Search PubMed⌕ Search

Biomedical subjects

S M Cutts

Publications and source records attributed to S M Cutts.

At least 19 recordsLinked to original sources
PubMed2001

Barminomycin functions as a potent pre-activated analogue of Adriamycin.

The anthracycline Adriamycin is known to form adducts with DNA, but requires prior activation by formaldehyde. In contrast, the anthracycline barminomycin is also able to form adducts with DNA, but does not require activation by formaldehyde. Barminomycin, therefore, appears to function as a pre-activated form of Adriamycin. The DNA adducts formed by both anthracyclines are bound covalently to only one strand of DNA, but both also stabilise duplex DNA sufficiently that they can be detected as virtual interstrand crosslinks in heat denaturation electrophoretic crosslinking assays. The barminomycin-DNA adducts form extremely rapidly with DNA, and at exceedingly low concentrations (approximately 50-fold lower than with Adriamycin in the presence of excess formaldehyde), both characteristics consistent with barminomycin being in a pre-activated state, hence, undergoing a bimolecular reaction with DNA compared with the trimolecular reaction (drug, formaldehyde and DNA) required with Adriamycin. Surprisingly, barminomycin-DNA adducts are substantially more stable (essentially irreversible) than Adriamycin-DNA adducts (half life of approximately 25 h at 37 degrees C). Due to this understanding of the reactivity of barminomycin and its exceptional cytotoxicity (1000-fold more cytotoxic than Adriamycin), detailed structural studies of barminomycin-DNA adducts are now warranted, both in vitro and in tumour cells.

Animals↗
PubMed2001

Molecular basis for the synergistic interaction of adriamycin with the formaldehyde-releasing prodrug pivaloyloxymethyl butyrate (AN-9).

The interaction of Adriamycin and pivaloyloxymethyl butyrate (AN-9) was investigated in IMR-32 neuroblastoma and MCF-7 breast adenocarcinoma cells. Adriamycin is a widely used anticancer drug, whereas AN-9 is an anticancer agent presently undergoing Phase II clinical trials. The anticancer activity of AN-9 has been attributed to its ability to act as a butyric acid prodrug, although it also releases formaldehyde and pivalic acid. Adriamycin and AN-9 in combination display synergy when exposed simultaneously to cells or when AN-9 treatment is up to 18 h after Adriamycin administration. However, the reverse order of addition results in antagonism. These interactions have been established using cell viability assays and classical isobologram analysis. To understand the molecular basis of this synergy, the relative levels of Adriamycin-DNA adducts were determined using various treatment combinations. Levels of Adriamycin-DNA adducts were enhanced when treatment combinations known to be synergistic were used and were diminished using those treatments known to be antagonistic. The relative timing of the addition of Adriamycin and AN-9 was critical, with a 20-fold enhancement of Adriamycin-DNA adducts occurring when AN-9 was administered 2 h after the exposure of cells to Adriamycin. The enhanced levels of these adducts and the accompanying decreased cell viability were directly related to the esterase-dependent release of formaldehyde from AN-9, providing evidence for the formaldehyde-mediated activation of Adriamycin.

Adenocarcinoma↗
PubMed2001

Construction of neocentromere-based human minichromosomes by telomere-associated chromosomal truncation.

Neocentromeres (NCs) are fully functional centromeres that arise ectopically in noncentromeric regions lacking alpha-satellite DNA. Using telomere-associated chromosome truncation, we have produced a series of minichromosomes (MiCs) from a mardel(10) marker chromosome containing a previously characterized human NC. These MiCs range in size from approximately 0.7 to 1.8 Mb and contain single-copy intact genomic DNA from the 10q25 region. Two of these NC-based Mi-Cs (NC-MiCs) appear circular whereas one is linear. All demonstrate stability in both structure and mitotic transmission in the absence of drug selection. Presence of a functional NC is shown by binding a host of key centromere-associated proteins. These NC-MiCs provide direct evidence for mitotic segregation function of the NC DNA and represent examples of stable mammalian MiCs lacking centromeric repeats.

Cell Line↗
PubMed2001

Cytosine methylation enhances mitoxantrone-DNA adduct formation at CpG dinucleotides.

