Search PubMed⌕ Search

Biomedical subjects

S Osawa

Publications and source records attributed to S Osawa.

At least 181 records · Page 10Linked to original sources
PubMed1982

Purification and characterization of 30S ribosomal proteins from Bacillus subtilis: correlation to Escherichia coli 30S proteins.

Twenty proteins were isolated from the 30S ribosomal subunits of Bacillus subtilis and their amino acid compositions and amino-terminal amino acid sequences were determined. These results were compared with the data of Escherichia coli 30S ribosomal proteins and the structural correspondence of individual ribosomal proteins has been established between B. subtilis and E. coli. Post-translational modifications of amino-terminal amino acids of the ribosomal proteins which have been found in E. coli are almost absent in B. subtilis with the exception of acetylated forms of S9.

Amino Acid Sequence↗
PubMed1982

The protein composition of Mycoplasma capricolum.

The whole cell proteins and the ribosomal proteins of Mycoplasma capricolum ATCC 27343 have been analyzed by two-dimensional polyacrylamide gel electrophoresis. The M. capricolum cell is relatively rich in basic proteins. The number of total protein spots detected was approximately 355, which is less than one-third of that of Escherichia coli or Bacillus subtilis. In contrast, the number (30 and 20 protein species have been found to be present in the 50S and 30S ribosomal subunits, respectively) and the size of the ribosomal proteins in the M. capricolum do not seem to be significantly different from those of typical eubacteria.

Bacterial Proteins↗
PubMed1982

Primary culture of chondrocytes embedded in collagen gels.

Chondrocytes isolated from sternal cartilage of 13-day embryonic chicks were dispersively embedded inside the collagen gels in Ham's F-12 medium containing fetal calf serum. Viability, three-dimensional growth and deposition of extracellular matrix in the living cultures were evidenced by increased cell number, morphology and autoradiographic observations, respectively. The cells increased 2- to 3-fold in 1 week and occupied ' chondrocytic lacunae' surrounded by 'territorial matrix'. A more extensive development of the tissue-like structure was produced by high density cultures. Exogenous collagen seemed to be incorporated or rearranged into the newly formed matrix. This new culture method may provide suitable conditions for differentiated chondrocytes to accumulate metachromatic matrix in vitro.

Animals↗
PubMed1981

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.

Base Sequence↗
PubMed1981

The number of ribosomal RNA genes in Mycoplasma capricolum.

We have examined the number of rRNA genes in Mycoplasma capricolum (KID) by hybridization of Bg/II-, EcoRI- and Xbal-digests of DNA to [3'-32P] 16S, 23S and 5S rRNAs according to the Southern procedure (1975). All the restriction gels gave two radioactive bands with three kinds of rRNA. Furthermore, band positions were indistinguishable from one another when 16S, 23S and 5S rRNAs were used as probes, indicating that each band contains sequences corresponding to the 3'-termini of 16S, 23S and 5S rRNAs. It is thus concluded that Mycoplasma capricolum chromosome carries at least two sets of genes for 16S, 23S and 5S rRNAs.

DNA Restriction Enzymes↗
PubMed1981

A role for calmodulin in the regulation of steroidogenesis.

TWO APPROACHES WERE USED TO STUDY THE POSSIBLE ROLE OF CALMODULIN IN THE REGULATION OF STEROID SYNTHESIS BY MOUSE ADRENAL TUMOR CELLS: trifluoperazine was used as an inhibitor of calmodulin and liposomes were used to deliver calmodulin into the cells. Trifluoperazine inhibits three steroidogenic responses to both ACTH and dibutyryl cyclic AMP: (a) increase in steroid production, (b) increased transport of cholesterol to mitochondria, and (c) increased side-chain cleavage by mitochondria isolated from cells incubated with ACTH or dibutyryl cyclic AMP. When calmodulin is introduced into the cells via liposomes, steroid synthesis is slightly stimulated. When calmodulin extensively dialyzed against EGTA, this stimulation is abolished. Ca(2+) introduced via liposomes was also without effect. However, when both calmodulin and Ca(2+) are introduced via liposomes (either in separate liposomes or in the same liposomes), steroid synthesis is stimulated. This stimulation does not occur when either anticalmodulin antibodies or EGTA is also present in the liposomes or when trifluoperazine is present in the incubation medium. Calmodulin and Ca(2+) presented together in liposomes to the cells stimulate transport of cholesterol to mitochondria, and side-chain cleavage activity is greater in mitochondria isolated from cells previously fused with liposomes containing calmodulin and Ca(2+) than in mitochondria from cells fused with liposomes containing buffer only. These observations suggest that calmodulin may be involved in regulating the transport of cholesterol to mitochondria, a process which is stimulated by ACTH and dibutyryl cyclic AMP and which may account, at least in part, for the increase in steroid synthesis produced by these agents.

20-alpha-Dihydroprogesterone↗
PubMed1981

Distribution of ribonucleic acid coliphages in animals.

To determine the distribution pattern of ribonucleic acid (RNA) coliphages (classified by serological groups I through IV) in animal sources, we isolated RNA phages from (i) feces samples from domestic animals (cows, pigs, horses, and fowls), some other animals in a zoological garden, and humans, (ii) the gastrointestinal contents of cows and pigs, and (iii) sewage samples from treatment plants in slaughter houses. These samples were then analyzed serologically. The concentration of RNA phages in the first and second kinds of material was fairly low (10 to 10(3) plaque-forming units per original phage sample), whereas that in the third kind of material was fairly high (10(3) to 10(5) plaque-forming units per original phage sample). Concerning the group types of the RNA phages in the first and second kinds of material, human feces contained RNA phages of groups II and III almost equally, the gastrointestinal contents of pigs included those of groups I and II equally, and the feces or gastrointestinal contents of other mammals other than humans and pigs had those of group I exclusively. In the third type of material we found mostly group I phages with a minor fraction of group II phages. Thus, the prominent features of the distribution pattern of RNA phages are the predominance of groups III and II in humans and the predominance of group I in animals.

