Search PubMed⌕ Search

Biomedical subjects

T Ma

Publications and source records attributed to T Ma.

At least 55 records · Page 3Linked to original sources
PubMed2000

Skeletal muscle function and water permeability in aquaporin-4 deficient mice.

It has been proposed that aquaporin-4 (AQP4), a water channel expressed at the plasmalemma of skeletal muscle cells, is important in normal muscle physiology and in the pathophysiology of Duchenne's muscular dystrophy. To test this hypothesis, muscle water permeability and function were compared in wild-type and AQP4 knockout mice. Immunofluorescence and freeze-fracture electron microscopy showed AQP4 protein expression in plasmalemma of fast-twitch skeletal muscle fibers of wild-type mice. Osmotic water permeability was measured in microdissected muscle fibers from the extensor digitorum longus (EDL) and fractionated membrane vesicles from EDL homogenates. With the use of spatial-filtering microscopy to measure osmotically induced volume changes in EDL fibers, half times (t(1/2)) for osmotic equilibration (7.5-8.5 s) were not affected by AQP4 deletion. Stopped-flow light-scattering measurements of osmotically induced volume changes in plasmalemma vesicles also showed no significant differences in water permeability. Similar water permeability, yet approximately 90% decreased AQP4 protein expression was found in EDL from mdx mice that lack dystrophin. Skeletal muscle function was measured by force generation in isolated EDL, treadmill performance time, and in vivo muscle swelling in response to water intoxication. No differences were found in EDL force generation after electrical stimulation [42 +/- 2 (wild-type) vs. 41 +/- 2 (knockout) g/s], treadmill performance time (22 vs. 26 min; 29 m/min, 13 degrees incline), or muscle swelling (2.8 vs. 2.9% increased water content at 90 min after intraperitoneal water infusion). Together these results provide evidence against a significant role of AQP4 in skeletal muscle physiology in mice.

Animals↗
PubMed2000

Role of aquaporin water channels in pleural fluid dynamics.

Continuous movement of fluid into and out of the pleural compartment occurs in normal chest physiology and in pathophysiological conditions associated with pleural effusions. RT-PCR screening and immunostaining revealed expression of water channel aquaporin-1 (AQP1) in microvascular endothelia near the visceral and parietal pleura and in mesothelial cells in visceral pleura. Comparative physiological measurements were done on wild-type vs. AQP1 null mice. Osmotically driven water transport was measured in anesthetized, mechanically ventilated mice from the kinetics of pleural fluid osmolality after instillation of 0.25 ml of hypertonic or hypotonic fluid into the pleural space. Osmotic equilibration of pleural fluid was rapid in wild-type mice (50% equilibration in <2 min) and remarkably slowed by greater than fourfold in AQP1 null mice. Small amounts of AQP3 transcript were also detected in pleura by RT-PCR, but osmotic water transport was not decreased in AQP3 null mice. In spontaneously breathing mice, the clearance of isosmolar saline instilled in the pleural space ( approximately 4 ml. kg(-1). h(-1)) was not affected by AQP1 deletion. In a fluid overload model produced by intraperitoneal saline administration and renal artery ligation, the accumulation of pleural fluid (approximately 0.035 ml/h) and was not affected by AQP1 deletion. Finally, in a thiourea toxicity model of acute endothelial injury causing pleural effusions and lung interstitial edema, pleural fluid accumulation in the first 3 h ( approximately 4 ml. kg(-1). h(-1)) was not affected by AQP1 deletion. These results indicate rapid osmotic equilibration across the pleural surface that is facilitated by AQP1 water channels. However, AQP1 does not appear to play a role in clinically relevant mechanisms of pleural fluid accumulation or clearance.

Animals↗
PubMed2000

Gastric acid secretion in aquaporin-4 knockout mice.

