Biomedical subjects

T Nagamine

Publications and source records attributed to T Nagamine.

At least 127 records · Page 7Linked to original sources

PubMed1998

Modality-specific subregions in human inferior parietal lobule: a magnetoencephalographic study during cognitive tasks.

The inferior parietal lobule (IPL) has been considered to be a multimodal sensory association area. Both event-related potentials and magnetic responses have examined the relationships between IPL and cognitive processing. However, there have been no studies clarifying the functional subregions in IPL. We studied the event-related magnetic response during conventional auditory and visual oddball paradigms. We were able to distinguish non-invasively modality-specific subregions in IPL. The subregion in IPL activated by auditory target stimuli was located more anterior and superior than that responding to visual target stimuli on each hemisphere. The data suggests that modality-specific subregions in the IPL are differentially activated by auditory or visual stimuli.

Acoustic Stimulation↗

PubMed1998

Serial processing of the somesthetic information revealed by different effects of stimulus rate on the somatosensory-evoked potentials and magnetic fields.

In order to evaluate information processing in the somatosensory cortex, the effect of two different stimulus rates was investigated by simultaneously recording somatosensory-evoked potentials (SEPs) and magnetic fields (SEFs) in nine healthy adults. During electric stimulation of the median nerve at the wrist, SEFs were recorded with the helmet-shaped whole-head coverage magnetometer array with 122 first-order planar gradiometers while SEPs were simultaneously recorded from seven scalp positions. Interstimulus intervals (ISIs) of 0.9 s and 4 s were compared. In all subjects, N20 as well as its magnetic counterpart, N20m, was clearly demonstrated over the contralateral somatosensory area. Subsequent deflections around 80-200 ms did not make any clear peak and were smaller than those at 20-60 ms (P30m, P40m, N50m and P60m). After 200 ms, SEFs were negligible, whereas SEPs had larger amplitude than those of shorter latencies, constituting a peak around 250 ms (P250). Both SEF and SEP deflections later than 40 ms were decreased in responses at the shorter ISI; this diminution was most prominent for P250. Therefore, it is concluded that the tangential currents in the somatosensory cortex (area 3b) mainly contribute to responses during the first 200 ms after the stimulus, whereas the radially oriented currents (most likely in the crown of the postcentral gyrus) take over for subsequent information processing.

Adult↗

PubMed1998

Human supplementary motor area is active in preparation for both voluntary muscle relaxation and contraction: subdural recording of Bereitschaftspotential.

Bereitschaftspotentials (BPs) preceding muscle relaxation and contraction were compared by using subdural electrodes which were implanted onto the right medial frontal surface in two patients with supplementary motor area (SMA) seizure. The applied movement paradigm (muscle relaxation and contraction tasks) was completely the same as employed in our previous study [Terada, K., Ikeda, A., Nagamine, T. and Shibasaki, H., Electroenceph. clin. Neurophysiol., 95 (1995) 335-345]. In both patients, either negative or positive BPs were observed in the SMA-proper and supplementary negative motor area (SNMA) starting at 1.2-1.8 prior to both movements. In one patient, BP was more widespread in the relaxation task whereas more restricted to the hand area in the contraction task. In the other patient, the BPs were observed in the cortical area rostral to SNMA (pre-SMA), in addition to the SMA-proper, in both tasks. It is concluded that SMA-proper and SNMA, and probably pre-SMA as well, in humans are similarly active in preparation for both voluntary muscle contraction and relaxation.

Adult↗

PubMed1998

Pathogenesis of cortical myoclonus studied by magnetoencephalography.

