Search PubMed⌕ Search

Biomedical subjects

T Sugita

Publications and source records attributed to T Sugita.

At least 19 recordsLinked to original sources

Cotransduction of CCL27 gene can improve the efficacy and safety of IL-12 gene therapy for cancer.

Interleukin-12 (IL-12) is a potent antitumoral cytokine, but high doses are toxic. Herein, we demonstrate that combinational transduction of IL-12 and CC-chemokine ligand-27 (CCL27) genes into pre-existing murine OV-HM ovarian carcinoma and Meth-A fibrosarcoma, by using RGD fiber-mutant adenoviral vectors, could induce tumor regression and relieve systemic side effects more effectively than either treatment alone. The antitumor activity of the IL-12 and CCL27 combination treatment was T-cell-dependent, and development of long-term specific immunity was confirmed in rechallenge experiments. Immunohistochemical analysis of tumors transduced with CCL27 gene alone or cotransduced with IL-12 and CCL27 genes showed significant increases in numbers of infiltrating CD3(+) T cells, which included both CD4(+) and CD8(+) cells. Additionally, cotransduction with IL-12 and CCL27 genes could more efficiently activate tumor-infiltrating immune cells than transduction with CCL27 alone, as determined by the frequency of perforin-positive cells and expression levels of IFN-gamma. Furthermore, mice treated with the IL-12 and CCL27 combination compared with those treated with IL-12 alone showed milder pathological changes, for example, lymphocyte infiltration and extramedullary hematopoiesis, in lung, liver and spleen. Our data provide evidence that combinational in vivo transduction with IL-12 and CCL27 genes is a promising approach for the development of cancer immunogene therapy that can simultaneously recruit and activate tumor-infiltrating immune cells.

Adenocarcinoma↗

The cytoskeleton in the unique cell reproduction by conidiogenesis of the long-neck yeast Fellomyces (Sterigmatomyces) fuzhouensis.

The morphology of conidiogenesis and associated changes in microtubules, actin distribution and ultrastructure were studied in the basidiomycetous yeast Fellomyces fuzhouensis by phase-contrast, fluorescence, and electron microscopy. The interphase cell showed a central nucleus with randomly distributed bundles of microtubules and actin, and actin patches in the cortex. The conidiogenous mother cell developed a slender projection, or stalk, that contained cytoplasmic microtubules and actin cables stretched parallel to the longitudinal axis and actin patches accumulated in the tip. The conidium was produced on this stalk. It contained dispersed cytoplasmic microtubules, actin cables, and patches concentrated in the cortex. Before mitosis, the nucleus migrated through the stalk into the conidium and cytoplasmic microtubules were replaced by a spindle. Mitosis started in the conidium, and one daughter nucleus then returned to the mother via an eccentrically elongated spindle. The cytoplasmic microtubules reappeared after mitosis. A strong fluorescence indicating accumulated actin appeared at the base of the conidium, where the cytoplasm cleaved eccentrically. Actin patches then moved from the stalk together with the retracting cytoplasm to the mother and conidium. No septum was detected in the long neck by electron microscopy, only a small amount of fine "wall material" between the conidium and mother cell. Both cells developed a new wall layer, separating them from the empty neck. The mature conidium disconnected from the empty neck at the end-break, which remained on the mother as a tubular outgrowth. Asexual reproduction by conidiogenesis in the long-neck yeast F. fuzhouensis has unique features distinguishing it from known asexual forms of reproduction in the budding and fission yeasts. Fellomyces fuzhouensis develops a unique long and narrow neck during conidiogenesis, through which the nucleus must migrate into the conidium for eccentric mitosis. This is followed by eccentric cytokinesis. We found neither an actin cytokinetic ring nor a septum in the long neck, from which cytoplasm retracted back to mother cell after cytokinesis. Both the conidium and mother were separated from the empty neck by the development of a new lateral wall (initiated as a wall plug). The cytoskeleton is clearly involved in all these processes.

Actins↗

Molecular analysis of malassezia microflora from patients with pityriasis versicolor.