Recently, we have shown that mitoxantrone can be activated by formaldehyde in vitro to form DNA adducts that are specific for CpG and CpA sites in DNA. The CpG specificity of adduct formation prompted investigations into the effect of cytosine methylation (CpG) on adduct formation, since the majority of CpG dinucleotides in the mammalian genome are methylated and hypermethylation in subsets of genes is associated with various neoplasms. Upon methylation of a 512-base pair DNA fragment (containing the lac UV5 promoter) using HpaII methylase, three CCGG sites downstream of the promoter were methylated at C5 of the internal cytosine residue. In vitro transcription studies of mitoxantrone-reacted DNA revealed a 3-fold enhancement in transcriptional blockage (and hence adduct formation) exclusively at these methylated sites. In vitro cross-linking assays also revealed that methylation enhanced mitoxantrone adduct formation by 2-3-fold, and methylation of cytosine at a single potential drug binding site on a duplex oligonucleotide also enhanced adduct levels by 3-fold. Collectively, these results indicate preferential adduct formation at methylated CpG sites. However, adducts at these methylated sites exhibited the same stability as nonmethylated sites, suggesting that cytosine methylation increases drug accessibility to DNA rather than being involved in kinetic stabilization of the adduct.

Base Pairing↗
PubMed2001

The binding of [(en)Pt(mu-dpzm)2Pt(en)]4+ to G/C-rich regions of DNA.

The non-covalent binding of [(en)Pt(mu-dpzm)2Pt(en)]4+ to segments of DNA containing only G and C bases has been studied to gain an understanding of the pre-covalent binding association of cationic polynuclear platinum(II) anti-cancer drugs at G/C sites. 1H-NMR and CD spectroscopy were used to study the binding of the metal complex to the oligonucleotide d(GC)5 and the polynucleotide poly(dG-dC).poly(dG-dC), respectively. NOE contacts between the metal complex protons and the oligonucleotide sugar H1' protons observed in NOESY spectra indicated that the metal complex bound in the minor groove at the central C4 to G7 region of the oligonucleotide. This result indicates that even though cationic polynuclear platinum(II) complexes bind covalently in the major groove at G/C sites, the pre-covalent binding association is favoured in the minor groove. CD spectra indicated that the addition of the metal complex to poly(dG-dC)-poly(dG-dC) induced some conformational changes, but it was not possible to conclude that [(en)Pt(mu-dpzm)2Pt(en)]4+ induced a B- to Z-type DNA transition. In addition, in vitro transcription assays using the lac UV5 promoter showed that the non-covalent binding of [(en)Pt(mu-dpzm)2Pt(en)]4+ was sufficiently stable to inhibit transcription, and at particular sites.

Antineoplastic Agents↗
PubMed2000

Interstrand cross-linking by adriamycin in nuclear and mitochondrial DNA of MCF-7 cells.

Activation of Adriamycin by formaldehyde leads to the formation of drug-DNA adducts in vitro and these adducts stabilise the DNA to such a degree that they function as virtual interstrand cross-links. The formation of these virtual interstrand cross-links by Adriamycin was investigated in MCF-7 cells using a gene-specific interstrand cross-linking assay. Cross-linking was measured in both the nuclear-encoded DHFR gene and in mitochondrial DNA (mtDNA). Cross-link formation increased linearly with Adriamycin concentration following a 4 h exposure to the drug. The rate of formation of Adriamycin cross-links in each of the genomes was similar, reaching maximal levels of 0.55 and 0.4 cross-links/10 kb in the DHFR gene and mtDNA respectively, following exposure to 20 micro M Adriamycin for 8 h. The interstrand cross-link was short lived in both DNA compartments, with a half-life of 4.5 and 3.3 h in the DHFR gene and mtDNA respectively. The kinetics of total Adriamycin adduct formation, detected using [(14)C]Adriamycin, was similar to that of cross-link formation. Maximal adduct levels (30 lesions/10 kb) were observed following incubation at 20 micro M drug for 8 h. The formation of such high levels of adducts and cross-links could therefore be expected to contribute to the mechanism of action of Adriamycin.

Carbon Radioisotopes↗
PubMed2000

Formaldehyde activation of mitoxantrone yields CpG and CpA specific DNA adducts.

Recently we have found that mitoxantrone, like Adria-mycin, can be activated by formaldehyde and subsequently form adducts which stabilise double-stranded DNA in vitro. This activation by formaldehyde may be biologically relevant since formaldehyde levels are elevated in those tumours in which mitoxan-trone is most cytotoxic. In vitro transcription analysis revealed that these adducts block the progression of RNA polymerase during transcription and cause truncated RNA transcripts. There was an absolute requirement for both mitoxantrone and formaldehyde in transcriptional blockage formation and the activated complex was found to exhibit site specificity, with blockage occurring prior to CpG and CpA sites in the DNA (non-template strand). The stability of the adduct at 37 degrees C was site dependent. The half-lives ranged from 45 min to approximately 5 h and this was dependent on both the central 2 bp blockage site as well as flanking sequences. The CpG specificity of mitoxantrone adduct sites was also confirmed independently by a lambda exonuclease digestion assay.