Myoclonus-associated cortical activities were studied by simultaneous recording of a magnetoencephalogram and an electroencephalogram in 6 patients with cortical myoclonus due to various causes. Cortical activities were averaged, with respect to the precise onset of the myoclonic jerk, to evaluate the myoclonus-associated cortical magnetic fields. The estimated generator of their earliest peak was localized at the contralateral precentral gyrus in all patients. As judged from the direction of the electrical current, surface positive activity preceding the electromyographic discharge was detected in 3 patients with cortical reflex myoclonus and in 1 patient with possible corticobasal degeneration. In contrast, in the remaining 2 patients (Lennox-Gastaut syndrome and Alzheimer's disease), magnetic fields time-locked to the myoclonic jerk were associated with surface negative activity at the precentral cortex. The present study, applying for the first time an off-line jerk-locked back-averaging analysis to magnetoencephalography, demonstrated the important role of the precentral cortex in generating spontaneous myoclonus. It is most likely that the differing polarity of the electromagnetic activity reflects the differing activation patterns within the cortical laminar structure in the precentral area, underlying the generation of various types of myoclonus.

Adult↗

PubMed1998

Immunohistochemical detection of activin A, follistatin, and activin receptors during fracture healing in the rat.

Activins are multifunctional proteins that belong to the transforming growth factor-beta superfamily and are thought to play an important role in modulating the formation of bone. Activins exert their cellular effects by way of activin type-I and type-II serine/threonine kinase receptors. Follistatin is an activin-binding protein that can suppress the biological effects of activins. In this study, the immunohistochemical expression of activin A, follistatin, and activin receptors was studied during fracture healing in the rat. Activin A was weakly detected in the periosteum near the fracture ends at an early stage but was absent in the chondrocytes around the fracture gap, where endochondral ossification took place. An antibody to follistatin stained osteogenic cells in the periosteum near the fracture ends; moderate and strong staining were observed in proliferating, mature, and hypertrophied chondrocytes at the sites of endochondral ossification. Levels of activin A and follistatin were high near the osteoblasts on the surface of the newly formed trabecular bone. In addition, an intense localization of activin A was noted where multinucleated osteoclast-like cells were present. This study suggests that the activin-follistatin system may contribute to cellular events related to the formation and remodeling of bone during fracture healing. Activin type-I and type-II receptors were co-expressed in intramembranous and endochondral ossification sites. The expression of activin type-I, type-II, and type-IIB receptors in the absence of activin A in the endochondral ossification suggests that other isoforms of activins may signal by way of these receptors.

Activin Receptors↗

PubMed1998

Electrophysiological studies of early stage corticobasal degeneration.

We conducted electrophysiological studies in two Asian patients with probable corticobasal degeneration (CBD). The duration of illness from onset was 16 and 20 months, respectively. The clinical manifestations were markedly asymmetric and characterized by cortical sensory loss, apraxia, action myoclonus, action tremor, and akinetic-rigid parkinsonism. Neither patient responded to levodopa therapy. Simple photon-emission computed tomography (SPECT) study showed significantly decreased regional cerebral blood flow in the frontoparietal areas and thalamus opposite to the predominantly affected limb. A series of electrophysiological studies failed to identify giant somatosensory evoked potentials (SEPs), enhanced long latency electromyography (EMG) reflex, and cortical spikes preceding myoclonic jerk. However, the earliest cortical component of the median nerve SEP was exclusively enlarged in one patient and preserved with depression of the subsequent components in the other patient. Significantly shorter postmotor-evoked potential (MEP) silent period was found after the transcranial magnetic stimulation of the motor cortex in both patients. CBD is a unique clinical entity characterized by action myoclonus probably the result of the pathologic hyperexcitability of the motor cortex, based on a loss of inhibitory input from the sensory cortex.

Aged↗

PubMed1998

Transcriptional regulation of the Prevotella ruminicola recA gene.