BACKGROUND: Pityriasis versicolor (PV) is a superficial infection of the stratum corneum caused by Malassezia species. Eleven species have been identified within this genus, namely M. globosa, M. restricta, M. sympodialis, M. furfur, M. obtusa, M. slooffiae, M. pachydermatis, M. dermatis, M. japonica, M. yamatoensis, M. nana. M. furfur has long been identified as the causative fungus of PV. However, recent studies using the culture and isolation identified by morphological and physiological characteristics suggest that M. globosa is the causative agent of PV. OBJECTIVES: The aim of this study was to examine the distribution of PV microorganisms with a molecular-based non-culture method. PATIENTS: The subjects were 49 patients with PV (32 males, 17 females; 16-83 years old) who visited our outpatient clinic. METHODS: Samples were taken from lesions for direct microscopy with methylene blue and detected Malassezia species without M. pachydermatis and M. nana using a non-culture-based method consisting of nested PCR with specific primers. RESULTS: The most frequently isolated species were M. globosa and M. restricta (both 93.9%). Only M. globosa was detected from the lesion in which the mycelial form alone was observed microscopically, but M. restricta was not. CONCLUSIONS: Our results suggest that M. globosa is the causative agent of PV.

Adolescent↗

[Unusual total anomalous pulmonary venous connection; report of a case].

We report a case of a 7-hour-old infant with total anomalous pulmonary venous connection having abberant origin of the vertical vein. His clinical condition presented hemodynamically severe pulmonary vein obstruction as common pulmonary vein atresia. Without making the definitive diagnosis, he underwent the operation at 11 hours after birth under cardiopulmonary bypass. During the operation, we could not identify the drainage vein. Although we ligated the vessel sized less than 2 mm in diameter draining into superior vena cava which was suspected to be the vertical vein. After the operation pulmonary edema was severe, but his clinical condition improved by using nitric oxide without extracorporeal membrane oxygenation (ECMO) support. Postoperative cardiac catheterization showed normal cardiac function without pulmonary venous obstruction, and moreover identified the drainage vein originated from right upper pulmonary vein. To the best of our knowledge, this is the first case where the vertical vein originated from right upper pulmonary vein. Immediate surgical treatment before the circuratory exacerbation improve the outcome for this congenital anomaly.

Humans↗

Optimization of anti-tumor necrosis factor-alpha single chain Fv displayed on phages for creation of functional antibodies.

In this study, we converted the immunoglobulin-type anti-human tumor necrosis factor-alpha (TNF-alpha) monoclonal antibody (Mab) to a scFv-type antibody in order to assess its basic properties. The immunoglobulin VH and VL genes were isolated from the hybridoma that produced an anti-TNF-alpha neutralizing Mab, and they were then linked together to create scFvs of the VL-VH or VH-VL-form. The binding affinity to TNF-a was retained in both scFvs. Interestingly, the VL-VH-type scFv effectively inhibited the TNF-alpha-mediated cytotoxicity, while this neutralization activity was dramatically decreased in the VH-VL-type scFv. These results suggest that the VL-VH-type scFv is a suitable template to create improved versions of the anti-TNF-alpha antibody using a phage display system, and they also show that the structural format must be taken into account in manufacturing scFvs.

Antibodies, Blocking↗

Evaluation of cytomegalovirus-specific cytotoxic T-lymphocytes in patients with the HLA-A*02 or HLA-A*24 phenotype undergoing hematopoietic stem cell transplantation.

