Search PubMed⌕ Search

Biomedical subjects

S Ramachandran

Publications and source records attributed to S Ramachandran.

At least 37 records · Page 2Linked to original sources
PubMed2002

Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs.

Only a small proportion of the mouse genome is transcribed into mature messenger RNA transcripts. There is an international collaborative effort to identify all full-length mRNA transcripts from the mouse, and to ensure that each is represented in a physical collection of clones. Here we report the manual annotation of 60,770 full-length mouse complementary DNA sequences. These are clustered into 33,409 'transcriptional units', contributing 90.1% of a newly established mouse transcriptome database. Of these transcriptional units, 4,258 are new protein-coding and 11,665 are new non-coding messages, indicating that non-coding RNA is a major component of the transcriptome. 41% of all transcriptional units showed evidence of alternative splicing. In protein-coding transcripts, 79% of splice variations altered the protein product. Whole-transcriptome analyses resulted in the identification of 2,431 sense-antisense pairs. The present work, completely supported by physical clones, provides the most comprehensive survey of a mammalian transcriptome so far, and is a valuable resource for functional genomics.

Alternative Splicing↗
PubMed2002

Evidence for the presence of HABP1 pseudogene in multiple locations of mammalian genome.

The gene encoding hyaluronan-binding protein 1 (HABP1) is expressed ubiquitously in different rat tissues, and is present in eukaryotic species from yeast to humans. Fluorescence in situ hybridization indicates that this is localized in human chromosome 17p13.3. Here, we report the presence of homologous sequences of HABP1 cDNA, termed processed HABP1 pseudogene in humans. This is concluded from an additional PCR product of ~0.5 kb, along with the expected band at approximately 5 kb as observed by PCR amplification of human genomic DNA with HABP1-specific primers. Partial sequencing of the 5-kb PCR product and comparison of the HABP1 cDNA with the sequence obtained from Genbank accession number AC004148 indicated that the HABP1 gene is comprised of six exons and five introns. The 0.5-kb additional PCR product was confirmed to be homologous to HABP1 cDNA by southern hybridization, sequencing, and by a sequence homology search. Search analysis with HABP1 cDNA sequence further revealed the presence of similar sequence in chromosomes 21 and 11, which could generate ~0.5 kb with the primers used. In this report, we describe the presence of several copies of the pseudogene of HABP1 spread over different chromosomes that vary in length and similarity to the HABP1 cDNA sequence. These are 1013 bp in chromosome 21 with 85.4% similarity, 1071 bp in chromosome 11 with 87.2% similarity, 818 bp in chromosome 15 with 82.3% similarity, and 323 bp in chromosome 4 with 84% similarity to HABP1 cDNA. We have also identified similar HABP1 pseudogenes in the rat and mouse genome. The human pseudogene sequence of HABP1 possesses a 10 base pair direct repeat of "AGAAAAATAA" in chromosome 21, a 12-bp direct repeat of "AG/CAAATTA/CAA/TTA" in chromosome 4, a 8-bp direct repeat of "ACAAAG/TCT" in chromosome 15. In the case of chromosome 11, there is an inverted repeat of "AGCCTGGGCGACAGAGCGAGA" ~50 bp upstream of the HABP1 pseudogene sequence. All of the HABP1 pseudogene sequences lack 5' promoter sequence and possess multiple mutations leading to the insertion of premature stop codons in all three reading frames. Rat and mouse homologs of the HABP1 pseudogene also contain multiple mutations, leading to the insertion of premature stop codons confirming the identity of a processed pseudogene.

Animals↗
PubMed2001

Glutathione-S-transferase family of enzymes.