The aquaporin-4 (AQP4) water channel has been proposed to play a role in gastric acid secretion. Immunocytochemistry using anti-AQP4 antibodies showed strong AQP4 protein expression at the basolateral membrane of gastric parietal cells in wild-type (+/+) mice. AQP4 involvement in gastric acid secretion was studied using transgenic null (-/-) mice deficient in AQP4 protein. -/- Mice had grossly normal growth and appearance and showed no differences in gastric morphology by light microscopy. Gastric acid secretion was measured in anesthetized mice in which the stomach was luminally perfused (0. 3 ml/min) with 0.9% NaCl containing [(14)C]polyethylene glycol ([(14)C]PEG) as a volume marker. Collected effluent was assayed for titratable acid content and [(14)C]PEG radioactivity. After 45-min baseline perfusion, acid secretion was stimulated by pentagastrin (200 microg. kg(-1). h(-1) iv) for 1 h or histamine (0.23 mg/kg iv) + intraluminal carbachol (20 mg/l). Baseline gastric acid secretion (means +/- SE, n = 25) was 0.06 +/- 0.03 and 0.03 +/- 0.02 microeq/15 min in +/+ and -/- mice, respectively. Pentagastrin-stimulated acid secretion was 0.59 +/- 0.14 and 0.70 +/- 0.15 microeq/15 min in +/+ and -/- mice, respectively. Histamine plus carbachol-stimulated acid secretion was 7.0 +/- 1.9 and 8.0 +/- 1.8 microeq/15 min in +/+ and -/- mice, respectively. In addition, AQP4 deletion did not affect gastric fluid secretion, gastric pH, or fasting serum gastrin concentrations. These results provide direct evidence against a role of AQP4 in gastric acid secretion.

Animals↗
PubMed2000

Colon water transport in transgenic mice lacking aquaporin-4 water channels.

Transgenic null mice were used to test the hypothesis that water channel aquaporin-4 (AQP4) is involved in colon water transport and fecal dehydration. AQP4 was immunolocalized to the basolateral membrane of colonic surface epithelium of wild-type (+/+) mice and was absent in AQP4 null (-/-) mice. The transepithelial osmotic water permeability coefficient (P(f)) of in vivo perfused colon of +/+ mice, measured using the volume marker (14)C-labeled polyethylene glycol, was 0.016 +/- 0.002 cm/s. P(f) of proximal colon was greater than that of distal colon (0.020 +/- 0.004 vs. 0. 009 +/- 0.003 cm/s, P < 0.01). P(f) was significantly lower in -/- mice when measured in full-length colon (0.009 +/- 0.002 cm/s, P < 0. 05) and proximal colon (0.013 +/- 0.002 cm/s, P < 0.05) but not in distal colon. There was no difference in water content of cecal stool from +/+ vs. -/- mice (0.80 +/- 0.01 vs. 0.81 +/- 0.01), but there was a slightly higher water content in defecated stool from -/- mice (0.68 +/- 0.01 vs. 0.65 +/- 0.01, P < 0.05). Despite the differences in water permeability with AQP4 deletion, theophylline-induced secretion was not impaired (50 +/- 9 vs. 51 +/- 8 microl. min(-1). g(-1)). These results provide evidence that transcellular water transport through AQP4 water channels in colonic epithelium facilitates transepithelial osmotic water permeability but has little or no effect on colonic fluid secretion or fecal dehydration.

Animals↗
PubMed2000

Aquaporin-4 is expressed in basolateral membranes of proximal tubule S3 segments in mouse kidney.

Because of the availability of knockout mouse models to examine renal transport mechanisms, it has become increasingly important to describe the cellular distribution of major renal transporters in mice. We have used immunocytochemistry and freeze-fracture electron microscopy to compare the renal distribution of aquaporin-4 (AQP4) with that previously described in rat. In rat kidney AQP4 is present exclusively in basolateral membranes of collecting duct principal cells. In mice, however, AQP4 was also detected by immunocytochemistry in basolateral membranes of proximal tubule S3 segments, and not detected in S1 and S2 segments of proximal tubule. Freeze-fracture electron microscopy revealed orthogonal arrays of intramembrane particles (OAPs) on the basolateral membranes of the S3 segment. In AQP4-knockout mice, immunostaining was absent and OAPs were found neither in collecting ducts nor in the S3 segment of the proximal tubule. The urinary concentrating capacity after deletion of both AQP1 and AQP4 was further reduced compared with that of AQP1 or AQP4 null mice, suggesting an additive effect of AQP1 and AQP4 in the concentrating mechanism. The functional significance of the apparent species-dependent expression of AQP4 in proximal tubules is unknown, but may relate to physiological differences between rats and mice.

