Biomedical subjects

T Matsui

Publications and source records attributed to T Matsui.

At least 523 records · Page 29Linked to original sources

PubMed1994

Distribution of mRNA for CCK-B receptor in the brain of Mastomys natalensis: abundant expression in telencephalic neurons.

The distribution of cholecystokinin B (CCK-B) receptors in the Mastomys brain was studied using Northern blot analysis and in situ hybridization technique. By Northern blot analysis using 32P-labeled cDNA probe, the cortex had the highest hybridization signal of CCK-B receptor mRNA in the brain. The olfactory bulb and hippocampus showed a moderate level of signals. In situ hybridization using 35S-labeled cRNA probes revealed a wide and region-specific distribution of CCK-B receptor mRNA in the telencephalon. Throughout the cerebral cortex, labeled cells were found in all layers, with higher intensities in layers II, V and VI. Pyramidal cells of the layer II of the piriform cortex showed the highest level of signals in the brain. In the hippocampus, most of the pyramidal cells of the Ammon's horn were labeled, although labeled cells were not detected in other layers. Distinct signals were also detected in the various amygdaloid nuclei, caudate-putamen, reticular thalamic nucleus, hypothalamic ventromedial nucleus and inferior colliculus. This distribution pattern may further support the prominent existence of CCK-B receptors in the brain particularly in the telencephalon.

Animals↗

PubMed1994

Alternative splicing generates two distinct transcripts for the Drosophila melanogaster fibroblast growth factor receptor homolog.

We screened Drosophila melanogaster genomic and cDNA libraries by low-stringency hybridization with a probe representing the protein tyrosine kinase (TyK) domain encoded by a human alpha-platelet-derived growth factor receptor-encoding cDNA. The complete sequences of the open reading frames and 3'-untranslated regions (UTR) of some cross-hybridizing clones were identical to the recently published sequence of DFR1, encoding the novel D. melanogaster fibroblast growth factor receptor homology. However, two species of DFR1 cDNAs were isolated that differed with respect to their 5'-UTR. Analysis of the genomic organization revealed that DFR1 is composed of three exons. The entire coding region is contained within the third exon. S1 mapping and RNase-protection assays demonstrated that two distinct DFR1 transcripts possessing either the first or the second exon in combination with the third exon are generated by alternative splicing. This suggests that the transcriptional, as well as posttranscriptional, regulation of fibroblast growth factor receptor (FGFR)-encoding genes during D. melanogaster development is likely to be complex.

Alternative Splicing↗

PubMed1994

Tumorigenicity of poly-L-lactide (PLLA) plates compared with medical-grade polyethylene.

Poly-L-lactide (PLLA) plates, 20 x 10 x 1 mm in size, with flat surfaces, were implanted into 50 young male Wistar rats subcutaneously, and the incidence of tumors for 2 years under specific pathogen-free (SPF) conditions was evaluated. Tumors arose in 22 rats (at the implant sites in 20, and distant from the implantation site in 2). As a control, plates of medical-grade polyethylene of the same shape were implanted into 50 rats. Tumors appeared in 23 of these rats (21 at the sites of the plates, and 2 ectopically). In 30 rats given sham operations, no tumors appeared in the 2 year observation period. Histologically, all the tumors were mesenchymal malignant tumors resembling fibrosarcoma or malignant fibrous histocytoma (MFH) in humans. In 6 of the PLLA tumors and 3 of the PE tumors, bone formation was observed. There was no significant difference between the incidence of tumors caused by PLLA plates and that of tumors caused by medical-grade polyethylene plates. Macroscopically, PLLA plates retained their initial shape for 2 years. Scanning electron microscopy revealed small holes on the surfaces of the plates, and their molecular weight was reduced to 8% of the initial value.

Animals↗

PubMed1994

C-type galactoside-binding lectin from Bothrops jararaca venom: comparison of its structure and function with those of botrocetin.