The regulation of the recA gene expression in the obligately anaerobic rumen bacterium Prevotella ruminicola was investigated by monitoring the recA-specific transcript level. P. ruminicola recA forms a monocistronic unit, but no SOS-box sequences resembling those of Escherichia coli or Bacillus subtilis can be identified upstream of the recA coding region. At the same time, we observed a fivefold increase in the level of recA mRNA in response to DNA damaging agents, mitomycin C and methyl methanesulfonate, as well as under conditions of oxidative stress. No induction was detected when growth of P. ruminicola was arrested by shifting to acidic (pH 4.8) conditions. Primer extension experiment revealed the three very close transcriptional start sites for recA. The putative -10 and -35 RNA polymerase binding regions were proposed on the basis of transcript mapping. These regions bear very little similarity to the E. coli (sigma70) and B. subtilis (sigmaA) consensus sequences, as well as to the recognition sites of other minor sigma-factors. Transcript mapping experiments in E. coli expressing P. ruminicola recA confirmed that the transcription machineries of these two bacteria recognize completely different regulatory sequences on the template to initiate transcription. Preliminary DNase I footprinting analysis data revealed that the region of imperfect dyad symmetry (AATTATAATCAATTATAAAT) found between the putative -10 region and the translation initiation codon may serve as an SOS-box-like regulatory sequence in P. ruminicola. This sequence bears no similarity to the known SOS-box sequences and, in particular, to that of E. coli and other Gram-negative bacteria.

Animals↗

PubMed1998

Survival of patient with late onset hepatic failure by living-related liver transplantation from maternal donor with incompatible blood type.

A 14-year-old girl with blood type B with late onset hepatic failure (LOHF) of unknown cause has survived through living-related liver transplantation (LRLT). No hepatitis virus, including HAV, HBV, HCV, and HGV, was positive at the onset of LOHF. Autoimmune hepatitis was thought to be the cause because of positive results for serum anti-nuclear antibody at 80 times dilution and elevated gamma-globulin, but treatment with glucocorticoid did not suppress the progressive hepatic failure. Supportive therapy, including pulse therapy with 1g methylprednisolone for 3 days, ursodesoxycholic acid, branched-chain amino acid, and azathioprine did not resolve the hepatic failure. She was treated by repeated plasmapheresis and plasma absorption for 10 months, and then received the left lobe of her mother's liver. (Her mother's blood type was AB). The patient had been well, being treated with tacrolimus and prednisolone, although the serum titer of anti-blood type B antibody was high just after LRLT and mild liver dysfunction continued for more than 3 years after LRLT. Follow-up biopsy 3 years after LRLT revealed chronic hepatitis and progression to liver cirrhosis. Re-transplantation is now under consideration; the patient is now aged 19 years.

ABO Blood-Group System↗

PubMed1998

Reappraisal of the effect of electrode property on recording slow potentials.

Subdural electrodes made of stainless steel, which were believed to be unsuitable for recording slow potentials, can still record Bereitschaftspotential (BP) (Neshige, R., Lüders, H. and Shibasaki, H. Recording of movement-related potentials from scalp and cortex in man. Brain, 1988, 11: 719-736) and ictal DC shifts (Ikeda, A., Terada, K., Mikuni, N., Burgess, R.C., Comair, Y., Taki, W., Hamano, T., Kimura, J., Lüders, H.O. and Shibasaki, H. Subdural recording of ictal DC shifts in neocortical seizures in humans. Epilepsia, 1996b, 37: 662-674) sufficiently. In this study, therefore, the effects of different kinds of metals on slow potential recordings were reevaluated. First, slow electro-oculograms (EOGs) were recorded with 3 different levels of input impedance (200 M omega, 470 k omega and 10 k omega) of a DC amplifier by using surface electrodes made of silver (Ag), silver/silver chloride (Ag/AgCl) and stainless steel. Secondly, BP was recorded by using the above electrodes with a long time constant of 3 s and with a fixed input impedance of 100 M omega. As a result: (1) slow EOGs were equally recorded with the input impedance of 200 M omega and 470 k omega regardless of the kind of metals used, although stainless steel electrodes caused baseline fluctuation, (2) low input impedance of 10 k omega allowed only the Ag/AgCl electrode to record slow EOGs without any decay, and (3) electrodes made of stainless steel could record BP as efficiently as the other two types of electrode with high input impedance. In conclusion, electrodes with a large surface area contact such as cup electrodes and an amplifier with a large input impedance, electrodes made of Ag, and even of stainless steel, can record slow potentials reasonably well.

