Search PubMed⌕ Search

Biomedical subjects

S S Smith

Publications and source records attributed to S S Smith.

At least 109 records · Page 6Linked to original sources
PubMed1992

Psychological modulation of the delayed type hypersensitivity skin test.

Considerable data have demonstrated that psychological states can influence the immune system in animals. Whether human immune function can be intentionally modulated by the central nervous system is unknown. This article presents data from two studies that sought to demonstrate intentional modulation of the immune system by psychological interventions. It also discusses the methodological complexities involved with this type of research in humans.

Adult↗
PubMed1991

GABAB receptor stimulation by baclofen and taurine enhances excitatory amino acid induced phosphatidylinositol turnover in neonatal rat cerebellum.

Excitatory amino acid stimulation of phosphatidylinositol (PI) hydrolysis has been associated with development of the CNS. Normally minimally ineffective in stimulating PI hydrolysis in the neonatal rat cerebellum, N-methyl-D-aspartate (NMDA) increased levels of PI hydrolysis 82.3 +/- 5.5% above basal values in the presence of 1 microM baclofen, a gamma-aminobutyric acidB (GABAB) receptor agonist. This effect was observed at day 7 but not in adult cerebellum. The effect of baclofen could be mimicked by low dose GABA and taurine, actions which were blocked by prior application of a specific GABAB antagonist. Therefore, the ability of NMDA to stimulate PI hydrolysis in neonatal cerebellar tissue may be regulated by the degree of GABAB receptor stimulation.

2-Amino-5-phosphonovalerate↗
PubMed1991

Quadruplex DNA formation in a region of the tRNA gene supF associated with hydrogen peroxide mediated mutations.

A hot spot for H2O2/Fe-mediated mutation has been observed between bases 154 and 170 of the supF gene in the mutation reporter plasmid pZ189 [Moraes et al. (1990) Carcinogenesis 11, 283; Akman et al. (1991) Mutat. Res. (in press)]. To further characterize this hot spot, we synthesized the 33mer d(pAAAGTGATGGTGGTGGGGGAAGGATTCGAACCT) (pZ33), which is complementary to bases 159-191 of the supF gene. pZ33 annealed spontaneously in 10 mM Tris-HCl (pH 8.0)-1 mM EDTA-100 mM NaCl at 50 degrees C into two major forms, one of which migrates more slowly than does d(pT)33 on nondenaturing 12% polyacrylamide gels. We propose that this form is a four-stranded structure stabilized by Hoogsteen-type deoxyguanosine quartets involving all deoxyguanosines of the sequence d-(pGGTGGTGGGGG) because of the following. (1) pZ33 migrates as a single form that comigrates with d(pT)33 on denaturing 20% acrylamide-8 M urea gels. (2) Annealing an equimolar mixture of 5'-32P-labeled pZ33 and the oligodeoxynucleotide d(pTTTTTTTTpZ33TTTTTTTT) (pZ49), as well as 5'-32P-labeled pZ49 and pZ33, caused the formation of four, discreet slowly migrating bands on nondenaturing 12% polyacrylamide gels. Mixing 5'-32P-labeled pZ33 with 5'-32P-labeled pZ49 resulted in five slowly migrating bands. (3) An oligodeoxynucleotide identical with pZ33 except that every deoxyguanosine has been replaced with deoxyinosine did not anneal into a slowly migrating form. (4) Dimethyl sulfate protection studies demonstrated that all deoxyguanosines of the sequence d(pGGTGGTGGGGG) were protected at N-7 in the slowly migrating form but not in single-stranded pZ33. These data suggest that a hot spot for H2O2/Fe-mediated base substitutions is located adjacent to a sequence that can spontaneously adopt a quadruplex structure in which deoxyguanosine quartets are Hoogsteen bonded.

Base Composition↗
PubMed1991

Lack of 5-methylcytosine in Dictyostelium discoideum DNA.

We find no evidence for the presence of 5-methylcytosine in the DNA of Dictyostelium discoideum. Methylation was absent from CCGG sites in repetitive DNA and in DNA from the actin multigene family. Nor was 5-methylcytosine detected in total DNA when base composition was determined by means of h.p.l.c.

