Search PubMed⌕ Search

Biomedical subjects

T Oshima

Publications and source records attributed to T Oshima.

At least 541 records · Page 30Linked to original sources
PubMed1981

The nucleotide sequence of 5S rRNA from an extreme thermophile, Thermus thermophilus HB8.

Using 3'- and 5'-end labelling sequencing techniques, the following primary structure for Thermusthermophilus HB8 5S RNA could be determined: pAA (U) CCCCCGUGCCCAUAGCGGCGUGGAACCACCCGUUCCCAUUCCGAACACGGAAGUGAAACGCGCCAGCGCC GAUGGUACUGGCGGACGACCGCUGGGAGAGUAGGUCGGUGCGGGGGA (OH). This sequence is most similar to Thermusaquaticus 5S RNA with which it shows 85% homology.

Base Sequence↗
PubMed1981

Purification, some properties and amino acid sequence of Thermus thermophilus HB8 ferredoxin.

A stable ferredoxin was purified in a crystalline form from an aerobic, thermophilic bacterium, Thermus thermophilus HB8. The molecular weight of the protein was determined to be 10500 by gel-filtration on Sephadex G-75 and to be 10200 by the sedimentation equilibrium method. The number of iron and acid labile sulfur atoms per mol was determined to be 6.3 and 6.4, respectively. The optical absorption spectrum of the ferredoxin has a broad maximum around 400 nm. The ferredoxin was so thermostable that its absorbance at 400 nm did not decrease after a 45-min incubation at 65 degrees C. The primary structure of the ferredoxin consisting of 78 amino acids was determined by sequence analysis of peptides obtained from a tryptic digest of the S-carboxymethylated ferredoxin and from a Staphylococcus aureus V8 protease digest of the S-aminoethylated derivative. The distribution of cysteine residues and the amino acid sequence around the cysteine residues are very similar to those of Mycobacterium smegmatis ferredoxin.

Amino Acid Sequence↗
PubMed1981

Cloning of 3-isopropylmalate dehydrogenase gene of an extreme thermophile and partial purification of the gene product.

The gene of an extreme thermophile, Thermus thermophilus HB8, which codes for a leucine biosynthetic enzyme, 3-isopropylmalate (3-IPM) dehydrogenase [EC 1.1.1.85], was cloned in Escherichia coli using pBR322 as a vector. E. coli cells carrying this recombinant plasmid, pHB2, produced the thermophilic enzyme 7-fold more than did T. thermophilus HB8 cells. When the crude extract of the pHB2-carrying cells was treated at 70 degrees C for 10 min, approximately 75% of the protein in the extract was precipitated with full activity of the thermophilic 3-IPM dehydrogenase being left in the supernatant, indicating that 4-fold purification was achieved during this process. This shows that the thermophilic 3-IPM dehydrogenase was purified 28-fold by these two procedures, cloning and heat treatment, and demonstrates that the extract from the plasmid-harboring cells is a good starting material for purification of the enzyme. Following the heat treatment, 3-IPM dehydrogenase was further purified by ammonium sulfate precipitation and DEAE-cellulose column chromatography. The enzyme preparation thus obtained contained 3-IPM dehydrogenase as a major component with a few minor impurities as shown by polyacrylamide gel electrophoresis, whereas the enzyme preparation from T. thermophilus HB8 cells obtained by the same procedures showed multiple bands on a polyacrylamide gel electrophoresis.

3-Isopropylmalate Dehydrogenase↗
PubMed1981

Chemical structure and thermal properties of initiator tRNA from Euphausia sperba in comparison with those of other eucaryotic initiator tRNAs.

