Search PubMed⌕ Search

Biomedical subjects

S Oka

Publications and source records attributed to S Oka.

At least 307 records · Page 17Linked to original sources
PubMed1993

[Prevalence of HIV infection among stable female partners of seropositive men].

Prevalence of HIV transmission to female sexual partners of seropositive men is not known yet. In order to know the condition in Japan, 11 HIV-seropositive men (25-42 years old; mean +/- SD, 32.5 +/- 6.0) and their stable female partners (24-42 years old; mean +/- SD, 31.3 +/- 6.0) were analyzed. Seropositive men consisted of seven hemophiliacs including a hemophiliac with intravenous drug abuse, three men who acquired HIV infection through heterosexual contact, and a man with intravenous drug abuse. Six of them were asymptomatic carriers, two had AIDS-related complex, and three had AIDS. All of the female partners had no risk factors other than sexual contact with their stable, seropositive male partners, except one who used to inject intravenous drug. Four of 11 female partners (36%) were found to be infected with HIV. All of the male partners of infected females had AIDS or AIDS-related complex, and had CD4 counts fewer than 100 cells/microliters. Asymptomatic carriers and men with CD4 counts more than 200 cells/microliters did not transmit HIV to their partners: rate of transmission of HIV by symptomatic men was significantly higher than that by asymptomatic men (p < 0.01), and the rate by men with CD4 counts fewer than 100 cells/microliters was also significantly higher than that by men with larger CD4 counts (p < 0.01). HIV-p24 antigen was measured in 10 of 11 seropositive men. The antigen was positive in four men, and negative in six.(ABSTRACT TRUNCATED AT 250 WORDS)

Acquired Immunodeficiency Syndrome↗
PubMed1993

[Reverse transcriptase gene analysis of HIV-1 mutants cultured in the presence of AZT].

HIV-1 strains were isolated from four patients treated with AZT for more than 6 months and from three patients untreated with AZT. Isolates from patients treated with AZT have been cultured by passage of virus in cell culture in the presence of 1 microM AZT. However the isolates from patients untreated with AZT could not be cultured in the presence of AZT. The RT gene of HIV-1 isolates which had been cultured in the presence of AZT were amplified by PCR and cloned to M13 vector. Four amino acid mutations in RT gene (Asp67, Lys70, Thr215, Lys219) associated with resistance to AZT were analysed. All of the 22 clones obtained from the isolates in the presence of 1 microM AZT had mutations at codon 215(Thr-->Tyr or Phe). Some of the 22 clones also had other mutations at codon 67 (Asp-->Ser), codon 70 (Lys-->Arg) and codon 219 (Lys-->Glu or Gln). Four amino acid residues in RT gene of the isolates which had been cultured in the presence of AZT were compared to that of the isolates cultured in the absence of AZT. The clones of the isolates obtained from the patients (04 or 05) had mutations at only codon 215 Thr-->Tyr) in both the presence and the absence of AZT. All of the clones of the isolates obtained from the patients (06 or 07) had mutations at codon 215 and some of them had other mutations.(ABSTRACT TRUNCATED AT 250 WORDS)

Amino Acid Sequence↗
PubMed1993

Clinical evaluation of rapid serodiagnosis of pulmonary tuberculosis by ELISA with cord factor (trehalose-6,6'-dimycolate) as antigen purified from Mycobacterium tuberculosis.

Immunoglobulin G (IgG) antibodies against purified cord factor (trehalose-6,6'-dimycolate) prepared from Mycobacterium tuberculosis H37Rv were determined by enzyme-linked immunosorbent assay (ELISA), and its diagnostic usefulness was evaluated. Serum specimens from 65 patients with active pulmonary tuberculosis, 58 patients with inactive pulmonary tuberculosis, 36 patients with diseases other than tuberculosis, and 66 healthy adults were examined. Patients with active pulmonary tuberculosis showed significantly higher titers of IgG antibodies against cord factor than did other groups (p < 0.001). The antibody titer greater than 0.29 in absorption difference (492 to 630 nm) of 160-times diluted serum was set as positive in ELISA. For patients with active and untreated pulmonary tuberculosis, the ELISA had a sensitivity of 81% and a specificity of 96%. From these results, it was concluded that the detection of IgG antibodies against cord factor is useful for serodiagnosis of active pulmonary tuberculosis. It was also indicated that the anticord factor antibody titers decline to the normal level as a result of antituberculosis chemotherapy.

