Search PubMed⌕ Search

Biomedical subjects

T Nishimaki

Publications and source records attributed to T Nishimaki.

At least 73 records · Page 4Linked to original sources
PubMed1997

Synovial mononuclear cells consist with T cells which produce high levels of tumor necrosis factor alpha.

To determine whether synovial mononuclear cells include a population of tumor necrosis factor alpha-producing T cells, we measured tumor necrosis alpha levels in culture supernatants of synovial mononuclear cells by ELISA and analyzed tumor necrosis alpha mRNA-positive cell frequencies. There were no significant differences in the spontaneous levels of TNF alpha between synovial mononuclear cells and peripheral mononuclear cells. The frequency of tumor necrosis factor alpha mRNA-positive cells in synovial mononuclear cells was higher than that of peripheral mononuclear cells. When stimulated with a superantigen, mononuclear cells from the synovial fluid of rheumatoid arthritis patients showed higher levels of tumor necrosis factor alpha production (1,035 +/- 817 pg/ml) than did mononuclear cells from their peripheral blood (236 +/- 180 pg/ml). In addition, we observed that a few T cell clones were resistant to superantigenic restimulation in vitro. We conclude that when these types of T cells persist in the synovium, they play a role in the development of rheumatoid arthritis via a mechanism involving tumor necrosis factor alpha production.

Animals↗
PubMed1997

Enhanced interleukin-8 production by cultured Chang liver cells subjected to ethanol exposure and subsequent stimulation with tumor necrosis factor-alpha.

We investigated the production of interleukin-8 (IL-8) and chemotactic activity released from Chang liver cells subjected to long-term treatment with ethanol (Et) and subsequent stimulation with tumor necrosis factor-alpha (TNF-alpha). Chang liver cells were cultured in the presence of 5, 50 or 100 mmol/l Et for 4 weeks and then treated with recombinant TNF-alpha (1, 10, 100 U/ml). The culture supernatants were assayed for IL-8 using a sandwich ELISA and chemotactic activity was measured using a chemotactic chamber. Total RNA was also extracted from these cells and IL-8 mRNA was assayed by RT-PCR. In addition, TNF-receptor expression on the Et-treated cells was analyzed by flow cytometry. IL-8 levels in supernatants of cells stimulated with 100 U/ml of TNF-alpha for 48 h rose significantly with increasing concentrations of Et and values obtained were as follows: 4,918 +/- 244.4 pg/ml at 0 mmol/l Et, 5,335 +/- 266.2 pg/ml at 5 mmol/l Et, 8,726 +/- 873.4 pg/ml at 50 mmol/l Et and 9,134 +/- 866.0 pg/ml at 100 mmol/l Et. The chemotactic activity also increased with increasing concentrations of Et and was almost completely suppressed by anti-IL-8 antibody. Using semiquantitative analysis of radioactivity of IL-8 mRNA using a 32P gamma ATP-labeled primer for IL-8 mRNA, Et-treated cells were shown to have markedly higher levels of radioactivity than untreated cells. In addition, TNF-receptor expression was significantly higher in cells treated with 100 mmol/l Et. These data suggest that long-term Et treatment of Chang liver cells stimulated with TNF-alpha may enhance transcription of the IL-8 gene with up-regulation of the TNF receptor.

Antibodies↗
PubMed1997

125I uptake competing with iodine absorption by the thyroid gland following povidone-iodine skin application.

Povidone-iodine solution is widely used to disinfect the skin surface or prevent suppuration during human and animal surgery. Using radioisotope 125I, we examined whether iodine may be absorbed and then concentrated in the thyroid gland when povidone-iodine solution is applied to the skin of rats or mice. The competition for 125I uptake was examined in mice and rats after the application of povidone iodine to the skin. We also traced the process of absorbed 125I in the thyroid glad during the fixation for tissue preparations. Povidone-iodine applied to the skin significantly reduced the uptake of 125I both in mice and rats. Significant flux of 125I from the thyroid gland in povidone-iodine treated animals was noted during the thyroid fixation of tissue preparations. From these results, povidone-iodine application to the skin instead of stable KI administration may be practical for preventing the uptake of 125I by the thyroid gland during 125I compound administration for medical therapy. In animal experiments concerning thyroid functions, careful attention must be paid when povidone-iodine is used for disinfection in animal surgery.