Contingent Negative Variation↗

PubMed1998

Cortical activation during fast repetitive finger movements in humans: steady-state movement-related magnetic fields and their cortical generators.

OBJECTIVE: To study the cortical physiology of fast repetitive finger movements. METHODS: We recorded steady-state movement-related magnetic fields (ssMRMFs) associated with self-paced, repetitive, 2-Hz finger movements in a 122-channel whole-head magnetometer. The ssMRMF generators were determined by equivalent current dipole (ECD) modeling and co-registered with anatomical magnetic resonance images (MRIs). RESULTS: Two major ssMRMF components occurred in proximity to EMG onset: a motor field (MF) peaking at 37+/-11 ms after EMG onset, and a postmovement field (post-MF), with inverse polarity, peaking at 102+/-13 ms after EMG onset. The ECD for the MF was located in the primary motor cortex (M1), and the ECD for the post-MF in the primary somatosensory cortex (S1). The MF was probably closely related to the generation of corticospinal volleys, whereas the post-MF most likely represented reafferent feedback processing. CONCLUSIONS: The present data offer further evidence that the main phasic changes of cortical activity occur in direct proximity to repetitive EMG bursts in the contralateral M1 and S1. They complement previous electroencephalography (EEG) findings on steady-state movement-related cortical potentials (ssMRCPs) by providing more precise anatomical information, and thereby enhance the potential value of ssMRCPs and ssMRMFs for studying human sensorimotor cortex activation non-invasively and with high temporal resolution.

Adult↗

PubMed1998

Role of the primary auditory cortex in auditory selective attention studied by whole-head neuromagnetometer.

In order to identify the human cortical areas involved in the auditory attention, neuromagnetic fields were recorded from 12 healthy adults with a 122-channel whole-head magnetometer while the subjects performed the auditory selective attention task. Randomized sequence of 900 Hz (P=0.9) and 950 Hz (P=0.1) tones was presented to each ear with random interstimulus intervals across ears ranging from 300 to 500 ms. Subjects were asked to pay attention to the designated ear (attended ear) and to count the number of the 950 Hz tones presented to the attended ear. Twelve sessions were performed for each subject, among which the attended ear was changed alternately in a counterbalanced order among subjects. In seven out of twelve subjects, averaged neuromagnetic fields in response to frequent tones presented to the attended ear showed attention-related deflection over the bilateral temporal areas starting at around 100 ms after the stimulus presentation. Although the dipole moment for N100m in the attended condition showed significant increase compared to that in the non-attended condition, locations of the two equivalent current dipoles in the auditory cortex were not significantly different from each other. Moreover, a simulation study supported the enhancement of N100m rather than participation of additional dipoles in the auditory selective attention task. These results suggest that the primary auditory cortex plays a main role in the auditory selective attention starting as early as 100 ms after the stimulus presentation.

Adult↗

PubMed1998

Distinct and overlapping patterns of localization of bone morphogenetic protein (BMP) family members and a BMP type II receptor during fracture healing in rats.

