[Monocytic aleukemic leukemia cutis].
Explore the source record for details and available documents.
Adult↗
Biomedical subjects
T Imanaka
Publications and source records attributed to T Imanaka.
[The first case of Legionella domoffi pneumonia in Japan].
Explore the source record for details and available documents.
Aged↗
[Meningeal leukemia in the chronic stage of chronic myelomonocytic leukemia].
Explore the source record for details and available documents.
Aged↗
Translocation of acyl-CoA oxidase into peroxisomes requires ATP hydrolysis but not a membrane potential.
An efficient system for the import of newly synthesized proteins into highly purified rat liver peroxisomes was reconstituted in vitro. 35S-Labeled acyl-CoA oxidase (AOx) was incorporated into peroxisomes in a proteinase K-resistant fashion. This import was specific (did not occur with mitochondria) and was dependent on temperature, time, and peroxisome concentration. Under optimal conditions approximately 30% of [35S]AOx became proteinase resistant. The import of AOx into peroxisomes could be dissociated into two steps: (a) binding occurred at 0 degrees C in the absence of ATP; (b) translocation occurred only at 26 degrees C and required the hydrolysis of ATP. GTP would not substitute for ATP and translocation was not inhibited by carbonylcyanide-m-chlorophenylhydrazone, valinomycin, or other ionophores.
Acyl-CoA Oxidase↗
Some factors affecting the copy number of specific plasmids in Bacillus species.
Some factors affecting the copy number of specific plasmids in different hosts were presented. A low copy number (one copy per chromosome) Kmr Tcr plasmid pTB19 was isolated from thermophilic bacillus. We have constructed 22 derivatives from pTB19 and their copy numbers range from 1 to 214 per chromosome in B. subtilis and B. stearothermophilus. Some recombinant plasmids containing the specific 1.0-MDa EcoRI fragment exhibited high transformation frequency and low copy number in B. stearothermophilus and were stable in the thermophile; on the other hand, those plasmids were unstable in different host B. subtilis, as mentioned earlier. By selecting the best combination of vector plasmid and host strain, both molecular cloning of various enzyme genes (i.e., penicillinase, thermostable alpha-amylase, and thermostable neutral protease) and enhancement of the enzyme production could be easily achieved.
Bacillus↗
Cloning and nucleotide sequence of the penicillinase antirepressor gene penJ of Bacillus licheniformis.
The penicillinase antirepressor gene, penJ, of Bacillus licheniformis ATCC 9945a was cloned in Escherichia coli by using pMB9 as a vector plasmid. The penicillinase gene, penP, its repressor gene, penI, and penJ were encoded on the cloned 5.2-kilobase HindIII fragment of the recombinant plasmid pTTE71. The penJ open reading frame was composed of 1,803 bases and 601 amino acid residues (molecular weight, 68,388). A Shine-Dalgarno sequence was found 7 bases upstream from the translation start site. Since this sequence was located in the 3'-terminal region of the penI gene, penJ might be transcribed together with penI as a polycistronic mRNA from the penI promoter. Frameshift mutations of penJ were constructed in vitro from pTTE71, and the penJ mutant gene was introduced into B. licheniformis by chromosomal recombination. The transformant B. licheniformis U173 (penP+ penI+ penJ) turned out to be uninducible for penicillinase production, whereas the wild-type strain (penP+ penI+ penJ+) was inducible. Only when these three genes (penP, penI, and PenJ) were simultaneously subcloned in Bacillus subtilis did the plasmid carrier exhibit inducible penicillinase production, as did wild-type B. licheniformis. It was concluded that penJ is involved in the penicillinase induction. The regulation of penP expression by penI and penJ is discussed.
Bacillus↗
Efficient association of in vitro translation products with purified stable Candida tropicalis peroxisomes.