The loci encoding the glutathione-S-transferase (GST) enzymes comprise a large supergene family located on at least seven chromosomes. The function of the GST enzymes has traditionally been considered to be the detoxication of electrophiles by glutathione conjugation. A wide variety of endogenous (e.g. by-products of reactive oxygen species activity) and exogenous (e.g. polycyclic aromatic hydrocarbons) electrophilic substrates have been identified. Interestingly, recent data has suggested a role, at least for the pi class gene product, in jun kinase inhibition. Since many GST genes are polymorphic, there has been considerable interest in determining whether particular allelic variants are associated with altered risk (or outcome) of a variety of diseases. We describe recent studies in patients with asthma and cutaneous basal cell carcinoma that demonstrate associations between GSTP1 and GSTT1 genotypes and disease phenotypes. Thus, GSTP1val(105)/val(105) was protective against asthma symptoms and GSTT1 null was associated with a subgroup of basal cell carcinoma patients who develop large numbers of primary tumours in clusters. Importantly, these associations were characterised by relatively large odds ratios (0.11 and 7.4, respectively) implying that the allelic variants exert a substantial biological effect. These and other data indicate the importance of GST polymorphism in determining disease phenotype.

Asthma↗
PubMed2001

Angiogenic role for glycodelin in tumorigenesis.

Angiogenesis plays an important role in neovascularization in tumors. Glycodelin, a hormone-responsive protein, has been detected in tumors of reproductive organs and is found in high levels in the plasma of subjects with gynecological malignancies. Glycodelin is also found in the endothelial cells of the umbilical cord and in the blood vessels of tumors. In this study, we tested whether glycodelin-rich amniotic fluid and a synthetic peptide derived from the sequence of glycodelin peptide (Gp) might promote angiogenic response by examining the migration and tube formation in human umbilical cord vein endothelial cells (HUVECs). Increased migration and tube formation of HUVECs were found in the presence of amniotic fluid and Gp, and this increase was blocked by antibody to Gp and by an anti-vascular endothelial growth factor (VEGF) antibody, suggesting that the angiogenic effects of glycodelin might be mediated by VEGF. The results also showed that Gp significantly increased the release of VEGF protein and mRNA expression in HUVECs, RL-95 (human endometrial carcinoma cells), OVCAR-3 (human ovarian adenocarcinoma cells), EM42 (human endometrial epithelial cells), THP-1 (human monocyte), and MCF-7 and MDA-MB-231 (human breast adenocarcinoma cells) cell lines. VEGF receptor Fit-1 mRNA expression in HUVECs was also increased in the presence of Gp. These findings, together with the suggestion from the literature that glycodelin may have immunosuppressive properties, suggest that glycodelin might play an important role in neovascularization during embryogenesis and tumor development.

Amino Acid Sequence↗
PubMed2001

Cutaneous basal cell carcinomas: distinct host factors are associated with the development of tumors on the trunk and on the head and neck.

BACKGROUND: Patients with basal cell carcinoma (BCC) demonstrate marked variation in clinical phenotype, suggesting the presence of distinct subgroups. Patients with truncal lesions comprise an interesting subgroup, because, although the pathogenesis of these tumors is unclear, there is evidence to suggest that their development is mediated by different mechanisms than the mechanisms that mediate the development of BCC on other sites. The authors now speculate that some patients inherit a predisposition to truncal BCC and develop disproportionately more BCC on this site than other patients. METHODS: The authors studied 100 patients who, at the time of initial presentation, had a truncal BCC lesion and 493 patients who had a lesion on the head and neck. The 493 patients with head and neck lesions included 36 patients who subsequently developed a truncal BCC and 457 patients who do not. RESULTS: Initial presentation with a truncal tumor was associated with significantly more subsequent BCC lesions on this site compared with patients who presented initially with a head and neck lesion. The mean truncal tumor accrual after initial presentation in patients who presented with an initial truncal BCC lesion was 0.13 BCC lesions per year compared with 0.03 BCC lesions per year in patients who presented with an initial head and neck lesion (P < 0.001). Patients with truncal lesions were significantly younger at the time of initial presentation and developed more clusters of BCC lesions (2--10 new tumors at any presentation) compared with patients who did not develop tumors on the trunk. CONCLUSIONS: These data suggest that the development of a truncal BCC is not random but, rather, is associated with a predisposition. In contrast, the accrual of nontruncal BCC lesions was similar in patients with and without initial truncal lesions, suggesting that different mechanisms determine the development of truncal BCC and nontruncal BCC.

Adult↗
PubMed2001

Temperature tolerance of some estuarine fishes.