Bone morphogenetic proteins (BMPs) and their receptors (BMPRs) are thought to play an important role in bone morphogenesis. The purpose of this study was to determine the locations of BMP-2/-4, osteogenic protein-1 (OP-1, also termed BMP-7), and BMP type II receptor (BMPR-II) during rat fracture healing by immunostaining, and thereby elucidate the possible roles of the BMPs and BMPR-II in intramembranous ossification and endochondral ossification. In the early stage of fracture repair, the expression of BMP-2/-4 and OP-1 was strongly induced in the thickened periosteum near the fracture ends, and coincided with an enhanced expression of BMPR-II. On day 7 after fracture, staining for BMP-2/-4 and OP-1 immunostaining was increased in various types of chondrocytes, and was strong in fibroblast-like spindle cells and proliferating chondrocytes in endochondral bone. On day 14 after fracture, staining with OP-1 antibody disappeared in proliferating and mature chondrocytes, while BMP-2/-4 staining continued in various types of chondrocytes until the late stage. In the newly formed trabecular bone, BMP-2/-4 and OP-1 were present at various levels. BMPR-II was actively expressed in both intramembranous ossification and endochondral ossification. Additionally, immunostaining for BMP-2/-4 and OP-1 was observed in multinucleated osteoclast-like cells on the newly formed trabecular bone, along with BMPR-II. In reference to our previous study of BMP type I receptors (BMPR-IA and BMPR-IB), BMPR-II was found to be co-localized with BMPR-IA and BMPR-IB. BMP-2/-4 and OP-1 antibodies exhibited distinct and overlapping immunostaining patterns during fracture repair. OP-1 may act predominantly in the initial phase of endochondral ossification, while BMP-2/-4 acts throughout this process. Thus, these findings suggested that BMPs acting through their BMP receptors may play major roles in modulating the sequential events leading to bone formation.

Animals↗

PubMed1998

An increase of circulating leptin in patients with liver cirrhosis.

OBJECTIVE: Leptin, the ob gene product, is an anorexigenic peptide secreted from adipose tissue. However, the mechanism of leptin clearance/degradation has not been well determined in humans. The present study was undertaken to examine a possible involvement of liver in determining circulating leptin concentrations in humans. SUBJECTS: In the present study 58 healthy control subjects and 68 patients with liver cirrhosis (LC) without any renal dysfunction were randomly included. METHOD: The serum immunoreactive leptin (IRL) concentrations relative to the body mass index (BMI) were determined. Serum IRL and estradiol (E2) concentrations were assayed by radioimmunoassay (RIA). RESULTS: The correlations between the BMI and circulating IRL concentrations were all significant in male healthy controls (M-C), male patients with LC (M-LC), female healthy controls (F-C) and female patients with LC (F-LC). Circulating IRL concentrations were significantly higher than control in F-LC but not M-LC groups. The ratio of circulating IRL concentrations to the BMI was significantly higher in the M-LC group than in the M-C group and also significantly higher in the F-LC group than in the F-C group. The correlation between the IRL/BMI ratio and serum total bilirubin concentrations was significant (r = 0.417, P < 0.05) in the M-LC group, but not in the F-LC group. There was no significant correlation of the IRL/BMI ratio to serum E2 or albumin concentrations in either M-LC or F-LC groups. CONCLUSION: The present data demonstrated that the rate of increase in circulating IRL concentrations with the BMI was higher in LC patients of both genders. Liver may play a role in determining circulating leptin levels.

Aged↗

PubMed1998

Undifferentiated pancreatic cancer associated with humoral hypercalcemia of malignancy.

We present a case of undifferentiated pancreatic cancer associated with humoral hypercalcemia of malignancy (HHM) in which parathyroid hormone-related protein (PTH-rP) is identified as the causative factor of hypercalcemia. A 61-year-old man was hospitalized with right hypochondralgia. Ultrasound examination and computed tomography demonstrated a large mass in the pancreatic head with liver metastases. Biopsy of the pancreatic tumor demonstrated undifferentiated carcinoma. Serum calcium level and PTH-rP were elevated. Bone scan with technetium-99 demonstrated no accumulation in the bones. Immunohistochemical staining for PTH-rP was weakly positive in the tumor cells. We considered that PTH-rP was the causative factor of HHM in this case from laboratory data and immunohistochemical findings. This rare case was successfully treated with pamidronate disodium, which is a type of bisphosphonate derivative. We compared this case with previously reported cases.

Antineoplastic Agents↗

PubMed1998

Accidental transmission of HCV and treatment with interferon.