Animals↗
PubMed2000

Requirement of aquaporin-1 for NaCl-driven water transport across descending vasa recta.

Deletion of AQP1 in mice results in diminished urinary concentrating ability, possibly related to reduced NaCl- and urea gradient-driven water transport across the outer medullary descending vasa recta (OMDVR). To quantify the role of AQP1 in OMDVR water transport, we measured osmotically driven water permeability in vitro in microperfused OMDVR from wild-type, AQP1 heterozygous, and AQP1 knockout mice. OMDVR diameters in AQP1(-/-) mice were 1.9-fold greater than in AQP1(+/+) mice. Osmotic water permeability (P(f)) in response to a 200 mM NaCl gradient (bath > lumen) was reduced about 2-fold in AQP1(+/-) mice and by more than 50-fold in AQP1(-/-) mice. P(f) increased from 1015 to 2527 microm/s in AQP1(+/+) mice and from 22 to 1104 microm/s in AQP1(-/-) mice when a raffinose rather than an NaCl gradient was used. This information, together with p-chloromercuribenzenesulfonate inhibition measurements, suggests that nearly all NaCl-driven water transport occurs by a transcellular route through AQP1, whereas raffinose-driven water transport also involves a parallel, AQP1-independent, mercurial-insensitive pathway. Interestingly, urea was also able to drive water movement across the AQP1-independent pathway. Diffusional permeabilities to small hydrophilic solutes were comparable in AQP1(+/+) and AQP1(-/-) mice but higher than those previously measured in rats. In a mathematical model of the medullary microcirculation, deletion of AQP1 resulted in diminished concentrating ability due to enhancement of medullary blood flow, partially accounting for the observed urine-concentrating defect.

4-Chloromercuribenzenesulfonate↗
PubMed2000

Lung fluid transport in aquaporin-5 knockout mice.

The mammalian lung expresses water channel aquaporin-1 (AQP1) in microvascular endothelia, AQP4 in airway epithelia, and AQP5 at the apical plasma membrane in type I cells of alveolar epithelia. We previously studied the role of AQP1 and AQP4 in lung fluid transport using knockout mice. Here, we examined the role of AQP5 using AQP5 knockout mice, which were recently shown to manifest defective saliva secretion. AQP5 deletion did not affect lung morphology at the light microscopic level, nor did it affect the distribution or expression of aquaporins 1, 3, or 4. Airspace-capillary osmotic water permeability (P(f)) was measured in isolated perfused lungs by pleural surface fluorescence and gravimetric methods. P(f) was reduced 10-fold by AQP5 deletion and was further reduced by 2- to 3-fold in AQP1/AQP5 double-knockout mice. Hydrostatic lung edema in response to acute increases in pulmonary artery pressure was not affected by AQP5 deletion. Active alveolar fluid absorption was measured in an in situ lung model from the increase in concentration of a volume marker in an isosmolar alveolar instillate. Interestingly, fluid absorption did not differ in litter-matched AQP5 knockout mice, nor was there an effect of AQP5 deletion when fluid absorption was maximally stimulated by pretreatment of mice with keratinocyte growth factor. These results indicate that AQP5 is responsible for the majority of water transport across the apical membrane of type I alveolar epithelial cells. The unimpaired alveolar fluid clearance in AQP5-null mice indicates that high alveolar water permeability is not required for active, near-isosmolar fluid transport.

Animals↗
PubMed2000

A novel glucocorticoid receptor binding element within the murine c-myc promoter.