A Ca(2+)-dependent type (C-type) galactoside-binding lectin was purified from venom of the snake Bothrops jararaca by thiodigalactoside-Sepharose affinity column chromatography. B. jararaca lectin is a disulfide-linked homodimer composed of 14-kDa subunits. The N-terminal 55-residue amino acid sequence was determined and appeared to belong to the animal C-type lectin family. This 55-residue sequence showed 37% identity with botrocetin, an exogenous von Willebrand factor modulator purified from the same venom, and 85% identity with a lectin from rattlesnake (Crotalus atrox) venom. B. jararaca lectin showed Ca(2+)-dependent hemagglutination activity but did not induce platelet aggregation in the presence or absence of Ca2+ and von Willebrand factor and did not inhibit platelet aggregation induced by botrocetin and von Willebrand factor. On the other hand, botrocetin, which also contains a C-type lectin motif in the N-terminal sequence, did not show hemagglutinating activity toward rabbit and human erythrocytes, nor binding activity toward immobilized glycoproteins. These results indicate that at least two structurally similar but functionally distinct proteins, both belonging to the C-type lectin family, are present in the venom of B. jararaca.

Amino Acid Sequence↗

PubMed1994

Effects of protein kinase C activators on Na, K-ATPase activity in rat brain microvessels.

In order to study the possible role of C kinase (PKC) on sodium pump of cerebral vessels, we used diacylglycerol (diC8: sn-1,2-dioctanoylglycerol) and phorbol esters (PMA: phorbol 12-myristate 13-acetate; PDA: phorbol 12,13-diacetate; 4 alpha-P: 4-alpha phorbol) as PKC activators, and examined their effects on Na,K-ATPase activity in rat brain microvessels (MVs). Rats were divided into non-treated (control; n = 9), four-vessel occlusion (4VO; 30-30 minutes ischemia and recirculation, n = 5), and middle cerebral artery occlusion (MCAO, n = 3) groups. MVs were passed through nylon meshes and were obtained by ultracentrifuge at 58000 g. Na,K-ATPase activity in MVs was determined by the phosphomolybdate method. DiC8 enhanced Na,K-ATPase activity at 10(-4) M in the control group, the 4VO group and the contralateral hemispheres of the MCAO group (139% +/- 0.06, 135% +/- 0.2, 133% +/- 0.18, mean +/- SE, p < 0.05, p < 0.01, Wilcoxon rank sum) respectively, but had no effects on MVs in the ipsilateral hemispheres of MCAO group (74% +/- 0.04). This activation by diC8 was inhibited by PKC inhibitors, staurosporine (3 x 10(8) M) and H7 (10(-6) M) in the control MVs. By contrast, PMA suppressed Na, K-ATPase at 10(-5) M in the control group (-25% +/- 0.07), but it tended to activate Na,K-ATPase activity in the ipsilateral hemispheres of the MCAO groups (33% +/- 0.09). PDA and 4 alpha-P did not have any consistent effects at the concentration examined. The cause of difference between the effects of diC8 and PMA is unclear at present, but it may stem from the mode of lipid-membrane interaction in these agents and the difference in the condition of cells as well.

Animals↗

PubMed1994

Temporal profiles of Ca2+/calmodulin-dependent and -independent nitric oxide synthase activity in the rat brain microvessels following cerebral ischemia.

The present study was aimed at determining chronological alterations of Ca2+/calmodulin (CaM)-dependent and -independent nitric oxide synthase (NOS) activities in brain microvessels (MV) isolated from the affected hemisphere following an occlusion of the middle cerebral artery (MCAo) in rats. It was shown that significant enhancements of Ca2+/CaM-independent NOS activity to 922% and 920% of control level were manifested at 4 h and 24 h, respectively, which returned to the control level at 48 h after MCAo. Regarding Ca2+/CaM-dependent NOS, on the other hand, it was shown that the activity was invariably increased to 374% and 743% of control level at 48 h and 1 week following MCAo, respectively. Thus, the present study provided the first evidence that two distinct types of NOS activities were increased with different temporal patterns after MCAo. These heterogeneous alterations of NOS activities may be of critical importance for the induction of brain damage following cerebral ischemia.

Amino Acid Oxidoreductases↗

PubMed1994

Idiopathic peripheral neuropathy in a horse with knuckling.

We report the pathological findings of the skeletal muscle and peripheral nerves from a male 14-months-old thoroughbred horse showing idiopathic knuckling. The affected animal, when in staining position, presented knuckling at the fetlock joint of both forelegs, and dragged both fore- and hindlegs when attempting forward movement. The skeletal muscles demonstrated neurogenic atrophy characterized by the scattering of single angular fibers, groups consisting of five to ten angular fibers, and multiple fascicles of atrophic and hypertrophic fibers. The severity of changes tended to be a distal gradient. While there was no evidence of fiber loss on light microscopy, a diffuse scattering of myelin ovoid, Wallerian-like degeneration and onion-bulb formations were observed in almost all peripheral nerves collected. The characteristic features in electron microscope were swollen axons, which contained accumulations of organelles, especially degenerative mitochondria and neurofilamanets. Onion-bulb formations were frequently found and were associated with Schwann cell processes and occasional collagen pockets. Other prominent feature were Büngner bands which contained myelin debris and regenerating axons or sprouts. These findings suggested that the nature of this disease was a disturbance in axonal transport and were indicative of a distal axonopathy.