The temperature tolerance of estuarine fishes Etroplus suratensis (Bloch), Therapon jarbua (Forsskal), Ambassis commersoni (Cuvier) collected from Vellar estuary, South India in 1986-87 were determined in the laboratory. E. suratensis and T. jarbua were found to be more tolerant to a wide range of temperature (16.5-41.5 degrees C for E. suratensis and 13.5-40.6 degrees C for T. jarbua), A. commersoni could tolerate from 15.5 to 38.5 degrees C. The tolerance area was found to be 512 units in E. suratensis, 629 units in T. jarbua and 442 units in A. commersoni. Among the fishes tested T. jarbua had a high tolerance area (629 units) than other fishes tested. It is evident from the results that 15 degrees C increase in acclimation temperature cause a shift of 4.02 degrees C (E. suratensis) and 3.05 degrees C (T. jarbua and A. commersoni) in upper incipient lethal temperature.

Journal Article↗
PubMed2001

Genetic factors determining cutaneous basal cell carcinoma phenotype.

BACKGROUND: Basal cell carcinoma (BCC) patients demonstrate considerable phenotypic diversity. The basis of this heterogeneity is poorly understood. We have shown that presentational phenotypes are associated with BCC numbers. Thus, patients with a cluster of new BCC at any presentation comprise a subgroup, termed MPP, that is at increased risk of developing numerous lesions. Patients with more than one cluster (multiple cluster MPP) are at particular risk. PROCEDURE: We determined in a cohort of BCC cases, whether: (i) tumor accrual was altered after clustering; and (ii) multiple cluster MPP is associated with characteristics linked with sensitivity to UV or, GSTT1, GSTM1, GSTM3, GSTP1, MC1R, CYP2D6, TNF-alpha, and VDR genotypes previously associated with BCC presentational phenotypes. RESULTS: (i) After clustering BCC accrual increased; and (ii) exposure to UV in single and multiple cluster MPP cases were similar. In multiple cluster cases, mean age at first presentation with a single tumor occurred earlier and, the frequencies of CYP2D6 EM (94.4%) and GSTT1 null (41.2%) were significantly greater (P = 0.028 and P = 0.004) than in single cluster cases (67.1 and 14.3%). The odds ratios for these associations with the multiple cluster MPP were large; 15.5 and 7.39, respectively. CONCLUSIONS: The finding of clusters of new, primary BCC is a critical event that is followed by markedly increased accrual of further tumors. Clustering occurs at a relatively late age and may be associated with a failure in immune surveillance. We propose the MPP is not the consequence of excessive UV exposure but reflects the presence of a distinct BCC subgroup defined by a combination of risk genes.

Basal Cell Carcinoma↗
PubMed2001

Susceptibility and modifier genes in cutaneous basal cell carcinomas and their associations with clinical phenotype.

While ultraviolet radiation (UV) is critical in the pathogenesis of basal cell carcinomas (BCC), its role in determining the phenotypic variation shown by patients is unknown. Thus, patients manifest variation in BCC numbers, patterns of presentation and tumour site. We have used this diversity to classify patients into subgroups that are associated with different risks of developing tumours. Two phenotypes are particularly interesting. Firstly, presentation with clusters of BCC. These patients, termed multiple presentation phenotype (MPP), had two to five BCC at one presentation, suggesting rapid accrual over short periods of time. They comprised 15% of our 1200 BCC patients. A minority of patients demonstrated multiple clustering events, a phenomenon that is associated with a genetic pre-disposition. The second risk phenotype, characterised by tumours on the trunk, is also associated with a pre-disposition. Both phenotypes were characterised by a susceptibility to develop numerous BCC. Thus, all our patients with more than five BCC had one or both of these phenotypes. We are using a candidate gene approach to identify loci associated with risk of these phenotypes (susceptibility genes) and tumour numbers in them (modifier genes). Interestingly, we did not identify differences in UV exposure between patients with high- and low-risk phenotypes.

Basal Cell Carcinoma↗
PubMed2001

Determination of butyl-, phenyl-, octyl- and tributylmonomethyltin compounds in a marine environment (Bay of Bengal, India) using gas chromatography-inductively coupled plasma mass spectrometry.