Administration, Cutaneous↗
PubMed1997

Synoviocyte proliferation in joints of SCID mice induced by toxic shock syndrome toxin-1 stimulated T cells from patient with rheumatoid arthritis.

OBJECTIVE: To investigate the histopathological arthropathy in severe combined immunodeficient (SCID) mice given intraarticular injection of toxic shock syndrome toxin-1 (TSST-1) stimulated T cells from patients with rheumatoid arthritis (RA). METHODS: Unstimulated or TSST-1 stimulated T cell blasts (TB-TSST) of synovial fluid mononuclear cells from patients with RA (RASFMC) were intraarticularly injected into the knee joint of SCID mice. Four weeks later, the knee joints were histopathologically examined and the numbers of fibroblasts in the synovial tissues were compared with those of controls. Total RNA of the SCID mouse knee joints was isolated and Southern analysis for human T cell receptor (TCR) V beta 2 and human tumor necrosis factor-alpha (TNF-alpha) was carried out. RESULTS: Hyperplasia and increased numbers of the fibroblasts as well as neovascularization of the synovial tissues were observed in the SCID mouse knee joint tissues injected with TB-TSST of RASFMC compared with those injected with unstimulated T cells from RASFMC or with TB-TSST from peripheral blood of healthy controls. Messenger RNA for human TCR V beta 2 and TNF-alpha were detected in the SCID mouse knee joint tissues injected with TB-TSST from RASFMC. CONCLUSION: Superantigen TSST-1 stimulated T cells from RASFMC have the ability to induce chronic arthropathy with fibroblast proliferation and neovascularization in the SCID mouse.

Animals↗
PubMed1997

Anti-endothelial cell antibodies in the sera of patients with mixed connective tissue disease--the clinical significance.

To determine the clinical significance of anti-endothelial cell antibodies in mixed connective tissue disease (MCTD), we measured the titers of antibodies to both untreated and cytokine-treated endothelial cells (EC) in the sera of the MCTD patients by means of an enzyme linked immunosorbent assay. The mean titer of antibodies to untreated EC (aEC) in the sera of the MCTD patients was significantly higher than that for the healthy subjects. The mean titer of antibody to EC treated with IFN gamma, IL1 (aIL1-EC) or TNF alpha (aTNF-EC) was significantly higher than that of aEC in the sera of the MCTD patients with proteinuria, and the mean titer of aTNF-EC was significantly higher than that of aEC in the sea of the MCTD patients with pulmonary fibrosis. Furthermore, the mean titers of aIL1-EC and aTNF-EC in the sera of the MCTD patients with pulmonary fibrosis were significantly higher than those of aIL1-EC and aTNF-EC in the sera of the MCTD patients without pulmonary fibrosis. These results suggest that antibodies to cytokine-treated EC may play a more important role in the manifestation of renal or pulmonary lesions in MCTD patients than aEC.

Antibodies↗
PubMed1997

Expression of Fas antigen on hepatocytes in viral hepatitis patients.

To evaluate the relationship between viral hepatitis and apoptosis, expression of Fas antigen in liver tissue sections of patients with viral hepatitis was investigated by immunohistochemical study using antibody to Fas antigen. A total of 46 liver tissues were obtained from 12 patients with acute viral hepatitis (AH) and 34 patients with chronic hepatitis (CH). Fas antigen was more markedly expressed in hepatocytes of AH patients than of CH patients. The Fas-positive hepatocytes of AH patients was localized rather diffusely in the inter lobular area and they were associated with closely to the area of the inflammatory cell infiltration. In CH patients, Fas antigen was weakly expressed in hepatocytes and was more intense in chronic active hepatitis than in persistent hepatitis patients. These results indicate that apoptosis may occur more frequently in AH than CH and might contributed to death of hepatocytes mainly in viral AH and partly in viral CH.

Adult↗
PubMed1996

Intramural metastases from thoracic esophageal cancer: local indicators of advanced disease.

