Search PubMed⌕ Search

Biomedical subjects

S Melmed

Publications and source records attributed to S Melmed.

At least 55 records · Page 3Linked to original sources
PubMed1999

Pathogenesis of pituitary tumors.

This article focuses on the molecular events associated with pituitary tumorigenesis. An accurate description of the molecular pathogenesis of pituitary adenomas will have an important impact on clinical practice: identification of specific molecular markers of tumor invasiveness and recurrence will allow earlier therapeutic intervention and selection of appropriate follow-up protocols; family screening may become practically feasible; and potent subcellular therapies may be developed for patients with nonfunctioning tumors, in whom nonsurgical therapies are ineffective, and for those with resistant hormone-secreting tumors.

Animals↗
PubMed1999

Molecular pathogenesis of acromegaly.

Acromegaly is generally caused by growth hormone (GH) hypersecretion from a benign, monoclonal pituitary adenoma. As in other neoplastic conditions, pituitary tumor formation and dysregulated hormone secretion are most likely the ultimate result of a series of genetic alterations. A number of molecular and biochemical defects have been associated with pituitary tumorigenesis. Molecular events such as tumor suppressor gene inactivation and oncogene activation involved in pituitary tumor progression are examined. The role of hypothalamic regulatory hormones and hereditary syndromes involving acromegaly are also discussed.

Acromegaly↗
PubMed1999

Early involvement of estrogen-induced pituitary tumor transforming gene and fibroblast growth factor expression in prolactinoma pathogenesis.

Pituitary tumors are commonly encountered, and result from clonal expansion of a single mutated cell. Hypothalamic hormones, local growth factors and circulating sex steroid hormones promote pituitary tumor growth and expansion into large invasive tumors. Estrogen acting directly through its receptor and by stimulation of fibroblast growth factor regulates prolactin synthesis and secretion. Fibroblast growth factor-2 (bFGF) modulates angiogenesis, tumor formation and progression in many tissues, including the anterior pituitary. A pituitary tumor-derived transforming gene (PTTG) has been isolated, which is tumorigenic in vivo, regulates bFGF secretion, and inhibits chromatid separation. The human PTTG family consists of at least three homologous genes, of which PTTG1 is located on chromosome 5q33 and is expressed at low levels in most normal human tissues but is highly expressed in malignant human cell lines and in pituitary tumors. We report here that pituitary pttg is regulated in vivo and in vitro by estrogen. Maximal induction of rat pituitary pttg mRNA in vivo occurred early in pituitary transformation (normal cell to hypertrophic/hyperplastic cell), coincident with bFGF and vascular endothelial growth factor induction and pituitary angiogenesis. We also demonstrate that pttg expression is induced by bFGF, and show concordant pttg and bFGF expression in experimental and human pituitary adenomas. As bFGF and estrogen both induce pttg, and pttg expression coincides with the early lactotrophic hyperplastic response, angiogenesis and prolactinoma development, we propose a previously unknown paracrine growth factor-mediated mechanism for pituitary tumor pathogenesis and potentially other estrogen-regulated tumors.

3T3 Cells↗
PubMed1999

Leukaemia inhibitory factor enhances tissue factor expression in human monocyte-derived macrophages: a gp130-mediated mechanism.

Leukaemia inhibitory factor (LIF) and interleukin (IL)-6 are members of a cytokine group that share a common signal transducer gp130 and induce pleiotropic biological effects in cells of diverse lineage. In monocytes, LIF facilitates differentiation, which may stimulate the biosynthesis of tissue factor (TF) that initiates the coagulation cascade. We tested the hypothesis that LIF would enhance TF expression in human monocyte-derived macrophages (MDMs). Human peripheral blood mononuclear cells separated from whole blood by density centrifugation were allowed to differentiate into MDMs in primary culture, and were then exposed to LIF, IL-6 and oncostatin M (OSM) for 24 h. LIF and IL-6 receptors, and gp130 were demonstrated in MDMs by immunocytochemistry and RT-PCR. TF procoagulant activity (TF-PCA) was measured by recalcification clotting time and TF protein by Western blotting. The results show that both TF procoagulant activity and TF protein increased significantly in response to LIF over the concentration range of 1-100 nM (P < 0.03). Although OSM and IL-6 tended to enhance TF expression by MDMs, the increase did not reach statistical significance. Anti-LIF receptor and anti-gp130 antibodies attenuated the effect of LIF on TF expression as assayed by both bioassay and flow-cytometry. In conclusion, LIF increases TF-PCA and TF protein in MDMs, and specific anti-LIF receptor antibodies attenuate this effect. Thus, LIF may regulate by a gp130-dependent pathway macrophage-mediated procoagulant function in diverse pathological states involving inflammation and thrombosis and seems to serve as an important mediator at the interface between these processes.