Cytomegalovirus-specific cytotoxic T-lymphocytes (CMV-CTL) are essential for the control of CMV reactivation. To monitor the quantity and function of CMV-CTL after hematopoietic stem cell transplantation (HSCT), two CMV epitopes that bind to HLA-A*0201 NLVPMVATV (A*02NLV) and HLA-A*2402 QYDPVAALF (A*24QYD) were evaluated for their immunological potential. Samples from patients with the HLA-A*02 or HLA-A*24 serotype were analyzed by tetramer, intracellular cytokine staining and enzyme-linked immunospot (ELISPOT) assay. There were significantly more A*02NLV-specific CMV-CTL than A*24QYD (23 x 10(6) vs 0.4 x 10(6)/l). The frequency of IFN-gamma-producing cells was also higher upon stimulation with A*02NLV than with A*24QYD (2.5 vs 0.1%/CD8). Furthermore, the magnitude of CMV-CTL expansion was two- to 50-fold when cells were cultured with A*02NLV, while only an insignificant increase was observed in culture with A*24QYD. Although the number of A*24QYD-specific CMV-CTL was very low in most of the HLA-A*24 patients, the incidence of CMV reactivation did not differ between those with HLA-A*02 and HLA-A*24 serotype alone. These results suggest that an epitope other than A*24QYD plays a major role in patients with HLA-A*24. Our study also showed that A*02NLV may be a useful epitope for monitoring CMV-CTL not only in patients with HLA-A*0201 but also in those with the A*0206 genotype.

Adult↗

DNA sequence diversity of intergenic spacer I region in the non-lipid-dependent species Malassezia pachydermatis isolated from animals.

The non-lipid-dependent species Malassezia pachydermatis is frequently isolated from animals. We analyzed the DNA sequences of the intergenic spacer (IGS) 1 region, which is the most variable region in the rRNA gene, of 43 M. pachydermatis strains obtained from dogs or cats. The lengths of the IGS 1 regions ranged from 552 to 898 bp and, based on the nucleotide sequence, these IGS 1 regions were divided into three major groups with 10 subtypes. Group 1 (552-601 bp long) was characterized by the short sequence repeat (CAGCA)n and had four to 14 repeats, and Group 3 (749-898 bp long), which included the neotype strain of M. pachydermatis, was characterized by the sequence (CAGCATAACATAACACACAACA)n in the IGS1 region. Group 2 possessed partial sequences of both Groups 1 and 3. Each group shared only 41.7-55.4% similarity in the IGS1 region with the other groups. The internal transcribed spacer (ITS) region and D1/D2 26S rDNA in the rRNA gene were also sequenced for representative strains in each IGS group. The groups were distinguished by both ITS (698-712 bp long including 5.8S rDNA) and D1/D2 26S rDNA (624 bp long) sequences with sequence similarities of 91.7-96.0% and 99.7-99.0%, respectively. Our results indicate that the sequence of the IGS region of M. pachydermatis has a remarkable intraspecies diversity, compared with ITS or D1/D2 26S rDNA, and that multiple genotypic strains of M. pachydermatis colonize animal skin.

Animals↗

Reassessment of the in vitro synergistic effect of fluconazole with the non-steroidal anti-inflammatory agent ibuprofen against Candida albicans.

We reassessed the in vitro synergistic effect of fluconazole with the non-steroidal anti-inflammatory agent ibuprofen against the pathogenic yeast Candida albicans. No synergistic effect of fluconazole combined with ibuprofen was seen against fluconazole-susceptible strains, but a remarkable effect was seen against fluconazole-resistant strains (FIX index: 0.02-0.03). Furthermore, vigorous growth of the microorganism, the so-called 'Eagle effect', was observed at concentrations higher than the minimal inhibitory concentrations of ibuprofen and fluconazole. Our results suggest that the combination of ibuprofen and fluconazole should prove useful for treating infection caused by fluconazole-resistant C. albicans.

Anti-Inflammatory Agents, Non-Steroidal↗

Nasal mask bilevel positive airway pressure ventilation for diaphragmatic paralysis after pediatric open-heart surgery.

A 2-year-old boy underwent surgical repair of tetralogy of Fallot. Topical cooling of the heart with ice slush was used during the operation. Diaphragmatic paralysis occurred after the operation, inducing severe respiratory distress. To avoid repeated intubation and tracheostomy, the patient was placed on nasal mask bilevel positive airway pressure (BiPAP) ventilation. After ventilatory support with BiPAP for 40 days, the patient recovered spontaneously from the paralysis. No sedation was required during this time. This report illustrates the usefulness of BiPAP for a pediatric patient with diaphragmatic paralysis after cardiac surgery.