The patterns of tumor spread and long-term survival of patients with (n = 54) and without (n = 270) intramural metastasis from esophageal cancer were investigated after either extended radical (n = 155) or less radical (n = 169) esophagectomy. The purpose was to evaluate whether extended radical esophagectomy has an impact on the long-term survival of patients with intramural metastases from the disease. The patients with intramural metastasis had significantly larger primary tumors (p < 0.01) and more frequent T4 tumors (p < 0.001), stage IV disease (p < 0.05), lymphatic invasion (p < 0.05), and lymph node metastasis (p < 0.01) than did those without intramural metastasis. The survival rates of patients with intramural metastases were significantly worse than those of patients without intramural metastases after resection (p < 0.001). No patient with intramural metastases survived more than 4 years after either extended or less radical esophagectomy, and there was no significant difference between the two survival curves. Therefore intramural metastases should be considered local indicators of advanced esophageal cancer, and radical esophagectomy may not be indicated for patients with intramural metastasis from the disease.

Aged↗
PubMed1996

Interleukin-6 induces proliferation of rat hepatocytes in vivo.

BACKGROUND/AIMS: The aim of this study was to assess the effect of interleukin-6 (IL-6) on the proliferation of hepatocytes and to study the interaction between IL-6 and hepatocyte growth factor (HGF) in vivo. METHODS: IL-6 was injected at a dose of 200 micrograms/mg subcutaneously into rats every day for 14 days. Liver and blood samples were obtained at 1, 3, 7 and 14 days during IL-6 administration. Hepatocyte proliferative activity of sera was measured using 3H-thymidine incorporation into cultured rat hepatocytes. To evaluate the proliferative activity of the hepatocytes in tissue sections, hepatic DNA content and immunostaining of the liver tissue sections for proliferating cell nuclear antigen (PCNA) were performed. Plasma HGF levels were measured using specific EIA. In addition, total RNA was extracted from the liver and expression of HGF mRNA was detected by RT-PCR. RESULTS: The DNA contents of liver taken from IL-6-treated rats were increased during IL-6 administration compared with untreated rats. Sera taken from IL-6-treated rats at various intervals during administration also significantly increased 3H-thymidine incorporation by cultured rat hepatocytes compared with sera from untreated rats, suppressing 3H-thymidine incorporation at day 1 and 3 by anti-HGF antibody. IL-6 itself did not increase 3H-thymidine incorporation. Increased expression of PCNA in these hepatocytes was noted from 1 day after IL-6 administration, and at 14 days, the number of PCNA-positive cells was sevenfold greater than in the livers of untreated rats. However, plasma HGF levels showed a peak at day 1, decreased gradually from day 3, and became undetectable by day 14. HGF mRNA expression in livers of IL-6-treated rats was suppressed from day 3 to day 14 of IL-6 administration. CONCLUSIONS: These data show that IL-6 induces an early phase of liver cell growth in vivo and suggest that an increase level of HGF mediates this effect.

Animals↗
PubMed1996

Protective effect of beraprost sodium, a stable prostacyclin analogue, in development of monocrotaline-induced pulmonary hypertension.

Experimental pulmonary hypertension (PH) was induced by a single injection of monocrotaline (MCT), a pyrrolizidine alkaloid extracted from Crotalaria spectabilis. The effect of beraprost sodium, a stable prostacyclin analogue, on the development of MCT-induced PH in rats was studied. Chronic administration of beraprost sodium at a dose of 30 micrograms/kg/day initiated on the same day as MCT injection decreased the degree of PH determined by weight ratio of right ventricular free wall to that of left ventricle plus septum depending on the duration of administration. Although the injection of prostaglandin E1 (PGE1) at a dose of 200 micrograms/kg/day initiated 1 week after MCT injection did not decrease the degree of PH significantly, beraprost sodium administration at doses of 30 and 100 micrograms/kg/day decreased the degree of PH significantly. The cytoprotective effect of beraprost sodium against endothelial cell (EC) damage is believed to be involved in inhibiting development of PH in MCT-injected rats. The amounts of cytokines such as interleukin-1 (IL-1), interleukin-6 (IL-6), and tumor necrosis factor (TNF) produced by alveolar macrophages decreased in accordance with the inhibiting effect of beraprost sodium on development of PH, indicating that beraprost sodium inhibited the development of PH in MCT-injected rats not only through its effect of vasodilation and anti-platelet aggregation in pulmonary circulation but also through its antiinflammatory effects.