Antigens, CD↗
PubMed1999

Pituitary tumour transforming gene: a novel factor in pituitary tumour formation.

Although pituitary tumours are common monoclonal neoplasms, they rarely metastasize outside the pituitary fossa, even though they cause considerable morbidity and mortality. Many molecular events underlying pituitary tumourigenesis have been elucidated in recent years, but no clear tumour marker has emerged that assists clinical decision-making with regard to appropriate therapy. Activating mutations and a loss of inactivating mutations, together with hypothalamic hormones, circulating hormones, growth factors and cytokines, co-operatively ensure the inexorable expansion of the initial mutated pituitary cell clone. We have recently described a novel oestrogen-regulated activating oncogene, pituitary tumour transforming gene (PTTG), which is potently transforming in vitro and in vivo, regulates basic fibroblast growth factor secretion and inhibits chromatid separation. In experimental animal pituitary tumour models, increased PTTG expression occurs early in cell transformation (from normal to hyperplastic cell), PTTG overexpression being observed in 99% of pituitary tumours. PTTG presents an attractive target for designing subcellular pituitary tumour therapy, and an increased understanding of its role and that of other genetic events in pituitary tumorigenesis may provide novel approaches to pituitary tumour management.

Animals↗
PubMed1999

Stimulatory effect of leukemia inhibitory factor on ACTH secretion of dispersed rat pituitary cells.

Cytokines are recognized to play an important role in modulating the immune and neuroendocrine system. We recently reported leukemia inhibitory factor (LIF) increased ACTH secretion and pro-opiomelanocortin mRNA level in the murine corticotroph tumor cell line (AtT-20). In this study, the expression of LIF in normal rat pituitary could be demonstrated by ribonuclease protection assay. LIF (1 nM) caused a slight, but significant increase in ACTH secretion (43.7% increase versus control, P<0.01), while showing statistically no significant change of growth hormone and prolactin level in dispersed rat pituitary cells. CRH (10 nM) also induced ACTH secretion 2.5-fold (P<0.01), and co-treatment of LIF and CRH exhibited 2.8-fold increase of ACTH secretion but no statistical difference from CRH treated group. These findings suggest that LIF also has same enhancing effect of ACTH secretion in primary pituitary cultured cells of rat as in AtT-20 cell and LIF acts as a paracrine or autocrine factor to modulate neuroendocrine function in the pituitary.

Adrenocorticotropic Hormone↗
PubMed1999

Inhibitory roles for SHP-1 and SOCS-3 following pituitary proopiomelanocortin induction by leukemia inhibitory factor.

Leukemia inhibitory factor (LIF) is a pleiotropic cytokine that stimulates the hypothalamo-pituitary-adrenal (HPA) axis through JAK-STAT activation. We show here that LIF-induced JAK2 and STAT3 tyrosine phosphorylation is transient, disappearing within 20 and 40 minutes, respectively. LIF activates the SH2 domain-containing tyrosine phosphatase, SHP-1, with maximal stimulation observed at 30 minutes. SHP-1 is constitutively associated with JAK2, and LIF induces recruitment of phosphorylated STAT3 to this complex. Overexpression of wild-type or dominant negative forms of SHP-1 shows decreased or increased LIF-induced proopiomelanocortin (POMC) promoter activity, respectively. LIF-induced JAK2 and STAT3 dephosphorylation is delayed until after 60 minutes in cells that overexpress the mutant SHP-1. In addition, SOCS-3, a negative regulator of LIF signaling, binds to JAK2 after 60 minutes of LIF stimulation, after which the complex is degraded by the proteasome. SOCS-3 overexpression blocks LIF-induced JAK2 tyrosine phosphorylation, confirming a role for SOCS-3 in deactivating JAK2 by direct association. Using SOCS-3 fusion proteins, we also define regions of the SOCS-3 protein that are critical for inhibition of LIF-induced POMC promoter activity. Corticotrophic signaling by LIF is thus subject to 2 forms of negative autoregulation: dephosphorylation of JAK2 and STAT3 by the SHP-1 tyrosine phosphatase, and SOCS-3-dependent inactivation of JAK2.