In the course of analyzing the murine c-myc promoter response to glucocorticoid, we have identified a novel glucocorticoid response element that does not conform to the consensus glucocorticoid receptor-binding sequence. This c-myc promoter element has the sequence CAGGGTACATGGCGTATGTGTG, which has very little sequence similarity to any known response element. Glucocorticoids activate c-myc/reporter constructs that contain this element. Deletion of these sequences from the c-myc promoter increases basal activity of the promoter and blocks glucocorticoid induction. Insertion of this element into SV40/reporters inhibits basal reporter gene activity in the absence of glucocorticoids. Glucocorticoids stimulate activity of reporters that contain this element. Recombinant glucocorticoid receptor binds to this element in vitro. An unidentified cellular repressor also binds to this element. The activated glucocorticoid receptor displaces this protein(s). We conclude that the glucocorticoid receptor binds to the c-myc promoter in competition with this protein, which is a repressor of transcription. To our knowledge, no glucocorticoid response element with such properties has ever been reported.

Animals↗
PubMed2000

Expression of endothelin-1, and endothelin A and B receptors in portal hypertensive esophagus of rats.

Nitric oxide synthase is overexpressed in the portal hypertensive (PHT) esophagus, suggesting that expression of other vasoactive mediatora could also be affected. Therefore, in the present study we determined the expression of endothelin-1 (ET-1) and endothelin receptors, which could contribute to the regulation of the vascular tone in PHT esophagus. In esophageal specimens of PHT and sham operated rats, expression of ET-1 and its receptors A and B (ET(A)R and ET(B)R) mRNAs was studied by reverse transcription-polymerase chain reactions. ET-1 protein expression was assessed by immunostaining and enzyme immunoassay. In PHT esophagus, expression of ET-1, ET(A)R and ET(B)R mRNAs was significantly increased by 2.2-, 2.5- and 1.5-fold, respectively, compared with sham operated. The ET-1 protein was significantly increased by 2.2-fold vs. controls as measured by enzyme immunoassay. ET-1 protein was predominantly localized to endothelia of submucosal veins. Thus, portal hypertension induces over-expression of ET-1 in endothelia of esophageal submucosal vessels. Since ET-1 and its receptors could promote vascular proliferation and induce mucosal damage, the overexpressed ET-1 may play an important role in the development and rupture of esophageal varices in portal hypertension.

Animals↗
PubMed2000

[Evaluation of several biological markers in the prognosis of patients with node-negative breast cancer].

OBJECTIVE: To evaluate the practical significance of microvessel count (MVC), c-erbB-2, CD44, cathepsin D and nm23 expression, and clinico-pathological parameters in the prognosis of node-negative breast cancer. METHODS: Sixty two patients with node-negative invasive breast cancer were treated by surgery alone, and followed-up for at least 10 years. Microvessel count (MVC), C-erbB-2, CD44, Cathepsin D and nm23 expression were studied by immunohistochemical technique. With other clinico-pathological parameters, they were evaluated prognostically. RESULTS: Univariate analysis showed that the prognostic factors influencing 10-year overall survival rate were MVC, C-erbB-2, stromal cell cath-D and CD44 expression. Multivariate analysis demonstrated that MVC was the sole independent prognostic factor determining 10-year survival. CONCLUSION: Although MVC, c-erbB-2, stromal cell cath-D and CD44 expression are all of prognostic significance, MVC is most meaningful in evaluating prognosis of node-negative breast cancer patients.

Adult↗
PubMed2000

[Endometrial stromal sarcoma with multi-differentiation: a study of 17 cases].

OBJECTIVE: To investigate the clinical and pathomorphological features of multi-differentiated endometrial stromal sarcoma of the uterus and to discuss their behaviour and differential diagnosis. METHODS: The histological characteristics of all cases were observed by pathological examination, some of them have been studied by immunohistochemical and/or ultrastructural techniques. RESULTS: Multi-differentiation was present in 13 cases of low grade and 4 cases of high grade endometrial stromal sarcoma, of which, 13 cases had sex-cord differentiation, 10 cases had smooth muscle differentiation, osseous differentiation in 2 cases and striated muscle differentiation in 1 case. Two types of multi-differentiation was present in 9 cases. CONCLUSIONS: Both low-grade and high-grade endometrial stromal sarcoma of uterus can display multi-differentiation. Sex-cord and smooth muscle differentiation are the most common types. Osseous and striated muscle differentiation are very rare. There is no definite correlation between prognosis and the amount or types of multi-differentiation components.