5-Methylcytosine↗
PubMed1991

Recognition of unusual DNA structures by human DNA (cytosine-5)methyltransferase.

The symmetry of the responses of the human DNA (cytosine-5)methyltransferase to alternative placements of 5-methylcytosine in model oligodeoxynucleotide duplexes containing unusual structures has been examined. The results of these experiments more clearly define the DNA recognition specificity of the enzyme. A simple three-nucleotide recognition motif within the CG dinucleotide pair can be identified in each enzymatically methylated duplex. The data can be summarized by numbering the four nucleotides in the dinucleotide pair thus: 1 4/2 3. With reference to this numbering scheme, position 1 can be occupied by cytosine or 5-methylcytosine; position 2 can be occupied by guanosine or inosine; position 3, the site of enzymatic methylation, can be occupied only by cytosine; and position 4 can be occupied by guanosine, inosine, O6-methylguanosine, cytosine, adenosine, an abasic site, or the 3' hydroxyl group at the end of a gapped molecule. Replacing the guanosine normally found at position 4 with any of the moieties introduces unusual (non-Watson-Crick) pairing at position 3 and generally enhances methylation of the cytosine at that site. The exceptional facility of the enzyme in actively methylating unusual DNA structures suggests that the evolution of the DNA methyltransferase, and perhaps DNA methylation itself, may be linked to the biological occurrence of unusual DNA structures.

5-Methylcytosine↗
PubMed1991

Progesterone administration attenuates excitatory amino acid responses of cerebellar Purkinje cells.

We have previously shown that the sex steroid progesterone plays a modulatory role in amino acid physiology by suppressing excitatory responses of cerebellar Purkinje cells to glutamate and augmenting inhibitory responses of these neurons to GABA. In the present study using the rat, progesterone effects on neuronal responses to the specific excitatory amino acid agonists quisqualate, kainate and N-methyl-D-aspartate were tested using iontophoretic, extracellular single unit recording techniques. In addition, the effect of systemic administration of progesterone on quisqualate-evoked excitation was evaluated in the presence of the GABAA blocker bicuculline. Progesterone consistently attenuated excitatory neuronal responses to local application of all three excitatory amino acids by 40-51%, but exerted variable effects on combined administration of quisqualate and N-methyl-D-aspartate which were dependent on temporal and dose-related factors. Progesterone-induced attenuation of the quisqualate response was found to be mediated primarily by a non-N-methyl-D-aspartate receptor. In addition, bicuculline application did not block progesterone effects on quisqualate excitation, suggesting that the observed steroidal modulation of excitatory amino acid function is not secondary to progesterone-induced potentiation of GABA inhibition.

Amino Acids↗
PubMed1991

Effects of famotidine on gastric pH and residual volume in pediatric surgery.

Aspiration pneumonitis is a severe complication of anesthesia. The objectives of this study were to determine if preoperative famotidine, a new histamine2-receptor antagonist, given by mouth either the evening before or the morning of elective surgery, reduced gastric residual volume and increased gastric pH in pediatric patients. Either famotidine or placebo (or both) were orally administered to 58 children (aged 2-17 years). The patients were randomly assigned to four groups: Famotidine-Famotidine, Placebo-Placebo, Placebo-Famotidine, and Famotidine-Placebo; subjects in the Famotidine-Famotidine group received two doses of famotidine (0.5 mg.kg-1 per dose), those in the Placebo-Placebo group, two doses of placebo, those in the Placebo-Famotidine and Famotidine-Placebo group, one dose of each by mouth. The Famotidine-Famotidine group received one dose of famotidine at 22:00 the evening before surgery and a second dose 60-90 min before the scheduled time of surgery. The Placebo-Placebo group received two doses of placebo at the same times as the Famotidine-Famotidine group. The Placebo-Famotidine group received a dose of placebo the night before surgery and a dose of famotidine the morning of surgery; the Famotidine-Placebo group received famotidine the night before surgery and placebo the morning of surgery. The administration of famotidine on the morning of surgery significantly increased gastric pH (4.8 vs. 1.3) in comparison with placebo, as did two doses of famotidine (6.6). Famotidine failed to reduce gastric residual volume significantly in any group. The administration of famotidine significantly reduced the number of pediatric patients considered at higher risk for aspiration pneumonitis, despite not decreasing gastric residual volume.

