQQ) of MDH and sGDH involve concerted base-catalyzed proton abstraction from the hydroxyl moiety of methanol or from the 1-hydroxyl of glucose, and hydride equivalent transfer from the substrate to the quinone carbonyl carbon C5 of PQQ. The products of methanol and glucose oxidation are formaldehyde and glucolactone, respectively. The immediate product of PQQ reduction, PQQH- [-HC5(O-)-C4(=O)-] and PQQH [-HC5(OH)-C4(=O)-] converts to the hydroquinone PQQH2 [-C5(OH)=C4(OH)-]. The main focus is on MD structures of MDH * PQQ * methanol, MDH * PQQH-, MDH * PQQH, sGDH * PQQ * glucose, sGDH * PQQH- (glucolactone, and sGDH * PQQH. The reaction PQQ-->PQQH- occurs with Glu 171-CO2- and His 144-Im as the base species in MDH and sGDH, respectively. The general-base-catalyzed hydroxyl proton abstraction from substrate concerted with hydride transfer to the C5 of PQQ is assisted by hydrogen-bonding to the C5=O by Wat1 and Arg 324 in MDH and by Wat89 and Arg 228 in sGDH. Asp 297-COOH would act as a proton donor for the reaction PQQH(-)-->PQQH, if formed by transfer of the proton from Glu 171-COOH to Asp 297-CO2- in MDH. For PQQH-->PQQH2, migration of H5 to the C4 oxygen may be assisted by a weak base like water (either by crystal water Wat97 or bulk solvent, hydrogen-bonded to Glu 171-CO2- in MDH and by Wat89 in sGDH).

Alcohol Oxidoreductases↗
PubMed2003

Conformations and dynamics of Ets-1 ETS domain-DNA complexes.

Molecular dynamics studies have been performed for 3.5 ns on the ETS domain of Ets-1 transcription factor bound to the 14-bp DNA, d(AGTGCCGGAAATGT), comprising the core sequence of high-affinity (GGAA), ETS-GGAA. In like manner, molecular dynamics simulations have been carried out for 3.9 ns on the mutant low-affinity core sequence, GGAG (ETS-GGAG). Analyses of the DNA backbone of ETS-GGAG show conformational interconversions from BI to BII substates. Also, crank shaft motions are noticed at the mutated nucleotide base pair step after 1500 ps of dynamics. The corresponding nucleotide of ETS-GGAA is characteristic of a BI conformation and no crank shaft motions are observed. The single mutation of ETS-GGAA to ETS-GGAG also results in variations of helical parameters and solvent-accessible surface area around the major and minor grooves of the DNA. The presence of water contacts during the entire simulation proximal to the fourth base pair step of core DNA sequence is a characteristic feature of ETS-GGAA. Such waters are more mobile in ETS-GGAG at 100 ps and distant after 1500 ps. Anticorrelated motions between certain amino acids of Ets-1 protein are predominant in ETS-GGAA but less so or absent in the mutant. These motions are reflected in the flexibility of amino acid residues of the protein backbone. We consider that these conformational features and water contacts are involved in stabilizing the hydrogen bond interactions between helix-3 residues of Ets-1 and DNA during the transcription process.

Amino Acid Sequence↗