Adult↗
PubMed1999

Activation of protein kinase C by phorbol dibutyrate modulates GABAA receptor binding in rat brain slices.

Effects of protein kinase C (PKC) activation on the function of the GABA/benzodiazepine receptor-chloride complex were analyzed by quantitative autoradiography using [3H]muscimol, [3H]flunitrazepam and [35S]TBPS in rat brain slices. The density of [3H]muscimol binding was highest in cerebellar granular layers and high in both the frontal cortex and thalamus, but binding levels in the hippocampus were low. After activation of PKC by 100 nM phorbol-12,13-dibutyrate (PDBu), [3H]muscimol binding was decreased in the frontal cortex, striatum and thalamus, but binding levels were not changed in the hippocampus or cerebellum. The density of [3H]flunitrazepam binding was high in the cortex, hippocampus and molecular layers of cerebellum but was low in thalamus. PDBu increased the [3H]flunitrazepam binding only in the striatum and in part of the cortex and thalamus after activation of PKC. After activation of PKC by PDBu [35S]TBPS binding was increased in most areas, but binding levels were not changed in the brainstem or cerebellum. The receptor binding was markedly decreased in almost all areas by the addition of 2.5 mM Mg2+. Elevated [35S]TBPS binding produced by PDBu was significantly inhibited by the addition of Mg2+. These results suggest that the activation of PKC potentiates benzodiazepine and TBPS binding, but decreases muscimol binding in a region-specific manner in the rat brain.

Animals↗
PubMed1999

Defective secretion of saliva in transgenic mice lacking aquaporin-5 water channels.

Aquaporin-5 (AQP5) is a water-selective transporting protein expressed in epithelial cells of serous acini in salivary gland. We generated AQP5 null mice by targeted gene disruption. The genotype distribution from intercross of founder AQP5 heterozygous mice was 70:69:29 wild-type:heterozygote:knockout, indicating impaired prenatal survival of the null mice. The knockout mice had grossly normal appearance, but grew approximately 20% slower than litter-matched wild-type mice when placed on solid food after weaning. Pilocarpine-stimulated saliva production was reduced by more than 60% in AQP5 knockout mice. Compared with the saliva from wild-type mice, the saliva from knockout mice was hypertonic (420 mosM) and dramatically more viscous. Amylase and protein secretion, functions of salivary mucous cells, were not affected by AQP5 deletion. Water channels AQP1 and AQP4 have also been localized to salivary gland; however, pilocarpine stimulation studies showed no defect in the volume or composition of saliva in AQP1 and AQP4 knockout mice. These results implicate a key role for AQP5 in saliva fluid secretion and provide direct evidence that high epithelial cell membrane water permeability is required for active, near-isosmolar fluid transport.

Amino Acid Sequence↗
PubMed1999

Aquaporin water channels in gastrointestinal physiology.

Fluid transport is a major function of the gastrointestinal (GI) tract with more than 9 litres of fluid being absorbed or secreted across epithelia in human salivary gland, stomach, the hepatobiliary tract, pancreas, small intestine and colon. This review evaluates the evidence that aquaporin-type water channels are involved in GI fluid transport. The aquaporins are a family of small ( approximately 30 kDa) integral membrane proteins that function as water channels. At least seven aquaporins are expressed in various tissues in the GI tract: AQP1 in intrahepatic cholangiocytes, AQP4 in gastric parietal cells, AQP3 and AQP4 in colonic surface epithelium, AQP5 in salivary gland, AQP7 in small intestine, AQP8 in liver, pancreas and colon, and AQP9 in liver. There are functional data suggesting that some GI cell types expressing aquaporins have high or regulated water permeability; however, there has been no direct evidence for a role of aquaporins in GI physiology. Recently, transgenic mice have been generated with selective deletions of various aquaporins. Preliminary evaluation of GI function suggests a role for AQP1 in dietary fat processing and AQP4 in colonic fluid absorption. Further study of aquaporin function in the GI tract should provide new insights into normal GI physiology and disease mechanisms, and may yield novel therapies to regulate fluid movement in GI diseases.