Newly synthesized peroxisomal proteins enter preexisting peroxisomes posttranslationally in vivo, generally without proteolytic processing. An efficient reconstitution of this process in vitro together with cloned DNAs for peroxisomal proteins would make possible investigation of the molecular information that targets proteins to peroxisomes. We have previously reported the isolation of clones for Candida tropicalis peroxisomal proteins; here we describe the association (and possible import) of peroxisomal proteins with peroxisomes in vitro. C. tropicalis was grown in a medium containing Brij 35, resulting in the induction of a moderate number of medium-sized peroxisomes. These peroxisomes, isolated in a sucrose gradient, had a catalase latency of 54% and were sufficiently stable to be concentrated and used in an import assay. The reticulocyte lysate translation products of total RNA from oleate-grown cells were incubated with the peroxisomes at 26 degrees C in the presence of 50 mM KCl, protease inhibitors, 0.5 M sucrose, 2.5 mM MOPS (morpholinepropanesulfonic acid) (pH 7.2), and 0.5 mM EDTA. Ten major translation products (which could be immunoprecipitated with antiserum against peroxisomal protein) became progressively associated with the peroxisomes during the first 30 min of incubation (some up to approximately 70%). These include acyl coenzyme A oxidase and the trifunctional protein hydratase-dehydrogenase-epimerase. This association did not occur at 4 degrees C nor did it occur if the peroxisomes were replaced with mitochondria.
Acyl-CoA Oxidase↗
Complete nucleotide sequences of Bacillus plasmids pUB110dB, pRBH1 and its copy mutants.
The deletion plasmids, pRBH1 (1.5 MDa, kanamycin resistance, Kmr) and pUB110dB (1.5 MDa, Kmr), were obtained from pTB913 (2.9 MDa, Kmr, isolated from a thermophilic bacillus) and pUB110 (3.0 MDa, Kmr, from Staphylococcus aureus), respectively. All the nucleotide sequences of these deletion plasmids were determined. Replication origin regions of pRBH1 and pUB110dB contained, respectively, 63 base-pair inverted repeat and a large open reading frame, encoding RepB protein (235 amino acid residues). The nucleotide sequences were identical to each other except for one base in the center of the inverted repeat. Two copy number mutant plasmids, pRBHC3 and pRBHC7, were obtained from pRBH1. The mutation points were located at different positions in the RepB protein coding region (Gly to Asp for pRBHC3 and Gly to Glu for pRBHC7). RepB protein was shown to be involved in the copy number control of these plasmids.
Bacillus↗
The copy number of Bacillus plasmid pRBH1 is negatively controlled by RepB protein.
The replication control mechanism of Bacillus plasmid pRBH1 was analysed; pRBH1 contains four promoters, P1 to P4, and a large inverted repeat (63 base pairs) upstream of the protein (RepB) coding sequence. The stem and loop structure is surrounded by two promoters, P1 and P3, with different directions of transcription. One base substitution in the loop structure caused a change in copy number. Since the P1 promoter is located upstream of the replication origin of pRBH1, the transcript from the P1 promoter might serve as the primer of DNA replication. In vivo transcription from the P1 promoter was repressed by a trans-acting plasmid gene product. Since the RepB protein is involved in copy number control and RepB contains the consensus amino acid sequence of DNA binding proteins, RepB was thought to be the repressor. It was concluded from these data that the inverted repeat is involved in the control of copy number of the plasmid pRBH1. The RepB protein also contains two regions highly homologous with the Rom protein encoded on Escherichia coli plasmid ColE1. The possible mechanism for the copy number control of the plasmid via RepB protein and/or RNAs is discussed.
Bacillus↗
Complete nucleotide sequence of the low copy number plasmid pRAT11 and replication control by the RepA protein in Bacillus subtilis.
The 2.6 kb kanamycin-resistant (Kmr) plasmid, pRAT11, was constructed using both the replication determinant (repA) region of the 10.8 kb tetracycline-resistant (Tcr) low copy number plasmid pTB52 and another fragment (0.9 kb) that contained solely the Kmr gene of pUB110. The complete nucleotide sequence of this plasmid was determined. The repA region contained a large open reading frame encoding RepA protein (396 amino acid residues). In vitro transcription and translation of the repA gene were confirmed. RepA protein was shown to be indispensable for plasmid replication, and acted in trans on DNA. The part of the repA gene encoding the specific recognition region of the RepA protein was located and contained 3.5 direct repeats of 24 bp (GGTTTCAAAAATGAAACGGTGGAG). Upstream and downstream of the direct repeats were the recognition sequence (TTATCCACA) of the Escherichia coli DnaA protein and an AT-rich region, respectively. The replication control mechanism of the low copy number Bacillus plasmid is discussed.