Alprostadil↗
PubMed1996

Early esophageal adenocarcinoma arising in a short segment of Barrett's mucosa after total gastrectomy.

A 66-yr-old man had undergone a total gastrectomy with esophagojejunostomy for gastric cancer 29 yr previously. Soon after the operation, he began to suffer frequent bile regurgitation and subsequent alkaline reflux esophagitis. A small esophageal tumor was found incidentally above the esophagojejunostomy at a follow-up endoscopy, and he subsequently underwent a lower esophagectomy in 1995. The resected specimen revealed evidence of an early adenocarcinoma arising in a short segment of columnar cell-lined esophagus which had not been grossly evident prior to the esophagectomy. The present case indicates that columnar metaplasia with a neoplastic potential can be induced in the esophagus by the chronic reflux of duodenal contents in the absence of gastric acid.

Adenocarcinoma↗
PubMed1996

[CpG motif in DNA from immune complexes of SLE patients augments expression of intercellular adhesion molecule-1 on endothelial cells].

The sequence of 9 DNA clones obtained from DNA-anti-DNA antibody immune complexes (IC) in 11 SLE patients was analyzed and the possible pathogenic role of the circulating DNA in SLE patients was discussed. Nucleic acid length of 9 cloned DNAs ranged from 87 to 312 base pairs(bp), with a mean length of 177 +/- 62bp, which were rich in guanine (G) + cytosine(C), CpG dinucleotide and palindromic sequences. Oligonucleotide TTTTCAATTCGAAGATGATT which contain the CpG motif in hexamer palindromic sequence segments in cloned DNA augmented the expression of ICAM-1 on the endothelial cells detected by FACS analysis and also augmented the gene expression of several cytokines such as interleukin-2, interleukin-6, interleukin-8 and tumor necrosis factor alpha. These data suggest that DNA in IC of SLE patients will augment expression of ICAM-1 on endothelial cells, resulting in exacerbation of vasculitis.

Antigen-Antibody Complex↗
PubMed1996

A case of idiopathic portal hypertension complicated with narrowing of intrahepatic bile ducts.

A 37-year-old woman who had portal hypertension followed by splenomegaly, developed collateral blood flow of spleno-renal shunt and paraesophageal veins, esophageal varices and further with narrowing of intrahepatic bile ducts shown by endoscopic retrograde cholangiography was described. Liver function was almost normal except the slight elevation of serum alkaline phosphatase and gamma-glutamyl transpeptidase levels. However, endoscopic retrograde cholangiography revealed the narrowing of the intrahepatic bile ducts. The histological examination of biopsied specimen showed no prominent change in portal tracts and bile ducts without cell infiltration or fibrosis in the portal area. This case will be considered as idiopathic portal hypertension complicated by narrowing of the intrahepatic bile ducts.

Adult↗
PubMed1996

Periarticular ectopic calcinosis probably due to 1 alpha-OH-vitamin D3 therapy, and successful treatment with bisphosphonate compound in a patient with systemic lupus erythematosus.

We describe the case of a 25-year-old woman who developed soft tissue ectopic nephritis. Ectopic calcinosis rarely occurs in systemic lupus erythematosus (SLE) patients. This is the first detailed case report of metastatic ectopic calcinosis, one of two categories of ectopic calcinosis, probably due to 1 alpha-OH-vitamin D3 therapy. We administered disodium 3-amino-1-hydroxypropylidene-1, 1-bisphosphonate pentahydrate, a second-generation bisphosphonate, to decrease the patient's serum calcium level, and subsequently observed a dramatic decrease in severity of the ectopic calcinosis along with decreases in both the serum calcium level and the (serum calcium level)x(serum phosphate level) index. We suggest that 1 alpha-OH vitamin D3 should be used in cases of lupus nephritis with great caution.

Adult↗