Child, Preschool↗

Room-temperature, continuous-wave 1-W green power by single-pass frequency doubling in a bulk periodically poled MgO:LiNbO3 crystal.

Continuous-wave high-power green light generation at room temperature is reported in a single-pass frequency-doubling configuration with bulk periodically poled MgO:LiNbO3 crystal placed outside a diode end-pumped Nd:GdVO4 laser. The MgO:LiNbO3 samples of 6.95-microm domain period, uniform periodicity, and 50% duty cycle along the entire crystal length are fabricated by use of a high-voltage multipulse poling method. A maximum power of 1.18 W at 531 nm with 16.8% conversion efficiency is obtained from a 2-mm-thick, 25-mm-long MgO:LiNbO3 crystal; the corresponding internal green power and conversion efficiency are 1.38 W and 19.6%, respectively, whereas the normalized conversion efficiency is 3.3%/W.

Journal Article↗

[Management for type A acute dissection].

From March 1998 to May 2002, we experienced 46 patients with type A acute dissection (AAD). Fifteen patients managed initially with conservative treatment because of intramular hematoma (IH, n = 10), broad cerebral infarction (n = 3), others (n = 2). One who diagnosed IH at admission progressed to AAD and underwent surgery. However his diagnosis of IH at admission was proved to be misdiagnosis retrospectively. In 8 of the remaining 9 patients, hematoma disappeared during the follow-up of 6 months to 1 year. In patients with broad cerebral infarction, 2 died early after admission and 1 discharged with hemiplegia. Thirty-two patients underwent surgery and 1 with preoperative broad cerebral infarction died 36 days after surgery. In the remaining 31 patients, 30 patients discharged ambulatory.

Acute Disease↗

[Early and late results of combined valvular and coronary artery surgery].

A total of 42 patients with combined valvular and coronary artery surgery were examined to analyze risk factors for cardiac related events and late deaths. There were aortic valve disease in 26 patients and mitral valve disease in 16. Preoperatively, 14 patients (33%) had cardiac dysfunction (ejection fraction < or = 40%) and 10 patients (24%) were in New York Heart Association (NYHA) functional class IV. There was no operative death with 96% of early graft patency. There was 8 late deaths during 5.6 years of mean follow up. Actuarial survival rate was 86% and 64% after 5 and 10 years, respectively. Cardiac dysfunction was a significant independent predictor for late death. Cardiac related events occurred in 9 patients. Freedom from cardiac related events was 78% and 59% after 5 and 10 years, respectively. Cardiac dysfunction and mitral valve surgery were significant independent predictors for cardiac related events. Late result of combined mitral and coronary artery surgery was unfavorable in patients with cardiac dysfunction.

Aged↗

Wavelength stabilization of a distributed Bragg reflector laser diode by use of complementary current injection.

We have demonstrated wavelength stabilization in an 821-nm AlGaAs three-section tunable distributed Bragg reflector (DBR) semiconductor laser diode (LD) that consists of active, phase-controlled, and DBR regions. We injected two separate, complementary currents into the active and the phase-controlled regions in the DBR-LD to suppress wavelength shift. This modulation method was applied to the LD fundamental wave in a second-harmonic-generation (SHG) laser, and the oscillating wavelength was maintained within the phase-matching acceptance range of the SHG device during modulation. A peak blue-violet light power of 62 mW was obtained for the ideal modulation waveform.

Journal Article↗

Slowly developing perigraft seroma after a modified Blalock-Taussig shunt.

We report a 26-year-old patient with slowly developing perigraft seroma 15 years after a modified Blalock-Taussig shunt with an expanded polytetrafluorethylene graft. The mediastinal mass was first observed on a chest x-ray film 8 years after the shunt operation. The mass contained massive gelatinous or organic tissues with a severely calcified pseudocapsule, and it was adjacent to the calcified but functioning graft. No fluid collections were noted. The histological findings were compatible with a seroma. No recurrence was noted on last follow-up 1 year postoperatively.

Adult↗

Dipeptidyl peptidase IV on activated T cells as a target molecule for therapy of rheumatoid arthritis.