Administration, Oral↗
PubMed1991

7-Mercaptoheptanoylthreonine phosphate substitutes for heat-stable factor (mobile factor) for growth of Methanomicrobium mobile.

Methanomicrobium mobile requires a heat-stable factor present in ruminal fluid and in boiled cell extract from Methanobacterium thermoautotrophicum for growth. By comparing the growth of M. mobile with boiled cell extract with that observed with various methanogenic cofactors, we found that 7-mercaptoheptanoylthreonine phosphate (HS-HTP) supported sustained growth of M. mobile, at an optimal concentration of 100 microM. No derivatives or possible biosynthetic precursors of HS-HTP could replace HS-HTP as the sole source of growth factor. Results suggest that the growth requirement might be satisfied by 7-mercaptoheptanoic acid plus a second, unidentified heat-stable factor.

Culture Media↗
PubMed1990

Evaluating the construct validity of psychopathy in black and white male inmates: three preliminary studies.

Although Black inmates represent almost half the population of United States prisons and have been included in several studies of psychopathy, there appear to be no published studies to date addressing the validity of the psychopathy construct in Black inmates. Three studies were conducted to assess the validity of the construct in Black male inmates using Hare's Psychopathy Checklist (PCL). In Study 1, we examined the internal structure of the PCL and the relation of checklist scores to several constructs relevant to psychopathy. We observed differences between Blacks and Whites in the distribution of psychopathy scores, in the relation of psychopathy to measures of impulsivity, and in the congruence of the underlying factor structure of the PCL. In Study 2, Black psychopaths were found to manifest a pattern of passive avoidance deficits similar but not identical to that reported for White psychopaths in Newman and Kosson's study. Study 3 demonstrated that psychopaths of both races receive more criminal charges in a wider variety of offense categories than do nonpsychopaths. The psychopathy construct appears tentatively applicable to Blacks, although its components may be somewhat different than for Whites.

Adult↗
PubMed1990

Alcohol and drug abuse-dependence disorders in psychopathic and nonpsychopathic criminal offenders.

Co-occurrence of psychopathy (assessed with the Psychopathy Checklist) and lifetime Diagnostic and Statistical Manual of Mental Disorders (3rd ed.) alcohol and drug disorders (assessed with the National Institute of Mental Health Diagnostic Interview Schedule) was examined in a sample of 360 male inmates. Consistent with previous research that used diagnoses of antisocial personality disorder, psychopaths were more likely than nonpsychopaths to have lifetime diagnoses of alcoholism, any drug disorder, and multiple drug disorders. We also examined the relation between substance abuse and the 2 factors of the Psychopathy Checklist. Substance abuse was significantly related to general social deviance (Factor 2) but was unrelated to core personality features of psychopathy (Factor 1). We present two possible models of psychopathy (unitary syndrome vs. dual-diathesis model) that may account for the association between psychopathy and substance abuse.

Adolescent↗
PubMed1990

Maturation in Larch : II. Effects of Age on Photosynthesis and Gene Expression in Developing Foliage.

The effect of maturation on the morphological and photosynthetic characteristics, as well as the expression of two genes involved in photosynthesis in the developing, current year foliage of Eastern larch (Larix laricina [Du Roi]) is described. These effects were observed on foliage during the third growing season after grafting of scions from trees of different ages onto 2 year old rootstock. Specific leaf weight (gram dry weight per square meter), leaf cross-sectional area (per square millimeter), and chlorophyll content (milligram per gram dry weight) all increase with increasing age in long shoot foliage from both indoor- and outdoor-grown trees. Net photosynthesis (NPS) (mole of CO(2) per square millimeter per second) increases with age on indoor- but not outdoor-grown trees. NPS also increases with increased chlorophyll content, but outdoor-grown scions of all ages had higher chlorophyll content, and chlorophyll does not appear to be limiting for NPS outdoors. To extend these studies of maturation-related differences in foliar morphology and physiology to the molecular genetic level, sequences were cloned from the cab and rbsS gene families of larch. Both cab and rbcS gene families are expressed in foliage but not in roots, and they are expressed in light-grown seedlings of larch but only at very low levels in dark-grown seedlings (~2% of light-grown seedlings). Steady-state cab mRNA levels are relatively higher (~40%) in newly expanding short shoot foliage from juvenile plants compared to mature plants. Unlike cab, the expression of the rbcS gene family did not seem to vary with age. These data show that the maturation-related changes in morphological and physiological phenotypes are associated with changes in gene expression. No causal relationship has been established, however. Indeed, we conclude that the faster growth of juvenile scions reported previously (MS Greenwood, CA Hopper, KW Hutchison [1989] Plant Physiol 90: 406-412) is not due to increased NPS or cab expression. Long shoot foliage is the dominant foliar type on young trees and its lower specific leaf weight will permit production of more photosynthetic surface area per unit of leaf biomass.