The nucleotide sequence of initiator tRNA (tRNAiMet) from Euphausia sperba, which was harvested in the Antarctic Sea, was determined to be pA-G-C-A-G-A-G-U-m1G-m2G-C-G-C-A-G-U-G-G-A-A-G-C-G-U-m2G-C-U-G-G-G-C-C-C-A-U-t6 A-A-C-C-C-A-G-A-G-m7G-U-C-G-G-U-A-G-A-psi-C-G-m1A-A-A-C-U-A-C-U-C-U-C-U-G-C-U-A -C-C-AOH by using post-labeling methods recently developed. The nucleotide sequence was very similar to that of mammalian tRNAiMet except for changes in six bases and three modifications: C16, U55, D47 and m5C48 are replaced by U16, psi 55 and unmodified U47 and C48, respectively. A50-U64 and G52-C62 base pairs of mammalian tRNAiMet are reversed in Euphausia tRNAiMet. In addition, the G49-C65 pair of the former is replaced by a less stable G49-U65 pair in Euphausia tRNAiMet. The sequence homology was compared between Euphausia tRNAiMet and over ten different species of eucaryotic tRNAiMet so far sequenced. The melting temperature of Euphausia tRNAiMet was 72.5 degrees C, which is 4.2 degrees C and 8.3 degrees C lower than those of rat liver and yeast tRNAiMet's, respectively. The origin of the thermal instability of Euphausia tRNAiMet is discussed in comparison of its secondary structure compared with those of other eucaryotic tRNAiMet's.

Animals↗
PubMed1981

[Studies on antigenicity, phototoxicity and other specific toxicities of hydrocortisone 17-butyrate 21-propionate (HBP) (author's transl)].

The present experiments were undertaken to determine the antigenicity and other toxicities of HBP; such as phototoxicity, photosensitivity, ulcerogenicity, adrogenic-myotropic, estrogenic and progestational activities, and mutagenicity. No antibody formation and delayed type skin reaction of HBP were seen in rabbits. Active systemic anaphylaxis was not observed in guinea pigs challenged by HBP. In the phototoxicity and photosensitivity test, 0.1% HBP ointment, 0.1% HBP cream and 10% HBP acetone solution did not show any skin reaction with or without irradiation of ultraviolet light. Repeated subcutaneous administration of HBP irritated the gastric and intestinal mucosa dose dependently in rats as hydrocortisone 17-butyrate and betamethasone 17-valerate (BV). HBP had neither androgenic-myotropic nor estrogenic activity, but antiestrogenic activity was observed. The progestational activity of HBP in immature rabbit pretreated with estrone was less potent than BV. In the mutagenicity test os HBP investigated by the reverse mutation according to the method by Ames, no significant increase in the number of revertants was observed in the presence or absence of S9 mixture.

Administration, Topical↗
PubMed1981

Dual activity patterns of fast pyramidal tract cells and their family neurones during EEG arousal in the cat.

1. Intracellular activities of fast pyramidal tract (PT) cells and their family neurones were investigated during the EEG arousal of various degrees in terms of (1) the strength of natural or midbrain reticular stimuli, (2) the length of aroused EEG and (3) the extent of stage shift from EEG synchronization to desynchronization. 2. These cells showed a response pattern of either disfacilitation (DF), disfacilitation followed by excitation (DF + E) or excitation (E). DF and E components in these responses were respectively quantified with their amplitude and incidence, and their relations to the above-listed intensity parameters of EEG arousal were examined. 3. The threshold of eliciting DF response was lower than that for E response to natural and reticular stimuli. On intensifying the parameters of EEG arousal, accompanying increases were observed in E response but not in DF response. Rather, DF response was often masked by E response on application of relatively intense stimuli, or was decreased in a reciprocal manner to the increase of E response in accordance with the degree of EEG arousal. 4. It is postulated that the phasic and tonic phases of EEG arousal manifested, respectively, as the initial DF and late E responses bear different functions, the former representing the cerebral state of a general set on receipt of a novel stimulus, and the latter involving the state of actively responding to the stimulus by encoding its intensity.

Animals↗
PubMed1981

Excitation of slow pyramidal tract cells and their family neurones during phasic and tonic phases of EEG arousal.

1. Intracellular activities of slow pyramidal tract cells and their family neurones were investigated during the EEG arousal of various intensities. 2. By assessing the intensity of midbrain reticular or natural stimuli, the arousal length of EEG and the extent of EEG stage shift, these neurones were identified as the recipient of enduring excitation (E + E) during both the phasic and tonic phases of EEG arousal, and were termed E + E cells. 3. These cells were located in all the cortical laminae. E + E responses took the form of continuous depolarization in most of the deep cortical layer cells, but separated initial and late peaks of depolarization were seen in most of the superficial initial and late peaks of depolarization were seen in most of the superficial layer cells. 4. The E + E response versus stimulus intensity or arousal length relationship consisted of plateau and rising limbs, which would characterize the initial and late E components, respectively. 6. The excitatory tonus was revealed in E + E cells with mean levels of resting membrane potential, being most hyperpolarized during highly synchronized EEG and gradually depolarized according to stage shift towards desynchronization.