Animals↗
PubMed1999

cDNA and genomic cloning of mouse aquaporin-2: functional analysis of an orthologous mutant causing nephrogenic diabetes insipidus.

As the first step in generating a transgenic mouse model of nephrogenic diabetes insipidus (NDI), we have analyzed the mouse aquaporin-2 (Aqp2) cDNA and gene and generated a mutated Aqp2 orthologous to NDI-causing human AQP2-T126M. Aqp2 cDNA was isolated from mouse kidney and encoded a 271-amino-acid protein with 90.4% identity to human AQP2. Expression in Xenopus oocytes indicated that Aqp2 encoded a mercurial-sensitive, water-selective channel. Northern blot analysis showed a single 1.7-kb Aqp2 transcript expressed only in kidney (medulla > cortex); transcript expression was increased approximately 20-fold in 48-h water-deprived mice. Immunoblot analysis revealed a 29-kDa glycoprotein in mouse kidney. Sequence comparison of the Aqp2 cDNA with a 5.5-kb mouse genomic DNA indicated three introns (lengths 2.4, 0.9, and 0.6 kb) separating four exons with boundaries at amino acids 120, 175, and 202. Genomic Southern blot analysis revealed a single-copy Aqp2 gene. The mutant Aqp2-T126M was water permeable when expressed in Xenopus oocytes, but was retained at the endoplasmic reticulum (ER) in transfected mammalian cells. The chemical chaperone glycerol produced a redistribution of Aqp2-T126M from ER to plasma membrane/endosomes. These results establish a basis for an Aqp2-T126M transgenic knock-in model of NDI.

Amino Acid Sequence↗
PubMed1999

Effects of chronic lead (Pb) exposure on neurobehavioral function and dopaminergic neurotransmitter receptors in rats.

Sprague-Dawley rats were maternally and permanently exposed to Pb (1000 ppm in their drinking water as lead acetate). Behavioral functions were examined starting at post-natal day (PN) 84. Lead exposure did not change spatial learning in the radial arm maze, but induced higher locomotor activity as observed in the open-field and in the radial arm maze. Lead treatment did not impact motor coordination. Autoradiographic analysis of brain sections indicated that Pb-exposure did produce a decrease in [125I]sulpride (D2 receptor antagonist) binding in the cerebral cortex, but not in the striatum and thalamus nucleus. No change was found in [125I]SCH-23982 (D1 receptor antagonist) binding. Since the cortical dopaminergic system is critical for cognitive processes and motor behavior, it is possible that Pb-related change in D2 receptors may mediate to it induced hyperlocomotor activity.

Animals↗
PubMed1999

Interaction between cyclin-dependent kinases and human papillomavirus replication-initiation protein E1 is required for efficient viral replication.

We have identified the human papillomavirus (HPV) DNA replication initiation protein E1 as a tight-binding substrate of cyclin E/cyclin-dependent kinase (Cdk) complexes by using expression cloning. E1, a DNA helicase, collaborates with the HPV E2 protein in ori-dependent replication. E1 formed complexes with cyclin E in insect and mammalian cells, independent of Cdks and E2. Additional cyclins, including A-, B-, and F-type (but not D-type), interacted with the E1/E2 complex, and A- and E-type cyclin kinases were capable of phosphorylating E1 and E2 in vitro. Association with cyclins and efficient phosphorylation of E1 required the presence of a cyclin interaction motif (the RXL motif). E1 lacking the RXL motif displayed defects in E2-dependent HPV ori replication in vivo. Consistent with a role for Cdk-mediated phosphorylation in E1 function, an E1 protein lacking all four candidate Cdk phosphorylation sites still associated with E2 and cyclin E but was impaired in HPV replication in vitro and in vivo. Our data reveal a link between cyclin/Cdk function and activation of HPV DNA replication through targeting of Cdk complexes to the E1 replication-initiation protein and suggest a functional role for E1 phosphorylation by Cdks. The use of cyclin-binding RXL motifs is now emerging as a major mechanism by which cyclins are targeted to key substrates.

Cloning, Molecular↗