Adult↗
PubMed1993

Pneumocystis carinii pneumonia monitored by P. carinii shedding in sputum by the polymerase chain reaction.

This study investigated the efficacy of applying the polymerase chain reaction (PCR) technique to the monitoring of therapy to P. carinii pneumonia (PCP). The PCR method was sensitive enough to determine P. carinii shedding in sputum samples which was not detectable by Diff-Quik (International Reagent Corp., Kobe, Japan) stain. By PCR, P. carinii disappeared in sputa on days 8 to 15 after treatment. Clinical improvements correlated with the loss of detectable P. carinii. This study represents a potential usefulness of PCR to monitor P. carinii shedding in sputum during treatment.

Adult↗
PubMed1993

Differences in response of patient's blood cells with bronchial asthma to diverse house dust mite allergens by histamine release assay.

A HPLC method was developed for the determination of histamine released from washed blood cells of allergic patients after exposure to allergens in the presence or absence of plasma. The blood cells used were preserved in a vital state at 4 degrees C during at least 6 hours after blood-collecting. The responses of blood cells to an appropriately diluted series of a mite feces extract (Dff) solution were evaluated in three patient's groups (68 cases of hyposensitized, 59 cases of newly visited and 44 cases of the others) with bronchial asthma. Washed blood cells from the hyposensitized groups had a tendency to release histamine easily even with lower concentration of the Dff solution. Both the sensitivities of washed blood cells to Dff or mite body extract (Dfb) and the responses of the cells to diverse antigens in neither extract differed largely in individual cases. The titer of blocking antibody could be expressed as the amount proportional to the concentration of Dff or Dfb.

Allergens↗
PubMed1993

Ocular manifestations in Japanese patients with human immunodeficiency virus infection.

The ocular manifestations in 65 Japanese human immunodeficiency virus (HIV)-seropositive patients were examined. Based on the cumulative totals, 22 of the cases had acquired immunodeficiency syndrome (AIDS), 17 had AIDS-related complex (ARC), and 35 were asymptomatic carriers (AC), including 4 AIDS cases who had progressed from ARC and 5 ARC cases from AC. Seventy-seven percent of the AIDS cases had ocular manifestations, including cotton-wool spots (50%), retinal hemorrhages (59%), cytomegalovirus retinitis (46%) and pupil abnormalities (14%). The ocular signs were also seen in 71% of the ARC cases and 37% of the AC cases. In Japanese HIV-seropositive patients, ocular manifestations are also as common as in Western HIV-seropositive patients.

AIDS-Related Complex↗
PubMed1993

[A case of cryptococcal retinochoroiditis associated with acquired immunodeficiency syndrome].

A case of cryptococcal retinochoroiditis associated with acquired immunodeficiency syndrome (AIDS) is reported. The patient was a 22-year-old man with hemophilia A. He was found seropositive for human immunodeficiency virus three years ago. He was admitted with complaints of fever and cough. CD4/CD8 ratio was 0.01 and CD4 lymphocyte count was 10/mm3. Two weeks later, ophthalmological examination revealed some yellowish white focal lesions at the posterior fundus. More detailed examinations were impossible because of his poor general condition. He died one month later. The autopsy showed disseminated cryptococcosis. Ocular histopathological examination revealed cryptococcal retinochoroiditis without any inflammatory reaction. This is the first report in Japan of this disease associated with AIDS and of a histopathological study of it.

AIDS-Related Opportunistic Infections↗
PubMed1993

[Ocular manifestations in human immunodeficiency virus seropositive patients].

Ocular manifestations in 56 human immunodeficiency virus (HIV) seropositive patients were examined prospectively. Eighteen of them had acquired immunodeficiency syndrome (AIDS), 14 had AIDS-related complex (ARC), and 30 were asymptomatic carriers (AC). Two AIDS patients progressed from ARC and four ARC patients from AC. Seventy-two percent of AIDS patients had ocular manifestations, including cotton-wool spots (28%), retinal hemorrhages (44%), cytomegalovirus retinitis (28%) and papilledema (6%). We also found ocular signs in 50% of ARC patients and 40% of AC patients. Since ophthalmologic manifestations are common in HIV seropositive patients, it is necessary for them to undergo a routine series of ophthalmologic examinations.

AIDS-Related Complex↗
PubMed1993

[Results of 29-year study of hoya (sea-squirt) asthma in Hatsukaichi, Hiroshima prefecture].