Animals↗
PubMed1981

The structure of EEG arousal as a dynamic ensemble of neuronal activities in cat motor cortex.

1. Intracellular potentials were recorded from 164 cells in cat precruciate cortex, and their responses were examined during the phasic and tonic phases of EEG arousal. 2. According to the initial responses corresponding to phasic EEG arousal, these cells were classified into 71 E (excitation), 49 I (inhibition), 38 DF (disfacilitation), and 6 DI (disinhibition) cells. 3. The late responses corresponding to tonic EEG arousal varied among these cells. Thirty-two of the 164 cells were unresponsive. Of the remaining cells, 102 showed excitation, 16 inhibition, 12 disfacilitation, and 2 disinhibition. These cells were retermed +E, +I, +DF, and +DI cells, respectively. 4. +E cells were located at all depths through laminae I to VI, but the majority were found in laminae IIIb-VI. +I cells were between lamina I and the lower half of lamina III (IIIb), and +DF and +DI cells were between lamina I and the upper half of lamina III (IIIa). From these characteristic layer distributions it is postulated that an upward cascade transmission from deep to superficial layers occurs during tonic EEG arousal. 5. Nine types of combinations of the initial and late responses were found: E, I, DF or DI with +E, E or I with +I, E or I with +DF, and I with +DI. To explain these various activity patterns, an 'arousal' circuit model was proposed by combining the downward and upward cascade transmission patterns. The elementary structure of cortical arousal was thus formulated, and discussed from the development aspect of behavior.

Action Potentials↗
PubMed1981

Assessment of beta-blockade and the non-specific effect of bucumolol, a beta-adrenergic blocking agent, on atrioventricular conduction in anesthetized dogs.

The effects of the beta-adrenergic blocking agent bucumolol [dl-5-methyl-8-(2-hydroxy-3-t-butylaminoproxy)coumarin] and its optical isomers were compared with those of propranolol and pindolol on the functional refractory period and the conduction time of atrioventricular (A-V) transmission in dogs. In dogs with intact nerves anesthetized with pentobarbital, bucumolol and propranolol (30 micrograms - 1 mg/kg) prolonged both parameters by blockade of background sympathetic nervous tone to A-V conduction. The optical d- and l-isomers of bucumolol depressed A-V conduction almost in parallel with their beta-blocking actions. In dogs with cardiac sympathectomy and bilateral vagotomy, or pretreated with reserpine, the dromotropic activity was lowered and the beta-blocking dose (30 micrograms - 1 mg/kg) of bucumolol and propranolol had less effect on A-V conduction, while larger doses (3-10 mg/kg) produced additional depression of the conduction. Pindolol, on the other hand, had a positive dromotropic action, reflecting its intrinsic stimulatory action. It is concluded that A-V conduction is affected by the existing tone of sympathetic nervous activity and that bucumolol has no beta-stimulant action and depresses A-V conduction by beta-blockade and by a non-specific action.

Adrenergic beta-Antagonists↗
PubMed1981

Cardiovascular pharmacology of bumepidil, a new synthetic vasoactive compound for coronary circulation.

Intravenously administered 8-tert.-butyl-7,8-dihydro-5-methyl-6H-pyrrolo[3,2-e]triazolo[1,5-alpyrimidine (bumepidil, CS-611) increased the coronary sinus outflow as well as intramyocardial flows in both subendocardial and subepicardial layers in the anesthetized dog and also the increase in the coronary arterial inflow was observed with short onset time, within 10 min when given orally to the conscious dog, and time for maximum effect is also short, i.e., 20 min after the oral administration. In the anesthetized rabbit flow-increase in the brain by CS-611 was next to the coronary, followed by the stomach and small intestines while there was no organ which showed a decreased flow. In the anesthetized open-chest dog cardiac output was increased by CS-611 while myocardial oxygen consumption was little affected. In addition, CS-611 exerted antiarrhythmic action on ventricular ectopics induced by coronary ligation of the conscious dog. A correlation between the increase in myocardial flow by CS-611 in the intact heart and the antiarrhythmic action in the coronary-lighted heart still remains to be studied further.

Animals↗