Animals↗
PubMed1981

Distribution of ribonucleic acid coliphages in Korea.

To determine the geographical distribution of ribonucleic acid (RNA) coliphages in Korea, we collected sewage samples from domestic drainage in densely populated urban areas in July through August, 1979. Of 132 samples, 74 (56%) contained RNA phages (106 strains). They were classified into groups I, II and III (4:47:55) by serological analysis. Based on previous data for Japan (groups II and III [3:11]) and Southeast Asia (mostly group III), the distribution pattern of RNA phages in Korea was of an intermediate type between those of Japan and Southeast Asia.

Coliphages↗
PubMed1981

Distribution of ribonucleic acid coliphages in raw sewage from treatment plants in Japan.

To determine the transmission cycle of ribonucleic acid (RNA) coliphages in their natural habitats, we investigated the distribution patterns of RNA phages in raw sewage collected from treatment plants in various localities in Japan. Most of the sewage samples contained group II and III phages. Samples from treatment plants in Sapporo, Tokyo, and Toyama contained appreciable amounts of group I phages in addition to the group II and III phages. As a whole, raw sewage from treatment plants in Japan contained RNA phages of the three groups in the ratio 1:2:5, group I/II/III. Based on the distribution patterns of RNA phages in sewage from domestic drainage in Japan proper (group II/III, 3:1), in animal feces and sewage from slaughter houses (mostly group I), and in human feces (group II/III, 1:1), it can be reasonably said that group I phages tend to be introduced from animal sources and group II and III phages tend to be introduced from human sources. Raw sewage from treatment plants in Japan consists mainly of human feces, sewage from domestic drainage, and industrial wastewater, and, in part, from slaughter houses. In fact, sewage from slaughter houses together with that from human sources flowed into the treatment plants of Tokyo as far as we could confirm.

Coliphages↗
PubMed1981

The influence of calmodulin on steroid synthesis in leydig cells from rat testis.

Two approaches were used to study the possible role of calmodulin in the regulation of synthesis of testosterone by Leydig cells: trifluoperazine was used as an inhibitor of calmodulin and liposomes were used to deliver calmodulin into the cells. The inhibitor prevented the expected responses of Leydig cells to LH and to cAMP. First the increase in synthesis of testosterone produced when these agents are added to Leydig cells was inhibited by the drug. Second, increased transport of cholesterol to mitochondria produced by LH and cAMP was inhibited by trifluoperazine. Third, increased side-chain cleavage of cholesterol (cholesterol leads to pregnenolone) produced by these agents in isolated mitochondria was also inhibited by the drug. When Leydig cells were incubated with liposomes containing calmodulin, production of testosterone, transport of cholesterol to mitochondria, and side-chain cleavage of cholesterol were all stimulated. The effect of calmodulin is greater if Ca2+ is added before incorporation into liposomes than if calmodulin and Ca2+ are introduced into the Leydig cells from separate liposomes. Stimulation of testosterone synthesis does not occur if calmodulin is dialyzed against EGTA, if calmodulin with excess anticalmodulin is present in the liposomes, if either calmodulin or Ca2+ is added to the medium (no liposomes), or if Ca2+ alone is present in liposomes. These observations suggest that calmodulin is involved in regulating the transport of cholesterol to mitochondria, a process that is stimulated by LH and cAMP and one that may account for the increased steroid synthesis produced by these agents.

Animals↗
PubMed1980

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).

Animals↗
PubMed1980

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria.

Bacillus subtilis↗
PubMed1979

Evolutionary change in 5S RNA secondary structure and a phylogenic tree of 54 5S RNA species.

Secondary structure models of 54 5S RNA species are constructed based on the comparative analyses of their primary structure. All 5S RNAs examined have essentially the same secondary structure. However, there are revealing characteristic differences between eukaryotic and prokaryotic types. The prokaryotic 5S RNAs may be further classified into two types, one having 120 nucleotides (120-N type) and another having 116 (116-N type). A possible mechanism for the conversion of the prokaryotic 116-N type to the 120-N type 5S RNAs (or vice versa) is discussed on the basis of their nucleotide alignments. Finally, by comparing the nucleotide alignments, we propose a phylogenic tree of the 54 5S RNA species.

Animals↗
PubMed1979

Continuous survey of the distribution of RNA coliphages in Japan.

In order to demonstrate the stability and continuity of RNA coliphages (phages) in their natural habitats, we investigated the amount and group types of RNA phages in sewage samples collected continuously from domestic drainage in Japan proper and islands in the seas adjacent to Japan (abbreviated simply as islands, hereafter) over a 5-yr period from 1973 to 1977. It was found that the frequencies of isolation of RNA phages were fairly high and constant. The group types of RNA phages isolated were also stable in the three cities. Choshi, Niigata, and Toyama in Japan proper. The average for the three cities was group II:III = 3:1. The investigation in islands revealed that the frequencies of isolation of RNA phages were fairly high as in the case of the above three cities in Japan proper and the group types of RNA phages isolated were also stable. That is to say, group II phages were predominant on Rishiri Island, Rebun I., Iki I., and Tsushima I., which are located relatively near to mainland Japan, while group III phages were predominant on Amamiohshima I., mainland Okinawa, Ishigakijima I., and Iriomotejima I., which are located south of Kyushu. It can thus be said that the RNA phages in the domestic drainage of Japan proper and islands remained more or less stable over at least the 5-yr period, and an apparent difference in the geographical distribution of RNA phages in Japan exists between Kyushu and Amamiohshima I.

Coliphages↗