Animals↗

PubMed1994

The effect of Nicorandil on chronic cerebral vasospasm.

The present study is aimed at examining the therapeutic effect of Nicorandil on chronic vasospasm using beagle dogs subjected to a "two-haemorrhage" insult, as well as its dilatory effect on the PDA [phorbol-12,13 diacetate]-induced contraction of the canine basilar artery. 1. A total of 12 animals of either sex, weighing 7 to 12 kg, were assigned into saline control and Nicorandil-treated groups. Immediately after the second induction of subarachnoid haemorrhage (SAH), animals started to receive the agent via the venous route at the constant rate of 10 micrograms/kg/minute for six hours (day 3). On days 4, 5, and 6, the drug was given twice at the same rate for three hours. After the final angiograms, animals were sacrificed by exsanguination. 2. Using ring specimen of the canine basilar artery at a resting tension of 3 g, isometric tension was monitored to examine the effect of Nicorandil on PDA induced contraction. Nicorandil significantly ameliorated chronic vasospasm and inhibited PDA-induced contraction in a dose-dependent fashion. The present data indicate that Nicorandil provides a useful way of treating chronic vasospasm after SAH.

Animals↗

PubMed1994

Plasma cell leukemia with myelofibrosis.

We describe a case of plasma cell leukemia associated with myelofibrosis. A 60-year-old woman was admitted due to lumbago and monoclonal hypergammaglobulinemia. Peripheral blood showed about 40% of plasma-cell-like cells. A bone marrow aspiration was dry tap. The patient was diagnosed as having plasma cell leukemia with myelofibrosis by bone marrow biopsy. Plasma cell leukemia as well as myelofibrosis improved with combination chemotherapy using vincristine, pirarubicin, and dexamethasone. However, when plasma cell leukemia became resistant to chemotherapies, myelofibrosis also reappeared. This case strongly suggests the pathogenetic relationship between plasma cell leukemia and myelofibrosis.

Antineoplastic Combined Chemotherapy Protocols↗

PubMed1994

Gastrin receptor genes are expressed in gastric parietal and enterochromaffin-like cells of Mastomys natalensis.

Although gastric enterochromaffin-like (ECL) carcinoid tumors are known to develop in patients with long-standing hypergastrinemia, the expression of the gastrin receptor gene in ECL cells has not yet been demonstrated. Therefore, this study was designed to examine gastrin receptor gene expression in ECL cells. Mastomys gastric mucosal cells isolated by enzyme dispersion were separated into 10 fractions (F1-10) by centrifugal elutriation. Each fraction was examined histologically to determine whether they contained ECL and/or parietal cells and Northern blot analysis was used to confirm the presence of histidine decarboxylase and H+, K(+)-ATPase gene expression. ECL cells were found only in fractions 1 and 2, whereas parietal cells were detected in fractions 6-10. Gastrin receptor gene expression was demonstrated in both parietal cell-rich and ECL cell-rich fractions. In addition, the gastrin receptor cDNA sequences obtained from the two of the fractions (F1 and 8) were identical. These results suggest that gastrin receptor genes are expressed in ECL cells as well as in parietal cells and that these receptors are identical.

Animals↗

PubMed1994

Clinical course and long-term prognosis of Crohn's disease in Japan.

The long-term outcome of Crohn's disease was reviewed in 74 patients who had a history of more than 10 years (range 10.8-27.3) since disease onset. The observation period was between 4.3 and 18.5 years, the mean and SD being 10.6 +/- 3.1 years. The means and SD of age at onset and final observation were 21 +/- 7 and 37 +/- 8 years, respectively. Fifty-eight of the 74 patients had not undergone bowel resection at the time of diagnosis; of these 58, 31 (53.4%) had an operation for the disease during the follow-up period. Thus, of the 74 patients, 47 (63.5%) (these 31, plus the 16 who had undergone bowel resection at the time of diagnosis) had an operation at least once during a follow-up period of 10 years or more. The cumulative operation rates 5, 10, and 15 years after onset in the 74 and 58 patients above were 18.9%, 6.9%, and 40.8%, and 34.8%, 49.1%, and 46.0%, respectively. The corresponding figures 5 and 10 years after diagnosis in all 74 patients and the 58 patients were 32.3% and 28.6% and 47.3% and 46.3%, respectively. There were no significant differences in the incidence of operation rate in relation to anatomical involvement. Cumulative reoperation rates 1, 3, 5, and 10 years after the first operation in the 31 patients who were operated on during the follow-up period were 3.4%, 6.9%, 25.5%, and 51.7%, respectively. Three patients died, the causes of death in one being directly related to Crohn's disease.(ABSTRACT TRUNCATED AT 250 WORDS)