Animals↗
PubMed1999

Interleukin-11 stimulates proopiomelanocortin gene expression and adrenocorticotropin secretion in corticotroph cells: evidence for a redundant cytokine network in the hypothalamo-pituitary-adrenal axis.

We recently characterized leukemia inhibitory factor (LIF) as an important modulator of hypothalamo-pituitary-adrenal (HPA) axis activity. We now describe the role of interleukin (IL)-11, another member of the IL-6 cytokine family, in the neuro-immuno-endocrine modulation of the HPA axis. In murine hypothalamus, pituitary and corticotroph AtT-20 cells, IL-11 messenger RNA (mRNA) was detectable by RT-PCR only, whereas IL-11R mRNA transcripts were demonstrated by Northern blot. Using RT-PCR, IL-11 and IL-11R gene expression were also detected in normal human pituitaries, as well as in corticotropic and nonfunctioning pituitary adenomas. Incubation of AtT-20 cells for 24 h with 10(-9) M IL-11 stimulated ACTH secretion 1.4 +/- 0.1-fold (P < 0.01), whereas LIF at the same concentration caused a 1.5 +/- 0.1-fold increase (P < 0.001). POMC mRNA expression was induced by IL-11 (0.5 x 10(-9) M) and LIF (0.5 x 10(-9) M) 1.5 +/- 0.18-fold (P < 0.05) and 1.7 +/- 0.13-fold (P < 0.01), respectively. POMC promoter activity, assayed by a -706/+64 rat POMC promoter-luciferase construct, was stimulated by 0.5 x 10(-9) M IL-11 (1.9 +/- 0.06-fold; P < 0.001) and 5 mM Bu2cAMP (7.1 +/- 0.52-fold, P < 0.001), and combined treatment of IL-11 plus Bu2cAMP caused a synergistic 11.7+/-0.71-fold increase ofluciferase activity (P < 0.001 vs. Bu2cAMP alone). Gene expression of SOCS-3, an intracellular inhibitor of cytokine action, peaked as early as 60 min after incubation with IL-11 (0.5 x 10(-9) M) and was induced 3.5-fold. In comparison to mock-transfected AtT-20 cells (AtT-20M), stable overexpression of SOCS-3 (AtT-20S) resulted in significant inhibition of ACTH secretion induced by IL-11 alone (1.5 +/- 0.09 vs. 1.1 +/- 0.04-fold induction, P < 0.01) and IL-11 plus Bu2cAMP (2.1 +/- 0.21 vs. 1.5 +/- 0.06-fold, P < 0.05), but not by Bu2cAMP alone (1.5 +/- 0.12 vs. 1.4 +/- 0.06). In summary, human and murine pituitary express IL-11 and IL-11R transcripts. In murine corticotroph AtT-20 cells, IL- 11 induces POMC gene transcription and ACTH secretion. IL-11 induction of SOCS-3 indicates an intracellular negative feedback control of cytokine-induced POMC expression and ACTH secretion. Thus, IL-11 regulates the HPA axis similarly to LIF, providing further evidence for a redundant cytokine network in the neuro-immuno-endocrine regulation of the HPA axis.

Adenoma↗
PubMed1999

Loss of heterozygosity on chromosome 11q13 in two families with acromegaly/gigantism is independent of mutations of the multiple endocrine neoplasia type I gene.