As remarkable improvements have been made to the working environment and working methods of oyster shucking workers during the past 30 years, a study was made on the effects of these improvements on hoya (sea-squirt) asthma and the following results were obtained. 1) The prevalence of hoya (sea-squirt) asthma among oyster shucking workers was 36.0%, 30.1%, 21.7%, 22.0%, 18.0%, and 26.6% in 1963, 1968, 1976, 1984, 1988, and 1992, respectively. Accompanying the improvements made to the working environment and working methods, asthmatic symptoms failed to develop in some of the patients through engaged in oyster shucking work. Thus, those with symptoms actually accounted for 36.0%, 18.7%, 15/8%, 7.4%, 8.4%, and 8.0% of the workers, respectively. 2) The proportion of serious cases among the patients rapidly decreased from 29.2% in 1963 to 0% after 1984. On the other hand the proportion of slight cases was 35.4% in 1963, but after 1988 all the cases were slight cases. 3) During the period from 1984 to 1992, the number of those newly engaged in oyster shucking work was 74. The number of those who developed hoya (sea-squirt) asthma during this period was 8 or 10.1%. All the cases were asthma of the rhinitis type. 4) The number of workers who did not develop asthmatic symptoms though engaged in oyster shucking work was 53 in 1984, 40 in 1988, and 49 in 1992. Of this number, 31% are now under hyposensitization therapy, 57.0% have received this therapy in the past, and 12.0% have not received any therapy.

Animals↗
PubMed1992

A novel glucuronyltransferase in nervous system presumably associated with the biosynthesis of HNK-1 carbohydrate epitope on glycoproteins.

Recently, embryonic chicken brain extract was shown to contain a glucuronyltransferase, which transfers glucuronic acid from UDP-glucuronic acid to glycolipid acceptors (neolactotetraosyl ceramide). The enzyme was also suggested to transfer glucuronic acid to glycoprotein acceptors (asialoorosomucoid) (Das, K. K., Basu, M., Basu, S., Chou, D. K. H., and Jungalwala, F. B. (1991) J. Biol. Chem. 266, 5238-5243). In this study, the glucuronyltransferase activity in rat brain extract was separated into two groups by UDP-glucuronic acid-Sepharose CL-6B column chromatography. The enzyme recovered predominantly in the effluent fraction (GlcAT-L) catalyzed the transfer of glucuronic acid to glycolipid acceptors but not to glycoprotein acceptors, whereas the enzyme recovered in the eluate fraction (GlcAT-P) transferred glucuronic acid most predominantly to glycoprotein acceptors and very little to glycolipid acceptors. GlcAT-P was able to transfer glucuronic acid to oligosaccharide chains on asialoorosomucoid. The enzyme recognized a terminal lactosamine structure, Gal beta 1-4GlcNAc, on glycoproteins. It was localized in the nervous system and was hardly detectable in other tissues, including the thymus, spleen, lung, kidney, and liver. Although GlcAT-L and GlcAT-P shared some properties in common such as tissue distributions and developmental changes, they exhibited marked differences in their phospholipid dependence and in their pH profiles, apart from their respective acceptor preference to glycolipids and glycoproteins. The acceptor specificity and tissue distribution suggest that a novel glucuronyltransferase, GlcAT-P, is involved in the biosynthesis of the sulfoglucuronylgalactose structure in the HNK-1 carbohydrate epitope that is expressed on glycoproteins.

Animals↗
PubMed1992

Antiulcer mechanism of action of rebamipide, a novel antiulcer compound, on diethyldithiocarbamate-induced antral gastric ulcers in rats.

The mechanism of the inhibitory action of rebamipide, a new mucosal protective drug, was studied using rats with diethyldithiocarbamate-induced gastric antral ulcers. Rebamipide reduced ulcer formation and inhibited the elevation in lipid peroxide concentration in the gastric mucosa. Rebamipide inhibited both luminol- and lucigenin-dependent chemiluminescence of neutrophils activated by formyl-methionyl-leucyl-phenylalanine. Rebamipide did not alter the reduction of cytochrome c induced by the xanthine-xanthine oxidase system or the NADPH-dependent microsomal lipid peroxidation in the liver. These findings suggest that rebamipide prevents diethyldithiocarbamate-induced gastric ulcer formation by inhibiting neutrophil activation.

Alanine↗
PubMed1992

Characterization of a glucuronyltransferase: neolactotetraosylceramide glucuronyltransferase from rat brain.