Adolescent↗

PubMed1994

Poisoning by the red alga 'ogonori' (Gracilaria verrucosa) on the Nojima Coast, Yokohama, Kanagawa Prefecture, Japan.

A food poisoning case due to the ingestion of 'ogonori', an edible red alga, occurred at Yokohama, Kanagawa Prefecture, Japan, in late October 1993, resulting in two victims, including one death (female). No causative agent present in the ogonori was found from a routine bioassay for marine toxins. From the production of increased amounts of prostaglandins (PGs), mainly PGE2, by the alga on stimulation by cutting or soaking in fresh water, and further increase of PGE2 by addition of arachidonic acid, it appeared that an enzyme, probably fatty acid cyclooxygenase, in the ogonori and the body of the victim, was acting on the highly unsaturated fatty acids in the oil of the ingested seafood and in the blood hemorrhaged from the stomach of the victim. This resulted in the production of over 30 mg of PGE2 and small amounts of other PGs in a comparatively short time. With this dosage the victim suffered from nausea, vomiting, and hypotension, and died of hypotensive shock. PGE2 seems to work more selectively on females. This type of poisoning is very unusual, and differs from the more familiar forms of poisoning occurring after ingestion of marine organisms.

Animals↗

PubMed1994

Lysis of autologous tumor cells by large granular lymphocytes in patients with acute leukemia in complete remission: correlation between lytic activity and clinical outcome.

In order to evaluate the effect of specific immune response on prognosis in acute leukemia, we investigated the correlation between the lysis of autologous tumor cells (ATC) by lymphocytes and prognosis. Peripheral mononuclear cells (PMC) from most patients with acute leukemia in complete remission (CR) do not exhibit cytotoxic activity against fresh-frozen ATC, although they have adequate cytotoxic activity against K562 cells. When the large granular lymphocyte (LGL) fraction was used in this study, we observed lysis of ATC in 17 (43.6%) of 39 patients with acute leukemia (12 (42.9%) of the 28 patients with acute myelogenous leukemia (AML) and 5 (45.5%) of the 11 patients with acute lymphocytic leukemia (ALL)). With regard to prognosis, the lytic activity of the LGL fraction did not reflect the duration of CR. The median CR duration in AML patients was 13 months for the lysis-positive group and 11 months for the lysis-negative group. No significant correlation was also found between lytic activity of the LGL fraction and overall survival in each patient. However, the lysis-positive group tended to have a longer survival, the median overall survival being 48 months for the lysis-positive group vs 12 months for the lysis-negative group. The prolonging of overall survival in the lysis-positive group was attributed to a high rate of induction of second remissions in this group. Long-term patient survival in the two groups did not differ.

Adolescent↗

PubMed1994

Putative bovine B cell lineage tumor in sporadic bovine leukosis.

Two calves (C924 and C928) clinically identified as suffering from the calf type of sporadic bovine leukosis (SBL) were examined for immunophenotypical distribution of their peripheral blood lymphocytes (PBL) with T cell or B cell specific monoclonal antibodies (mAbs). Flow cytometric profile analysis indicated that both calves possessed a high population of MHC class II positive cells and a low population carrying T cell associated markers. More than 93% of the PBL of C928 were positive for MHC class II and BoCD5, but were not IgM positive, indicating that clonal tumor cells (MHC-II+, BoCD5+ and IgM-) accounted for most of the PBL of C928. A tumor cell line, BLC3, established from calf C924 in nude mice was examined for immunophenotype, DNA rearrangement of immunoglobulin (Ig) genes and expression of cellular oncogenes c-abl, c-myc and c-myb. BLC3 showed a characteristic profile, being MHC class I and MHC class II positive, but without T cell associated markers. Although the rearranged configuration in the Ig loci was not clearly found in Southern blot analysis using sheep Ig probes, steady-state levels of c-myb transcripts were detected in tumor cell line BLC3 by Northern blot hybridization. Taken together, our data show that the calf type of SBL found in these two calves is induced by immature pre-B cells, including tumor cell line BLC3 established in nude mice.