Familial acromegaly/gigantism occurring in the absence of multiple endocrine neoplasia type I (MEN-1) or the Carney complex has been reported in 18 families since the biochemical diagnosis of GH excess became available, and the genetic defect is unknown. In the present study we examined 2 unrelated families with isolated acromegaly/gigantism. In family A, 3 of 4 siblings were affected, with ages at diagnosis of 19, 21, and 23 yr. In family B, 5 of 13 siblings exhibited the phenotype and were diagnosed at 13, 15, 17, 17, and 24 yr of age. All 8 affected patients had elevated basal GH levels associated with high insulin-like growth factor I levels and/or nonsuppressible serum GH levels during an oral glucose tolerance test. GHRH levels were normal in affected members of family A. An invasive macroadenoma was found in 6 subjects, and a microadenoma was found in 1 subject from family B. The sequence of the GHRH receptor complementary DNA in 1 tumor from family A was normal. There was no history of consanguinity in either family, and the past medical history and laboratory results excluded MEN-1 and the Carney complex in all affected and unaffected screened subjects. Five of 8 subjects have undergone pituitary surgery to date, and paraffin-embedded pituitary blocks were available for analysis. Loss of heterozygosity on chromosome 11q13 was studied by comparing microsatellite polymorphisms of leukocyte and tumor DNA using PYGM (centromeric) and D11S527 (telomeric), markers closely linked to the MEN-1 tumor suppressor gene. All tumors exhibited a loss of heterozygosity at both markers. Sequencing of the MEN-1 gene revealed no germline mutations in either family, nor was a somatic mutation found in tumor DNA from one subject in family A. The integrity of the MEN-1 gene in this subject was further supported by demonstration of the presence of MEN-1 messenger ribonucleic acid, as assessed by RT-PCR. These data indicate that loss of heterozygosity in these affected family members appears independent of MEN-1 gene changes and suggest that a novel (tissue-specific?) tumor suppressor gene(s) linked to the PYGM marker and expressed in the pituitary is essential for regulation of somatotrope proliferation.

Acromegaly↗
PubMed1999

Pituitary tumor transforming gene (PTTG) expression in pituitary adenomas.

We recently cloned a novel pituitary tumor transforming gene (PTTG). Here we report PTTG expression in human pituitary adenomas and in normal pituitary tissue. In situ hybridization revealed PTTG expression in nonfunctioning and in GH-secreting adenomas but not in normal pituitary tissue. Using a more sensitive detection method, RT-PCR, low level PTTG expression was detected in normal pituitary. However, when expression levels in normal pituitary tissue were compared with those in 54 pituitary tumors using comparative reverse transcription polymerase chain reaction (RT-PCR), we found that most tumor samples expressed higher levels of PTTG. More than 50% PTTG increases were observed in 23 of 30 nonfunctioning pituitary tumors, all 13 GH-producing tumors, 9 of 10 prolactinomas, and 1 ACTH-secreting tumor, with more than 10-fold increases evident in some tumors. Furthermore, higher PTTG expression (P = 0.03) was observed in hormone-secreting tumors that had invaded the sphenoid bone (stages III and IV; 95% CI 3.118-9.715) compared with hormone-secreting tumors that were confined to the pituitary fossa (stages I and II; 95% CI 1.681-3.051). Therefore, PTTG abundance is a molecular marker for invasiveness in hormone-secreting pituitary tumors. The ubiquitous and prevalent expression of pituitary adenoma PTTG suggests that PTTG plays a role in pituitary tumorigenesis and invasiveness.

Adenoma↗
PubMed1999

An intronless homolog of human proto-oncogene hPTTG is expressed in pituitary tumors: evidence for hPTTG family.

A novel proto-oncogene, PTTG (Pituitary Tumor Transforming Gene), was isolated in our laboratory by virtue of its increased expression in rat pituitary tumor cell lines. Cells which overexpress human or rat PTTG form tumors in athymic mice. hPTTG is highly expressed in cancer cell lines, pituitary adenomas and in normal testis, suggesting that hPTTG protein has different tissue-specific interactions in normal cells and in cancer. Alternatively, different hPTTG gene family members may be functional in normal development and in tumorigenesis. While mapping the chromosomal location of hPTTG to 5q33, we discovered a second gene, hPTTG2, which is intronless and maps to chromosome 4p12. Using gene-specific oligonucleotide hybridization in a PCR-ELISA assay, we determined that hPTTG2 is expressed in both normal and tumorous pituitary. However, high levels of hPTTG mRNA in cancer cell lines are due to increased expression of hPTTG1. Thus, this family of proto-oncogenes appears to differentially participate in tumor-specific pathogenesis.

Chromosome Mapping↗
PubMed1999

In vivo and in vitro regulation of thyroid leukemia inhibitory factor (LIF): marker of hypothyroidism.