The extracellular domain of the T cell co-stimulatory molecule CD26 possesses dipeptidyl peptidase IV (DP IV) enzyme activity. Activated T cells are known to increase expression of cell surface DP IV and some specific inhibitors of this enzyme have been reported to suppress T cell function. Previously we have identified a DP IV inhibitor, designated TMC-2, found in culture supernatant of Aspergillus oryzae. Administration of TMC-2 to rats with adjuvant arthritis caused marked suppression of paw swelling. To elucidate the mechanism of TMC-2 antiarthritic activity, we have studied its effects on T cell function. Here we show that TMC-2 inhibited DP IV activity of CD26 immunoprecipitated from T cell lysates, and also inhibited proliferative responses of T cells to specific antigen or anti-CD3 antibody. Suppression of IL-2 production was demonstrated at both the mRNA and protein levels. TMC-2 did not alter the PTPase activity of pure CD45, but when this molecule was co-precipitated from T cell lysates together with associated CD26, its PTPase was virtually completely abolished by TMC-2. These results suggest that modulation of CD45 PTPase activity might be responsible for functional suppression of T cells by TMC-2. Because the effects of TMC-2 on T cells were reversible and it was not toxic at the concentrations used, TMC-2 may be a candidate novel therapeutic agent for rheumatoid arthritis.

Arthritis, Rheumatoid↗

Effect of a human urinary protease inhibitor (Ulinastatin) on respiratory function in pediatric patients undergoing cardiopulmonary bypass.

BACKGROUND: We performed this prospective randomized study to determine the effect of a human urinary protease inhibitor (Ulinastatin) on respiratory function in pediatric patients undergoing cardiopulmonary bypass. METHODS: Twenty-two children were included in this study. They were randomly allocated to 1 of the following groups; a control group (n=11) or a Ulinastatin group (n=11) in which patients received 5000 U/kg of Ulinastatin. Arterial blood samples were obtained before cardiopulmonary bypass (CPB), immediately after CPB, and 30 min after protamine administration, as well as 3 hours after and 18 hours after CPB, and Interleukin-8 and neutrophil elastase concentration were evaluated. RESULTS: CPB time and aortic clamp time did not differ between the groups. Interleukin 8 and neutrophil elastase concentrations before CPB increased significantly immediately after CPB, these concentrations did not differ between the groups. However, neutrophil elastase concentrations of a Ulinastatin group were significantly lower than that of a control group at 30 min after protamine administration (a Ulinastatin group: 1011.3+/-539.1 mg/ml, a control group: 1619.7+/-595.7 mg/ml, p<0.05) and A-aDO2 of a Ulinastatin group was significantly lower than that of a control group at 2 hours after CPB (a Ulinastatin group: 67.1+/-70.6 mmHg, a control group: 169.2+/-116.3 g, p<0.05). CONCLUSIONS: These results suggest that Ulinastatin suppresses the increase in neutrophil elastase and protects the respiratory function in pediatric patients undergoing cardiopulmonary bypass.

Cardiopulmonary Bypass↗

Hypermutable change of human UV(r)-1 cells by p53 overexpression.

The p53 protein has been reported to regulate cellular responses to genetic stress such as far-ultraviolet light (UV), protecting human cells from mutation. Levels of p53 protein in hypermutable RSa cells were found here to increase soon after UV irradiation, while those in UV(r)-1 cells, a hypomutable variant of RSa cells, showed a delayed increase. Three cell lines overexpressing wild-type p53 in UV(r)-1 cells exhibited higher sensitivity to UV mutagenicity than did control U-V-7 cells transfected with vector alone, assessed using the ouabain-resistance phenotypic mutation test and identification of K-ras codon 12 base substitution mutation. On the other hand, U-V-7 cells showed UV-induced elevation of antipain-sensitive protease activity, but p53 transfectants did not. Moreover, antipain treatment to U-V-7 cells was increased susceptibility to UV mutagenicity. Thus, p53 protein overproduction may sensitize human cells, at least those tested, to UV mutagenicity, in association with inhibition of protease activity.

Cell Division↗