Amino Acid Sequence↗
Application of recombinant DNA technology to the production of useful biomaterials.
Explore the source record for details and available documents.
Animals↗
Construction of high, intermediate and low-copy-number promoter-probe plasmids for Bacillus subtilis.
We constructed promoter-probe plasmids for Bacillus subtilis based on the promoterless gene for penicillinase (penP) of Bacillus licheniformis. A Bacillus stearothermophilus DNA fragment, which contained translational stop codons for all three reading frames and transcription terminators of the alpha-amylase gene, was inserted upstream from the Shine-Dalgarno sequence for the penP gene. A low-copy-number plasmid (about 10 copies per chromosome), pPF101, carried tetracycline-resistance gene, whereas another high-copy-number plasmid (about 55 copies per chromosome), pPF201, conferred resistance to kanamycin. The intermediate-copy-number plasmids (about 20 copies per chromosome), pPF001, pPF002, pPF011 and pPF012, conferred chloramphenicol resistance to both B. subtilis and Escherichia coli. Vector plasmids, pPF011 and pPF012, were provided with single cloning sites for BamHI, SacI, SmaI and XbaI upstream from the protein coding region of penP, whereas other plasmids contained only unique BamHI cloning sites. The applicability of these plasmids was demonstrated by cloning a promoter for the alpha-amylase gene.
Bacillus subtilis↗
Temperature-dependent plasmid integration into and excision from the chromosome of Bacillus stearothermophilus.
A transformant of Bacillus stearothermophilus carrying a recombinant plasmid, pLP11 (9.5 MDa), on which the penicillinase gene (penP) and kanamycin resistance gene (kan) were located was subjected to mutagenesis, and a mutant plasmid (9.5 MDa; penP kan), designated pTRA117, was obtained. A transformant of B. stearothermophilus carrying pTRA117 could grow at 63 degrees C in medium containing kanamycin, whereas a transformant carrying pLP11 could not. Although pTRA117 was detected as covalently closed circular (ccc) DNA when it was extracted from transformants cultured at 48 degrees C, it was integrated into the host chromosome when the culture temperature was shifted up to 63 degrees C. If the culture temperature was lowered to 48 degrees C from 63 degrees C, a new plasmid (10.7 MDa; penP kan), designated pTRZ117, could be detected as ccc DNA; the size of this plasmid suggested that it was pTRA117 plus a 1.2 MDa DNA fragment of the host chromosome, and this was confirmed by Southern hybridization. pTRZ90 (7.9 MDa; kan) was constructed from pTRZ117 by the deletion of a 2.8 MDa DNA fragment that contained penP. Fresh transformants of B. stearothermophilus that carried either pTRZ117 or pTRZ90 could grow at 65 degrees C.
Chromosomes, Bacterial↗
Nucleotide sequence of the penicillinase repressor gene penI of Bacillus licheniformis and regulation of penP and penI by the repressor.
Bacillus licheniformis penicillinase genes, penP and penI, are coded on a 4.2-kilobase EcoRI fragment of pTTE21 (T. Imanaka, T. Tanaka, H. Tsunekawa, and S. Aiba, J. Bacteriol. 147:776-186, 1981). The EcoRI fragment was subcloned in a low-copy-number plasmid pTB522 in Bacillus subtilis. B. subtilis carrying the recombinant plasmid pPTB60 (Tcr penP+ penI+) was chemically mutagenized. Of about 150,000 colonies, two penI(Ts) mutant plasmids, pPTB60D13 and pPTB60E24, were screened by the plate assay at 30 and 48 degrees C for penicillinase. By constructing recombinant plasmids between wild-type and mutant plasmids, the mutation points were shown to be located in a 1.7-kilobase EcoRI-PstI fragment. The EcoRI-PstI fragments of the wild-type plasmid and two mutant plasmids were sequenced. A large open reading frame, composed of 384 bases and 128 amino acid residues (molecular weight, 14,983), was found. Since the mutation points were located at different positions in the protein coding region (Ala to Val for pPTB60D13 and Pro to Leu for pPTB60E24), the coding region was concluded to be the penI gene. A Shine-Dalgarno sequence was found 7 bases upstream from the translation start site (ATG). A probable promoter sequence which is very similar to the consensus sequence was also found upstream of the penP promoter, but in the opposite direction. A consensus twofold symmetric sequence (AAAGTATTA CATATGTAAGNTTT) which might have been used as a repressor binding region was found downstream and in the midst of the penP promoter and also downstream of the penI promoter. The regulation of penP and penI by the repressor is discussed.