Organotin compounds (butyl-, phenyl-, octyl- and tributylmonomethyltin) and inorganic tin were quantified in sea-water and sediments from two harbours and several locations on the southeast coast of India using highly sensitive and selective gas chromatography-inductively coupled plasma mass spectrometry (GC-ICP-MS), adopting new extraction and analytical techniques with extremely low detection limits (water, 0.019-0.85 pg l(-1); sediment, 0.23-0.48 ng g(-1)). The concentrations of monobutyltin (MBT), dibutyltin (DBT) and tributyltin (TBT) in sea-water from Tuticorin harbour varied from 0.64 to 4.97, 3.0 to 26.8 and 0.3 to 30.4 ng Sn l(-1), respectively. MBT, DBT and TBT in sediments from harbour areas ranged from 1.6 to 393, 1.3 to 394 and ND (not detected) to 1280 ng Sn g(-1) (dry weight), respectively. Natural methylation in both harbours was established by quantifying tributylmonomethyltin (TBMMT) residues (sea-water, ND-0.19 ng Sn l(-1); sediment, ND-765 ng Sn g(-1) dry weight). In sea-water, octyltins were also determined as monooctyltin (MOT) > dioctyltin (DOT) > trioctyltin (TOT). Butyltin contamination in commercial harbours is evident, but other coastal waters are not contaminated with organotin residues. The high concentration of inorganic tin in estuarine sediment indicates an elevated rate of debutylation in the estuarine environment. Both methylation and debutylation of TBT in Chennai harbour were greater than in Tuticorin harbour. A significant correlation (r2 = 0.75) between total butyltin and organic carbon contents in sediment was found. To our knowledge, this is the first report on the distribution of butyltins and methylated butyltin in sea-water and sediment and octyltins in sea-water in the Indian marine environment.

Carbon↗
PubMed2001

Basal cell carcinomas: association of allelic variants with a high-risk subgroup of patients with the multiple presentation phenotype.

Previous studies have shown that patients who present at first or a later presentation with a cluster of new basal cell carcinoma (BCC) comprise a subgroup, termed multiple presentation phenotype (MPP), that is at increased risk of developing further lesions. In this study, we examined the hypothesis that patients who develop multiple clusters are a high-risk subgroup. We found, in a total group of 926 BCC patients, 32 patients with 2-5 BCC clusters (multiple cluster MPP) and 113 cases with only one cluster (single cluster MPP). Multiple cluster MPP cases had mean of 11.3 BCC compared with 3.7 in single cluster MPP cases during similar follow-up. Ultraviolet (UV) exposure in these groups was similar. We determined whether the multiple cluster MPP was associated with characteristics associated with sensitivity to UV or glutathione S-transferase (GST) GSTT1, GSTM1, cytochrome P450 (CYP) CYP2D6, tumour necrosis factor (TNF)-alpha and vitamin D receptor (VDR) genotypes previously associated with BCC presentational phenotypes. While the frequencies of blue eyes and male gender were greater in multiple cluster than single cluster cases, these differences were not significant. In multiple cluster cases, mean age at first presentation with single tumours occurred earlier and the frequencies of CYP2D6 extensive metabolizer (EM) (94.4%) and GSTT1 null (41.2%) were significantly greater (P = 0.028 and P = 0.004) than in single cluster cases (67.1% and 14.3%, respectively). The odds ratios for the individual associations of CYP2D6 EM and GSTT1 null with the multiple cluster MPP were relatively larger; 15.5 and 7.39, respectively. TNF-alpha and VDR genotypes were not associated with multiple cluster MPP. We propose that the MPP is not the consequence of excessive UV exposure but rather reflects the presence of a distinct BCC subgroup which is defined by combinations of risk genes.

Alleles↗
PubMed2001

ADF proteins are involved in the control of flowering and regulate F-actin organization, cell expansion, and organ growth in Arabidopsis.