Several cytokines regulate thyroid function and may be involved in the pathogenesis of thyroid disorders, including euthyroid sick syndrome. Leukemia inhibitory factor (LIF), a neuroimmune pleiotropic cytokine, was measured to assess its role in hypothalamic-pituitary-thyroid function. Mean circulating serum LIF levels in 10 hypothyroid patients [TSH, 23+/-0.5 mIU/L (mean+/-SEM); free T4, 0.77+/-0.1 ng/dL] was 0.29+/-0.04 ng/mL, 145% higher (P < 0.04) than in 20 normal subjects (LIF, 0.20+/-0.02 ng/mL; TSH, 2.23+/-0.21 mIU/L; free T4, 1.23+/-0.04 ng/dL) but was not different from those in 10 hyperthyroid patients (LIF, 0.21+/-0.03 ng/mL; TSH, 0.01+/-0.00 mIU/L; free T4, 3.63+/-0.51 ng/dL). Serum LIF concentrations linearly correlated with serum TSH in the 40 samples (r = 0.58, P < 0.001). When T4 (1-8 microg/kg x day) was administered to cynomolgus monkeys with methimazole-induced hypothyroidism, serum T4 and T3 levels increased appropriately, and TSH and LIF concentrations decreased. When methimazole was given alone, both serum TSH (146+/-30 mIU/L) and LIF (8.84+/-0.49 ng/mL) were markedly induced. When methimazole together with T4 (>2 microg/kg x day) was administered, both serum TSH (7.5+/-1.2 mIU/L) and LIF (6.22+/-0.31 ng/mL) were lowered (P < 0.01). Monkey serum LIF levels and log TSH levels also correlated (r = 0.72, P < 0.01). Cultured thyroid carcinoma cells produced LIF (9.2 ng/10(6) cells/48 h). TSH (100 mIU/mL) and interleukin (IL)-6 (10 nmol/L) stimulated in vitro LIF secretion from the cells by 170+/-12% (P < 0.05) and 261+/-8% (P < 0.05), respectively. Dexamethasone (1 micromol/L) inhibited basal LIF concentration by 83% (P < 0.05), whereas TSH and IL-6 stimulated LIF by 52% (P = 0.04) and 42% (P = 0.03), respectively. However, using Northern blot analysis, we could not observe induction of LIF mRNA by TSH, suggesting that LIF regulation by TSH may be due to stimulation of secretion. The results show that the thyroid gland is a source of LIF production; TSH, IL-6, and glucocorticoid influence thyroid cell LIF expression. The correlation between TSH and LIF suggests that LIF may participate in the physiologic regulation of hypothalamic-pituitary-thyroid function.

Animals↗
PubMed1999

Structure, expression, and function of human pituitary tumor-transforming gene (PTTG).

Despite advances in characterizing the pathophysiology and genetics of pituitary tumors, molecular mechanisms of their pathogenesis are poorly understood. Recently, we isolated a transforming gene [pituitary tumor-transforming gene (PTTG)] from rat pituitary tumor cells. Here we describe the cloning of human PTTG, which is located on chromosome 5q33 and shares striking sequence homology with its rat counterpart. Northern analysis revealed PTTG expression in normal adult testis, thymus, colon, small intestine, brain, lung, and fetal liver, but most abundant levels of PTTG mRNA were observed in several carcinoma cell lines. Stable transfection of NIH 3T3 cells with human PTTG cDNA caused anchorage-independent transformation in vitro and induced in vivo tumor formation when transfectants were injected into athymic mice. Overexpression of PTTG in transfected NIH 3T3 cells also stimulated expression and secretion of basic fibroblast growth factor, a human pituitary tumor growth-regulating factor. A proline-rich region, which contains two PXXP motifs for the SH3 domain-binding site, was detected in the PTTG protein sequence. When these proline residues were changed by site-directed mutagenesis, PTTG in vitro transforming and in vivo tumor-inducing activity, as well as stimulation of basic fibroblast growth factor, was abrogated. These results indicate that human PTTG, a novel oncogene, may function through SH3-mediated signal transduction pathways and activation of growth factor(s).

3T3 Cells↗
PubMed1998

Functional map of a placenta-specific enhancer of the human leukemia inhibitory factor receptor gene.