Accidental transmission of contagious pathogens, especially hepatitis C virus (HCV), by needlestick or other means as an occupational hazard for medical staff is of concern. We retrospectively analysed cases of work-related accidental injury with pathogens such as hepatitis B virus (HBV), HCV, syphilis and human immunodeficiency virus (HIV) reported to the centres for disease control at 15 hospitals (total 5776 beds) in the Gunma prefecture, Japan, from December 1990 to August 1993 (24.7 months). There were 416 such cases (16.8 cases/month), with an incidence of 0.2-3.5 accidents per month per hospital. Such accidents occurred in 297 (71.2%) nurses, 98 (23.5%) medical doctors, 13 (3%) laboratory technicians, four (1.0%) hospital maintenance workers, one (0.2%) assistant nurse, one secretary and two others. There were 323 (77.6%) injuries caused by needlestick, 42 (10.1%) from suture needles or surgical knife cuts, 17 (4.1%) from blood splatters from patients into the eyes or mouth, 10 (2.4%) from contact with injured skin and 24 (5.8%) simple skin contacts. Of the pathogens, 60.3% were HCV, 22.6% HBV, 5.8% syphilis, 0.7% HIV and 10.6% were of unknown origin. Four cases (1.6%) of HCV infection were found and treated with one or two courses of interferon therapy, and HCV was subsequently cleared. All four patients were cured with interferon therapy. None of the HBV-injured cases resulted in infection, possibly because of prophylaxis with HB immunoglobulin and HB vaccine. No HIV or syphilis infection was contracted. In summary, chronic HCV infection acquired as an occupational hazard can be cured by appropriate treatment, such as with interferon, after early detection of the infection.

Accidents, Occupational↗

PubMed1998

Hepatic hydrothorax in the absence of ascites.

Pleural effusion due to hepatic cirrhosis and ascites is well known, but hepatic hydrothorax in the absence of ascites is a rare complication. We report a case of liver cirrhosis due to hepatitis C virus with a large and recurring pleural effusion that had an apparent abdominal source in the absence of ascites. We review the characteristics and treatment for hepatic hydrothorax in the absence of ascites.

Adult↗

PubMed1998

Attention modulates both primary and second somatosensory cortical activities in humans: a magnetoencephalographic study.

To clarify the role of primary and second somatosensory cortex (SI and SII) in somatosensory discrimination, we recorded somatosensory evoked magnetic fields during a stimulus strength discrimination task. The temporal pattern of cortical activation was analyzed by dipole source model coregistered with magnetic resonance image. Stimulus intensity was represented in SI as early as 20 ms after the stimulus presentation. The later components of SI response (latency 37.7 and 67.9 ms) were enhanced by rarely presented stimuli (stimulus deviancy) during passive and active attention. This supports an early haptic memory mechanism in human primary sensory cortex. Contra- and ipsilateral SII responses followed the SI responses (latency 124.6 and 138.3 ms, respectively) and were enhanced by attention more prominently than the SI responses. Active attention increased SII but not SI activity. These results are consistent with the concept of ventral somatosensory pathway that SI and SII are hierarchically organized for passive and active detection of discrete stimuli.

Adult↗

PubMed1998

Cortical-hippocampal auditory processing identified by magnetoencephalography.

We recorded magnetic and electrical responses simultaneously in an auditory detection task to elucidate the brain areas involved in auditory processing. Target stimuli evoked magnetic fields peaking at approximately the same latency of around about 400 msec (M400) over the anterior temporal, superior temporal, and parietal regions on each hemisphere. Equivalent current dipoles (ECDs) were analyzed with a time-varying multidipole model and superimposed on each subject's magnetic resonance image (MRI). Multiple independent dipoles located in the superior temporal plane, inferior parietal lobe, and mesial temporal region best accounted for the recorded M400 fields. These findings suggest that distributed activity in multiple structures including the mesial temporal, superior temporal, and inferior parietal regions on both hemispheres is engaged during auditory attention and memory updating.

Adult↗