Animals↗

PubMed1994

Differentiation analysis of bovine T-lymphosarcoma.

The tumor cells from three different types (calf, skin and thymic) of bovine lymphosarcoma identified as sporadic bovine leukosis (SBL) were transplanted to nude mice and established as lymphoid tumor lines. To clarify the T-cell lineage, clonality and differentiation stage, these cell lines were examined for the immunophenotypic profile, the expression and the gene rearrangement of T-cell receptor (TCR) genes. The tumor cells from all three types showed alpha-naphthyl acetate esterase-positive staining and the absence of surface immunoglobulin (sIg). Moreover, the tumor cells appeared to be all BoCD5+ BoCD6+ BoCD4- BoCD8- cells in the FACS analysis with mAbs. Rearrangement of TCR-beta and -delta, but not of TCR-alpha and -gamma, genes was found to be unique for each tumor line showing T-cell clonality. Mature or truncated TCR-beta, -gamma and -delta transcripts were detected in the tumor cells, but all of them were found to be non-functional in cDNA cloning analysis. These results suggested that tumor cells from SBL are immature double-negative T-cells expressing non-functional TCR gamma delta transcripts to somewhat differentiated degrees.

Amino Acid Sequence↗

PubMed1994

Intestinal lymphangiectasia: value of double-contrast radiographic study.

Intestinal lymphangiectasia is a disorder presenting as enteric protein loss through the dilated lymphatics without mucosal ulceration. To determine the double-contrast radiographic features and to assess the significance of them, five patients with intestinal lymphangiectasia were examined using single- and double-contrast small intestinal studies. The double-contrast examinations demonstrated clearly the main radiographic findings of smooth nodular protrusions, thickening of the mucosal folds, with no evidence of mucosal ulceration. Compared with the single-contrast study, smooth nodular protrusions were seen more often and in more widespread segments, particularly in the duodenum, on double-contrast study. Thickening of the mucosal folds was revealed similarly by both methods. Double-contrast study appears to be worthwhile to demonstrate the characteristic radiographic findings of this disease.

Adolescent↗

PubMed1994

Candidiasis caused by Candida glabrata in the forestomachs of a calf.

A female Japanese black calf suffering from diarrhoea was treated with six different antibiotics for 9 days. The diarrhoea worsened and the calf was killed when 17 days old. At necropsy, the mucosal surface of the forestomachs showed diffuse haemorrhagic necrosis and pseudomembrane formation. Candida glabrata infection was diagnosed histologically, immunohistochemically, and by isolation and examination of the yeast. The intensive antibiotic treatment was considered to have been a predisposing or exacerbating factor. This is the first report of C. glabrata infection of the bovine forestomachs.

Animals↗

PubMed1994

Restriction enzyme-resistant high molecular weight telomeric DNA fragments in tobacco.

Restriction endonuclease-resistant high-molecular-weight (HMW) DNA fragments were isolated from nuclear DNA fragments in tobacco. The size of the fragments produced by EcoRI, HindIII, AfaI, and HaeIII ranged from 20 kb to over 166 kb. The kinetics of digestion by Bal31 nuclease showed that most of the HMW fragments are chromosome ends. The consensus sequence for tobacco telomere repeats was determined to be CCCTAAA by genomic sequencing using the HMW fragments and by sequencing after cloning. Besides the telomere sequence, 9 tandem repeats of a 45-bp sequence were identified, in which a 35-bp unit sequence (AGTCAGCATTAGGGTTTTAAACCCTAAACTGAACT) formed a stem structure. The front of the stem is composed of a palindrome of the telomere repeats. This highly conserved unit is surrounded by less conserved internal sequences that are around 10-11 bp in size and contain a TTTT stretch. The internal sequences resemble the 10-11 bp consensus for the scaffold attachment regions found in yeast and drosophila. The characteristic 45-bp sequence was abundant on the ends of chromosomes. The shortest distance between the repeats containing telomeric stem and the telomere was less than 20 kb. This architecture of the tobacco chromosome end region resembles the end region of yeast chromosomes in which autonomous replication sequences are present frequently.

Base Sequence↗