We recently reported a placenta-specific enhancer in the human leukemia inhibitory factor receptor (LIFR) gene and now show detailed characterization of the 226-base pair enhancer (-4625/-4400 nucleotides). Four of twenty-two mutants in linker analysis showed reduced promoter activities to 45, 30, 10, and 10%, respectively. Specific binding of region A (-4617/-4602) with nuclear extract was competed by a known Oct-1 oligo and supershifted by Oct-1 antibody. Specific binding of region B (-4549/-4535) was competed by a GATA oligo, but could not be supershifted by four GATA antibodies. Nevertheless, mutagenesis showed that critical bases in region B were identical to the GATA core motif, indicating that region B may bind to a novel GATA family transcription factor. The other two adjacent regions designated as region C (-4464/-4445) showed no known consensus binding sites, and their specific placental JEG-3 nuclear extract binding was not evident in nonplacental nuclear extracts and was not competed by a trophoblast specific element (TSE), indicating that region C is a novel placenta-specific element (PSE, CATTTCCTGAACTAGTTTTT). Footprinting localized the binding boundary of PSE-binding protein (PSEB), and three Gs were found to be important for specific PSE binding. UV cross-linking showed that PSEB had a molecular mass of approximately 160 kDa, substituting the PSE with two previously reported placenta elements TSE or chorionic somatomammotropin enhancer factor 1 (CSEF-1) motifs resulted in markedly different promoter activities, indicating that PSEB is indeed different from TSE binding protein or CSEF-1. These results are the first demonstration that a novel PSE is the major element for placenta-specific enhancer activity in human LIFR gene.

Binding Sites↗
PubMed1998

Management of pituitary tumors.

Management of pituitary tumors has improved in the past decade since the introduction of novel therapeutic agents. As a result, several treatment options are now available. Dopamine agonists are the preferred treatment for both symptomatic microprolactinomas and macroprolactinomas; these drugs result in normalization of hormone levels and tumor shrinkage in most treated patients. New formulations (such as cabergoline and parenteral bromocriptine) with prolonged duration of action offer improved compliance with treatment and cure rates. For acromegaly and adrenocorticotropin hormone (ACTH)-secreting, thyroid-stimulating hormone (TSH)-secreting, and nonfunctional adenomas, surgery often results in cure. Octreotide and the long-acting, slow-release somatostatin analogues are effective medical alternatives to or adjuvants for transsphenoidal surgery in patients with growth hormone-secreting and TSH-secreting tumors. No drug treatment is available for symptomatic nonfunctional tumors, and patients with ACTH-secreting adenomas may benefit from cortisol-lowering drugs after surgical failure. Pituitary irradiation may be required after surgery for ACTH-secreting, TSH-secreting, and nonfunctioning tumors; it is less commonly required for acromegaly. Although many pituitary tumors are successfully resected, functional adenomas may not be cured by surgery. As more-effective drugs are introduced for the management of pituitary tumors, more patients with hormone-secreting adenomas are being successfully treated medically.

Adenoma↗
PubMed1998

Leukemia inhibitory factor regulates proopiomelanocortin transcription.

Leukemia inhibitory factor (LIF), a pleiotropic cytokine, is expressed in both fetal and adult pituitary tissue, and LIF immunoreactivity is found in functional human pituitary tumors. LIF induces basal, and augments CRH-induced, POMC mRNA and ACTH secretion from AtT20 cells. Therefore, we examined LIF signaling and LIF regulation of POMC expression in AtT20 cells. Immunoneutralization studies demonstrated the dependence of LIF action on both the specific LIF receptor (35% inhibition; p < 0.05) and also the gpl30 affinity converter (41% inhibition; p < 0.05). These antisera also attenuate basal ACTH secretion without added LIF. LIF rapidly induced tyrosyl phosphorylation of both STAT 1 alpha, and STAT beta and also induced phosphorylation of a novel STAT 1 alpha related protein p115. LIF induced POMC transcription (-706/+64) and strikingly potentiated CRH action (up to 18-fold induction). This synergy involved cAMP-dependent pathways, as forskolin action was also potentiated by LIF. Deletion of the major CRH-responsive region in POMC (-323/-166) abolished both CRH and LIF action on POMC transcription. Thus LIF action in pituitary corticotrophs is dependent on LIF receptor heterodimerisation with gpl30 and involves STAT protein tyrosyl phosphorylation. LIF enhances POMC transcription and strongly potentiates the well-documented action of CRH on the POMC gene. These results define a subcellular mechanism for an immuno-neuroendocrine interface between peripheral afferent signals and the HPA axis.

Adrenocorticotropic Hormone↗