Based mostly on the results of in vitro experiments, ADF (actin-depolymerizing factor) proteins are thought to be key modulators of the dynamic organization of the actin cytoskeleton. The few studies concerned with the in vivo function of ADF proteins that have been reported to date were performed almost exclusively using single-cell systems and have failed to produce consistent results. To investigate ADF functions in vivo and during the development of multicellular organs, we generated transgenic Arabidopsis plants that express a cDNA encoding an ADF protein (AtADF1) in the sense or the antisense orientation under the control of a strong constitutively active promoter. Selected lines with significantly altered levels of AtADF protein expression were characterized phenotypically. Overexpression of AtADF1 resulted in the disappearance of thick actin cables in different cell types, caused irregular cellular and tissue morphogenesis, and reduced the growth of cells and organs. In contrast, reduced AtADF expression promoted the formation of actin cables, resulted in a delay in flowering, and stimulated cell expansion as well as organ growth. These results are consistent with the molecular functions of ADF as predicted by in vitro studies, support the global roles of ADF proteins during the development of a multicellular organism, and demonstrate that these proteins are key regulators of F-actin organization, flowering, and cell and organ expansion in Arabidopsis.

Actin Depolymerizing Factors↗
PubMed2001

Role of arterial wall antioxidant defense in beneficial effects of exercise on atherosclerosis in mice.

The mechanism(s) by which exercise reduces atherogenic risk remains unknown. This study tested the hypothesis that sustained exercise-induced oxidative stress may increase antioxidant defense in the arterial wall. Acute exercise induced an increase in antibodies to oxidatively modified proteins and catalase in the aortic walls of normal mice compared with sedentary control mice. In male atherogenic diet-fed low density lipoprotein (LDL) receptor-deficient mice, exercise lowered plasma cholesterol (15%) and decreased atherosclerotic lesions by 40% compared with values in sedentary control mice, with a concomitant increase in arterial catalase and endothelial NO synthase. Because these mice lack the LDL receptor, the results indicate that the LDL receptor might not be responsible for the exercise-induced lowering of plasma cholesterol. Vitamin E supplementation to exercising LDL receptor-deficient mice did not reduce atherosclerotic lesion formation significantly as opposed to lesion formation in untreated exercised mice. Moreover, vitamin E counteracted the beneficial effects of exercise by preventing the induction of aortic catalase activity and endothelial NO synthase expression. These results might indicate that although vitamin E might have prevented the exercise-induced oxidative stress, its availability in the artery was insufficient to prevent the atherosclerotic process. These results indicate that exercise-induced plasma oxidative stress could be responsible for the prevention of atherosclerosis by stimulating arterial antioxidant response. Furthermore, vitamin E supplementation could be deleterious in exercisers by inhibiting antioxidant enzyme buildup in the arterial wall.

Animals↗
PubMed2001

Expression of scavenger receptor class B1 in endometrium and endometriosis.

Endometriosis is characterized by the presence of endometrial glands and stroma within the peritoneum and other extrauterine sites. The presence of aromatase, a key enzyme in the biosynthesis of estradiol, has been demonstrated in eutopic endometrial samples of women with moderate to severe endometriosis, but not in those of disease-free women. Animal studies have shown that high density lipoprotein provides precursor cholesterol pool for steroidogenesis. Scavenger receptor class B1, a 82-kDa cell surface protein, is involved in the binding of high density lipoprotein to target cells and promotes cholesteryl ester uptake. In this study we detected the presence of scavenger receptor class B1 in eutopic and ectopic endometrium. There was more scavenger receptor class B1 protein associated with endometriosis compared with matched endometrium. Two bands (82 and 45 kDa) were detected in the endometrium and endometriosis samples. Glycanase treatment indicated that the 45-kDa protein might be a nonglycosylated form of scavenger receptor class B1. Immunostaining of fixed tissues detected scavenger receptor class B1 in glandular epithelium of both tissues. Scavenger receptor class B1 and aromatase mRNA were increased in endometriosis tissues. Scavenger receptor class B1 expression in the endometrium and endometriosis supports a role for this receptor in the uptake of high density lipoprotein cholesterol, possibly supporting in situ estrogen production, which is detrimental in the progression of endometriosis.

Adult↗
PubMed2000

Basal cell carcinoma.