Amino Acid Sequence↗
Positional specificity of lysosomal acid lipase purified from rabbit liver.
The hydrolysis of tri-, di-, and monooleoylglycerols by highly purified lysosomal acid lipase from rabbit liver (Imanaka, T., et al. (1984) J. Biochem. 96, 1089-1101) was examined. The degradative products were separated by thin layer chromatography on silicic acid impregnated with boric acid. Trioleoylglycerol was hydrolyzed with intermediate accumulation of 1,2(2,3)-dioleoylglycerol and 2-monooleoylglycerol, but no detectable production of the 1,3-isomer. 1,2(2,3)-Dioleoylglycerol was also hydrolyzed with the intermediate accumulation of 2-monooleoylglycerol. The 1(3)-isomer of monooleoylglycerol was hydrolyzed exclusively, with no hydrolysis of the 2-isomer. These results indicate that the enzyme shows preference for 1(3)-ester bonds and that the main lipolytic reaction sequence catalyzed is triacylglycerol---1,2(2,3)-diacylglycerol---2-monoacylglycerol.
Animals↗
Effect of phospholipids on the hydrolysis of cholesterol oleate liquid crystals by lysosomal acid lipase.
Cholesterol oleate liquid crystals were prepared in vitro as a model of lipid droplets accumulated in the atheromatous aorta. The hydrolysis of cholesterol oleate crystals by lysosomal acid lipase was examined in the presence and absence of various phospholipids. Phosphatidylserine markedly stimulated the hydrolysis of cholesterol oleate liquid crystals (20 times the basal value); it increased the Vmax value about 15 times and decreased the Km value to 1/20 times the basal value. The polar head group and the acyl chains of phosphatidylserine were required for its stimulation of hydrolysis.
Animals↗
Effect of in vitro DNA rearrangement in the NH2-terminal region of the penicillinase gene from Bacillus licheniformis on the mode of expression in Bacillus subtilis.
We have constructed secretion vector plasmids that have unique BglII sites within or near the signal sequence of Bacillus licheniformis penicillinase, and have also constructed penicillinase cartridges that lack either one, two or three of the processing sites for the membrane-bound, exo-large and exo-small enzymes. Each of these penicillinase cartridges was cloned on secretion vectors in Bacillus subtilis, and enzyme production was examined. The presence of both the signal sequence and the three host-specific processing sites on the secretion vector was required for an effective expression of the enzyme in B. subtilis. The presence of any of the processing sites on the cartridge reduced the accumulation of penicillinase in the culture medium. When a vector plasmid lacking part of the hydrophobic region of the signal sequence and lacking the three processing sites was used, total penicillinase production decreased and enzyme accumulation in the medium was extremely low, despite the complete or incomplete presence of the processing sites on the cartridge. Molecular mass determination of these extracellular penicillinases suggested the existence of a new cleavage site for the enzyme.
Amino Acid Sequence↗
Isolation of streptomycin-nonproducing mutants deficient in biosynthesis of the streptidine moiety or linkage between streptidine 6-phosphate and dihydrostreptose.
Eight streptidine idiotrophic mutants (SD20, SD81, SD141, SD189, SD245, SD261, SD263, and SD274) which required streptidine to produce streptomycin were derived from Streptomyces griseus ATCC 10137 by UV mutagenesis. By both the characterization of intermediates accumulated by the idiotrophs and the assay of enzymes involved in streptidine biosynthesis, the biochemical lesions of the mutants were deduced as follows: SD20 and SD263, transamination; SD81, SD261, and SD274, phosphorylation; SD141, transamidination; SD189, dehydrogenation; SD245, linkage between streptidine 6-phosphate and dihydrostreptose. An accumulation of streptidine 6-phosphate was found in SD245 to impair its aminotransferase activity. This finding suggests that aminotransferase activity might have been negatively controlled by the end product, streptidine 6-phosphate, of the streptidine biosynthetic pathway.
Amidinotransferases↗