Base Sequence↗
PubMed2000

Poly(ADP-ribose) polymerase at active centromeres and neocentromeres at metaphase.

A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequences as affinity substrates has indicated either significantly reduced or no detectable PARP purification, suggesting preferential but not absolute sequence-specific binding. Immunofluorescence analysis of human and sheep metaphase cells using a polyclonal anti-PARP antibody revealed centromeric localization of PARP, with diffuse signals also seen on the chromosome arms. Similar results were observed for mouse chromosomes except for a significantly enlarged PARP-binding region around the core centromere-active domain, suggesting possible 'spreading' of PARP into surrounding non-core centromeric domains. Enhanced PARP signals were also observed on alpha-satellite-negative human neo- centromeres and on the active but not the inactive alpha-satellite-containing centromere of a human dicentric chromosome. PARP signals were absent from the q12 heterochromatin of the Y chromosome, suggesting a correlation of PARP binding with centromere function that is independent of heterochromatic properties. Preliminary cell cycle analysis indicates detectable centromeric association of PARP during S/G(2)phase and that the total proportion of PARP that is centromeric is relatively low. Strong binding of PARP to different centromere sequence motifs may offer a versatile mechanism of mammalian centromere recognition that is independent of primary DNA sequences.

Animals↗
PubMed2000

Structural requirements for the formation of anthracycline-DNA adducts.

A series of anthracyclines (comprising carminomycins I, II and III, and barminomycin) were tested for their ability to react with DNA to form site-specific adducts using an in vitro transcription assay. The requirement for drug activation by formaldehyde was also assessed using a transcription assay and HPLC analysis of GC-containing oligonucleotide duplexes. In the absence of formaldehyde, barminomycin was the most reactive compound and carminomycin I the least reactive. The DNA sequence specificity of all anthracyclines was similar (the most intense binding sites being 5'-GC sequences), although barminomycin was the most selective for 5'-GC. Barminomycin adducts were the most stable at 37 degrees C (no loss in the 48 h time frame studied) while carminomycin II and III lesions were least stable (each with a half-life of approximately 4-5 h). These results are discussed collectively in terms of the requirement and contribution of structural elements of the anthracyclines for the formation of DNA adducts.

Anthracyclines↗
PubMed1999

Defective chromosome segregation, microtubule bundling and nuclear bridging in inner centromere protein gene (Incenp)-disrupted mice.

INCENP is a chromosomal passenger protein which relocates from the centromere to thel spindle midzone during the metaphase-anaphase transition, ultimately being discarded in the cell midbody at the completion of cytokinesis. Using homologous recombination, we have generated Incenp gene-targeted heterozygous mice that are phenotypically indistinguishable from their wild-type littermates. Intercrossing the hetero-zygotes results in no live-born homozygous Incenp -disrupted progeny, indicating an early lethality. Day 3.5 affected pre-implantation embryos contain large, morphologically abnormal cells that fail to fully develop a blastocoel cavity or thrive in utero and in culture. Chromatin and tubulin immunocytochemical stainings of these and day 2.5 affected embryos reveal a high mitotic index, no discernible metaphase or anaphase stages, complete absence of midbodies, micronuclei formation, morphologically irregular macronuclei with large chromosome complements, multipolar mitotic configurations, binucleated cells, internuclear bridges and abnormal spindle bundling. The phenotype is consistent with a defect in the modulation of microtubule dynamics, severely affecting chromosome segregation and resulting in poorly resolved chromatin masses, aberrant karyokinesis and internuclear bridge formation. These latter occurrences could pose a physical barrier blocking cytokinesis.

Animals↗
PubMed1998

Centromere protein B null mice are mitotically and meiotically normal but have lower body and testis weights.