BACKGROUND: Basal cell carcinoma (BCC) is characterized by marked interpatient variation in tumor accrual. The authors previously reported that presentation with a cluster of BCC is associated with an inherited predisposition to develop many additional lesions suggesting clustering is a critical event. A cluster is defined as the presence of two or more new, primary BCCs, at initial or later presentation. METHODS: The authors recruited 927 cases and determined whether 1) clustering was an early or late event and 2) tumor accrual was altered after clustering. RESULTS: In the cases, 669 patients developed only 1 lesion, 112 patients presented more than once but with single lesions (single presentation phenotype[SPP]-more), 94 cases had a cluster at first presentation (multiple presentation phenotype [MPP]-cluster initial), and 52 cases first presented with 1 lesion but later had a cluster (MPP-cluster later). The authors found that 1) clustering occurred relatively late. The mean ages at first presentation with 1 BCC of the SPP-more (61.5 years) and MPP-cluster later patients (60.4 years) were similar although presentations with clusters in the MPP-cluster initial (67.6 years, P = 0.0002) and -cluster later cases (68.1 years, P = 0.002) occurred significantly later. 2) Clustering was associated with increased accrual. Thus, 26 patients (MPP-cluster later/a) in the MPP-cluster later group had a additional BCC postcluster. Mean accrual post-cluster (1.99 BCC/year) in these cases was significantly increased (P = 0.0001) compared with precluster accrual (0.39 BCC/year). CONCLUSIONS: The authors found that the formation of BCC clusters represents a critical event such that after a cluster presentation, tumor accrual is significantly increased. Cluster presentation is a relatively late event suggesting reduced effectiveness in immune surveillance.

Age Factors↗
PubMed2000

The introduction of new vaccines into developing countries II. Vaccine financing.

The development of new vaccines for important childhood diseases presents an unparalleled opportunity for disease control but also a significant problem for developing countries: how to pay for them. To help address this problem, the William H. Gates Foundation has established a Global Fund for Children's Vaccine. In this paper, we discuss the allocation of this and other similar funds, which we call Global Funds. We propose that allocation of the Global Funds to individual countries be guided in part by a Vaccine Procurement Baseline (VPB). The VPB would set a minimum of 0.01% of gross national product (GNP) as an amount each developing country would devote to its own vaccine procurement. When this amount is not sufficient to procure the vaccines needed by a developing country, the Global Funds would meet the shortfall. The amount required of donors to maintain the Global Funds would be about $403 million per year for both existing EPI vaccines as well as for a hypothetical group of five new vaccines costing $0.50 per dose and requiring three doses per child. Including program costs, poor developing countries currently spend about 0.13% of GNP on EPI immunizations. In contrast, the United States, as one example donor country, spends about 0.035% of GNP for childhood immunization including several new vaccines. This paper analyzes the Global Funds requirements for hepatitis B and Haemophilus influenzae type b (Hib) vaccines. After a ramp-up period, needier countries would eventually require about $62 million for hepatitis B and $282 million for Hib at current prices. Various additional criteria could be used to qualify countries for participation in the Global Funds.

Bacterial Capsules↗
PubMed2000

Measurements of cysteine reactivity during protein unfolding suggest the presence of competing pathways.

Evidence that proteins may unfold utilizing complex competing pathways comes from a new pulse-labeling protocol in which the change in reactivity of a single cysteine residue in a protein during unfolding is measured, making use of its easily monitored reaction with the Ellman reagent, dithionitrobenzoic acid. The kinetics of unfolding of two single cysteine-containing mutant forms of the small protein barstar, C82A, which contains only Cys40, and C40A, which contains only Cys82, have been studied. The data suggest that unfolding occurs via two parallel pathways, each forming competing intermediates. In one of these early intermediates, Cys40 and Cys82 are already as reactive as they are in the fully unfolded protein, while in the other intermediate, the Cys thiol groups are unreactive. One more long-lived intermediate also needs to be included on the pathway defined by the early intermediate with unreactive Cys thiol groups to account for the difference in the rates of fluorescence change and of change in Cys40 reactivity. The demonstration of multiple intermediates and pathways for unfolding indicates that protein unfolding reactions can be as complex as protein folding reactions.

Amino Acid Substitution↗