The properties of a rat brain glucuronyltransferase, which is presumed to be associated with the biosynthesis of the HNK-1 epitope on sulfoglucuronyl glycolipids, are described. The enzyme required divalent cations for reaction, with maximal activity at 10 mM Mn2+, and exhibited a dual optimum at pH 4-5 and pH 6 depending upon the buffer used, with the highest activity at pH 4.5 in MES buffer. This enzyme strictly recognized the Gal beta 1-4GlcNAc terminal structure, and was highly specific for neolacto (type 2) glycolipids as acceptor. The enzyme was localized specifically in the brain, and was barely detected in other issues, including the thymus, spleen, liver, kidney, lung, and sciatic nerve fibres. Phosphatidylinositol and phosphatidylserine increased the enzymatic reaction 4.4- and 2.3-fold, respectively, whereas phosphatidylcholine slightly decreased the rate.

Animals↗
PubMed1992

Disseminated Pneumocystis carinii infection in a hemophiliac patient with acquired immunodeficiency syndrome.

A case of disseminated Pneumocystis carinii (PC) infection in a 28-year-old Japanese male hemophiliac with acquired immunodeficiency syndrome (AIDS) is reported. The patient had displayed a high fever and diffuse faint interstitial infiltrates on chest X-ray films without dyspnea three months before his death. At that time, no PC was detected after four consecutive induced sputum tests. Serum anti-cytomegalovirus (CMV) IgM was positive by EIA. No treatment for PC and CMV was given at the patient's request. Autopsy findings disclosed disseminated PC infection consisting of granulomas with caseation-like necrosis and frothy exudate in the lungs and disseminated organized calcification in the blood vessels of extrapulmonary organs. PC cysts and/or trophozoites were detected in these lesions.

Acquired Immunodeficiency Syndrome↗
PubMed1992

[Identification of mycobacteria by the acridinium-ester labeled DNA probes for M. tuberculosis and M. avium-intracellulare complex in culture and its clinical application].

The detectability of mycobacterium in culture by non-isotopic, chemiluminescent DNA probes for Mycobacterium tuberculosis (M. tuberculosis) and M. avium-intracellulare complex (MAC) was evaluated and compared with that by 125I-labeled DNA probe for the same mycobacteria. The sensitivity and specificity of the AE-DNA probes for MAC were 97.2% and 100%, respectively, for the conventional method and were both 100% for the 125I-labeled DNA probes. The detection limits of the AE-DNA probes tests for both M. tuberculosis and MAC were 10(5)-10(6) CFU/tube which were almost the same as those of the 125I-labeled DNA probes tests. Because the procedure is simple, rapid (it can be completed within 90 min), and safe (it does not use radioisotopes), it can be easily performed in any clinical laboratory.

Acridines↗
PubMed1992

Clinical application of the polymerase chain reaction for a rapid diagnosis of Mycobacterium tuberculosis infection.

A gene amplification method of Mycobacterium tuberculosis DNA by the polymerase chain reaction (PCR) has been devised. A primer pair used in this study is 5'GTTGCCGTGGCGG TATCGG3' and 5'GCGACATTACGGGGCAGGTGG3', which brackets a 152-base region encoding the 65KD antigen, and a specific probe is 5'TTTGGGGTCATCTTTGGAGCG3'. The procedure could be completed within 2 days. The specificity and the sensitivity of the PCR for M. tuberculosis complex in identifying M. tuberculosis complex did not conflict with the conventional methods at all. Using this method, we could diagnose three cases of the disease, which had been very difficult to diagnose by the conventional methods, by detecting the DNA from the blood, liver biopsy specimen, lung aspirate, and pleural effusion.

AIDS-Related Opportunistic Infections↗
PubMed1992

A randomized trial of reduced doses of azidothymidine in Japanese patients with human immunodeficiency virus type 1 infection.

Adverse reactions to the standard dose (1,200 mg/day-1,500 mg/day) of azidothymidine (AZT) are serious. An in vitro pharmacokinetic study of intracellular AZT-5'-triphosphate suggested the feasibility of a clinical trial with reduced doses of AZT. A randomized trial with reduced doses of AZT (group A; 400 mg/day, n = 15, group B; 800 mg/day, n = 13), was conducted enrolling 28 patients with human immunodeficiency virus infection. The effective rate of AZT on CD4+ lymphocyte counts was similar for both groups, but the duration of the effect of AZT was significantly longer in group A (p less than 0.05). In group B, adverse reactions were more frequently observed (p less than 0.01), and AZT was withdrawn or the dose was reduced more frequently (p less than 0.05). These results suggest that AZT at a dose of 400 mg/day is less toxic, and is more beneficial for long-term treatment.

Adolescent↗