Journal Article↗
PubMed1989

Quisqualate and N-methyl-D-aspartate synergistically excite cerebellar Purkinje cells as a long-term effect.

Interactions between the excitatory amino acids (EAAs) quisqualate (QUIS) and N-methyl-D-aspartate (NMDA) were investigated in order to explore mechanisms which may help to explain long-term changes in synaptic efficacy induced by these agents. In 93% of the cerebellar Purkinje (Pnj) cells recorded extracellularly which responded to iontophoretic application of QUIS with increases in discharge of up to 100% above spontaneous levels. NMDA administration sensitized the neuron to further QUIS stimulation by 40-200% over control levels of response. NMDA-enhanced QUIS responses reached maximal levels after termination of NMDA application and persisted for up to 2 h post-NMDA. The NMDA receptor blocker 2-amino-5-phosphonovalerate (APV) prevented the observed effect only when administered before but not after NMDA application, suggesting that a long-lasting post-receptor mechanism may be involved in the observed synergistic interaction of QUIS and NMDA.

2-Amino-5-phosphonovalerate↗
PubMed1989

Estrogen administration increases neuronal responses to excitatory amino acids as a long-term effect.

Ongoing studies from this laboratory have demonstrated marked potentiating actions of the sex steroid 17 beta-estradiol (E2) on glutamate-induced excitation. In the present study, systemic injection of a physiological dose of E2 was demonstrated to augment significantly excitatory responses of cerebellar Purkinje (Pnj) cells to iontophoretic application of the specific excitatory amino acid (e.a.a.) agonists quisqualate and N-methyl-D-aspartate. Potentiation of e.a.a. responses was observed as rapidly as 5-10 min post E2, and was, in many cases, a persistent, non-decremental effect. These observed long-term actions of E2 may provide one mechanism for the activating effects of the steroid on sensorimotor function and seizure activity.

Action Potentials↗
PubMed1989

A G4-DNA/B-DNA junction at codon 12 of c-Ha-ras is actively and asymmetrically methylated by DNA(cytosine-5)methyltransferase.

Oligodeoxynucleotides spanning codon 12 of the human c-Ha-ras gene were found to be exceptionally good substrates for de novo methylation by human DNA(cytosine-5)methyltransferase. In the complex formed by two complementary 30mers, only the C-rich strand was methylated by the enzyme. Guanines at the 3' end of the G-rich strand of the complex could not be completely modified by dimethyl sulfate [corrected] suggesting tetrameric bonding at these G-residues. An eight-stranded structure, composed of four duplex DNAs at one end, joined to a G4-DNA segment at the other with the junction between the two DNA forms at codon 12, can account for our results.

Base Sequence↗
PubMed1989

Quantitative evaluation of Escherichia coli host strains for tolerance to cytosine methylation in plasmid and phage recombinants.

Many strains of E. coli K12 restrict DNA containing cytosine methylation such as that present in plant and animal genomes. Such restriction can severely inhibit the efficiency of cloning genomic DNAs. We have quantitatively evaluated a total of 39 E. coli strains for their tolerance to cytosine methylation in phage and plasmid cloning systems. Quantitative estimations of relative tolerance to methylation for these strains are presented, together with the evaluation of the most promising strains in practical recombinant cloning situations. Host strains are recommended for different recombinant cloning requirements. These data also provide a rational basis for future construction of 'ideal' hosts combining optimal methylation tolerance with additional advantageous mutations.

Animals↗