CENP-B is a constitutive centromere DNA-binding protein that is conserved in a number of mammalian species and in yeast. Despite this conservation, earlier cytological and indirect experimental studies have provided conflicting evidence concerning the role of this protein in mitosis. The requirement of this protein in meiosis has also not previously been described. To resolve these uncertainties, we used targeted disruption of the Cenpb gene in mouse to study the functional significance of this protein in mitosis and meiosis. Male and female Cenpb null mice have normal body weights at birth and at weaning, but these subsequently lag behind those of the heterozygous and wild-type animals. The weight and sperm content of the testes of Cenpb null mice are also significantly decreased. Otherwise, the animals appear developmentally and reproductively normal. Cytogenetic fluorescence-activated cell sorting and histological analyses of somatic and germline tissues revealed no abnormality. These results indicate that Cenpb is not essential for mitosis or meiosis, although the observed weight reduction raises the possibility that Cenpb deficiency may subtly affect some aspects of centromere assembly and function, and result in reduced rate of cell cycle progression, efficiency of microtubule capture, and/or chromosome movement. A model for a functional redundancy of this protein is presented.

Animals↗
PubMed1996

Adriamycin-induced DNA adducts inhibit the DNA interactions of transcription factors and RNA polymerase.

Adriamycin is known to specifically induce DNA interstrand cross-links at 5'-GC sequences. Because 5'-GC sequences are a predominant feature of 5'-untranslated regions (transcription factor-binding sites, promoter, and enhancer regions), it is likely that adriamycin adducts at GC sites would affect the binding of DNA-interacting proteins. Two model systems were chosen for the analysis: the octamer-binding proteins Oct-1, N-Oct-3 and N-Oct-5, which bind to ATGCAAAT and TAATGARAT recognition sites, and Escherichia coli RNA polymerase binding to the lac UV5 promoter. Electrophoretic mobility shift studies showed that adriamycin adducts at GC sites inhibited the binding of octamer proteins to their consensus motifs at drug levels as low as 1 micoM, but no effect was observed with a control sequence lacking a GC site. Adriamycin adducts at GC sites also inhibited the binding of RNA polymerase to the lac UV5 promoter. Adriamycin may therefore function by down-regulating the expression of specific genes by means of inactivation of short but critical motifs containing one or more GC sites.

Antibiotics, Antineoplastic↗
PubMed1995

Use of oligonucleotides to define the site of interstrand cross-links induced by Adriamycin.

It has been known for several years that Adriamycin forms adducts and interstrand cross-links when reacted for long periods of time with bacterial and mammalian DNA in vitro, with the cross-link being restricted to 2 bp elements containing GpC sequences. The self-complementary 20mer deoxyoligonucleotide TA4T4GCA4T4A has been used in this study as a model of the apparent G-G cross-linking site at GpC sequences. The rate of formation of cross-links, as well as the dependence on both Adriamycin and Fe(III) concentration, were similar with this oligonucleotide as compared with calf thymus DNA. The cross-linking was demonstrated on both denaturing and non-denaturing sequencing gels. The half-life of the G-G cross-link was 40 h, consistent with that implied with high molecular weight, heterogeneous sequence DNA. Exonuclease III digests of adducts formed with 20mer deoxyoligonucleotides containing single, central G-G, G-I and I-I potential cross-links revealed that a guanine residue is required at both ends of the cross-link. No cross-linking was observed with a similar oligonucleotide containing only a single central (G.C) bp.

Animals↗
PubMed1995

Stability of adriamycin-induced DNA adducts and interstrand crosslinks.

The stability of adriamycin-induced DNA adducts and interstrand crosslinks was measured at 37 degrees C by three independent procedures. The loss of [14C]-labelled adducts was described by two first-order decays with half-lives of 7.4 h (60% amplitude) and 39 h (40%). The loss of the drug chromophore also exhibited a biphasic character, with half-lives of 6 h (65%) and approximately 150 h (35%). The decay of transcriptional blockages at an isolated, apparent interstrand GpC crosslinking site was described by two first-order processes, with half-lives of 3 h (65%) and 40 h (35%), whereas the decay of transcriptional blockages at an isolated guanine residue (apparent site of monoadduct) was completely described by a first-order decay with a half-life of 5.3 h. The loss of interstrand crosslinks was measured using a gel electrophoresis assay, and the decay was characterised by a single first-order process with a half-life of 4.7 h. Collectively, these values serve to define a model of the interstrand crosslink with unstable sites of attachment at both ends of the crosslink, with half-lives at either end being approximately 5 and 40 h. The adducts exhibited increasing lability with increasing pH, and were particularly unstable at pH 12, with a half-life of approximately 0.5 h. The adducts were also heat labile, with an overall melting temperature of 67 degrees C (10 min exposure) and this was also the thermal lability measured at three individual adduct sites probed by lambda exonuclease.

Animals↗