Biomedical subjects

S Liu

Publications and source records attributed to S Liu.

At least 397 records · Page 22Linked to original sources

PubMed2000

[Effect of reperfusion after local ischaemia on the M receptor density in rat brains].

OBJECTIVE: To study the dynamic changes in the density of muscarinic acetylcholine receptor in different areas of rat brains during reperfusion after local ischaemia. METHODS: The rat cerebral focal ischemia/reperfusion model after middle cerebral artery occlusion was made by the intraluminal suture method. Using 3H-QNB as radioligand, after binding with M receptor on the brain slice of the rat model, the brain samples were exposed on the hypersensitive film [H-3] to complete autoradiography, and the density of M receptor in different areas on the film of autoradiography was measured. RESULTS: There were no changes in the M receptor density in 2 hours' ischaemia group and 2 hours' reperfusion group, M receptor densities in the area of occipital cortex (OC) and temporal cortex (TC) were observed to decrease significantly in 8 hours' reperfusion group, but the degree of decrease was lower than 24 hours' and 72 hours' reperfusion groups, there was significant decrease in the density of M receptor in the areas of caudate putamen (CP), frontal cortex (FC), TC, OC of the 24 hours' and 72 hours' reperfusion groups and no difference was found between these two groups, and the imaging of M receptor in the domains with decreased receptor was obvious. CONCLUSIONS: The quantity of M receptor did not change right after ischaemia or reperfusion. It decreased gradually after an interval of time; Imaging of the M receptor could assess the changes of the density of viable cholinergic neurons and be a marker of diagnosis, therapy, and prognosis of brain ischaemia.

Animals↗

PubMed2000

[Detection of hyperdiploid in malignant cells in fine-needle aspirates from lung cancer by fluorescence in situ hybridization].

OBJECTIVE: To study the numerical abnormality of chromosomes in malignant cells in fine-needle aspirates from lung cancer by fluorescence in situ hybridization (FISH). METHODS: 30 fine-needle aspirates from lung cancer (4 from lung tissues, 26 from lymph nodes) were detected by FISH with the centromere DNA probes for chromosome 7, 11, 17 and X. RESULTS: In 27 positive fine-needle aspirates the rates of hyperdiploid in chromosome 7, X, 17, and 11 were 81.5% (22/27), 77.8% (21/27), 70.4% (19/27) and 63.0% (17/27), respectively. In 3 negative fine-needle aspirates, the number of chromosomes was normal. CONCLUSIONS: (1) Interphase cytogenetic cells analysis of fine-needle aspirates by FISH is feasible and simple; (2) Hyperdiploid in malignant cells in fine-needle aspirates from lung cancer can be used as a biomarker for benign and malignant cells.

Biopsy, Needle↗

PubMed2000

[Effect of sodium azide on mitochondrial membrane potential in SH-SY5Y human neuroblastoma cells].

OBJECTIVE: To study the role of mitochondrial deficiency in the pathogenesis of neurodegenerative disease by investigating the energy metabolism in a sodium azide inhibited cytochrome-c oxidase SH-SY5Y Cell model. METHODS: Human neuroblastoma SH-SY5Y Cells were exposed to sodium azide, then mitochondrial complex IV activity was assayed by microassay method; cell viability was measured by Thiazolyl blue(MTT) method; mitochondrial membrane potential (MMP) was detected by confocal microscopy and flow cytometry. RESULTS: Cultured SH-SY5Y cells were exposed to 16-64 mmol/L sodium azide for 1 hour, the mitochondrial complex IV activity decreased dose-dependently. MTT absorbance decreased does- and time-dependently in cultured nerve cells treated by 16-128 mmol/L sodium azide for 1-8 hours. After the treatment of 16 mmol/L sodium azide for 1 hour, both the fluorescence intensity of MMP and normal cell events reduced. Decrease of MMP was significant especially in cell processes. CONCLUSION: Sodium azide induced the impairment of mitochondrial energy synthesis in the cultured nerve cells which is an important cause in cell death.

Cell Death↗

PubMed2000

[Assay and L1 gene sequence analysis of human papillomavirus type 6 and 11 in condylomata acuminata].

OBJECTIVE: To determinate the prevalence of HPV type 6, 11 in condylomata acuminata, and analyze the sequence of L1 gene and its deduced L1 protein. METHODS: PCR was used to amplify DNA sequences between E6 and E7 of HPV type 6 and 11. The PCR products were identified by the fragment length cleaved with restriction enzyme RsaI. L1 genes were amplified with high fidelity Taq, and cloned DNA sequences were detected by the dideoxynucleotide method. RESULTS: In 34 examples of condylomata acuminata, HPV11 was found in 25 examples (73.5%), HPV6 in 15(44.1%), including HPV6 + HPV11 in 6(17.6%). In comparison with the prototypes there were 7-8 point mutations in HPV11 L1 gene and 3 in HPV6L1 gene. L1 encoded protein changes showed up only in 1-3 amino acids in the former cases. CONCLUSION: Most of patients tested with condylomata acuminata are mainly infected by HPV11, the rest of them by HPV6 or by co-infection of two mixex types. Sequence analysis of L1 genes indicated that mutations were found in both HPV6 and 11, whereas deduced amino acid mutations in L1 protein were limited in HPV11 only.

Adult↗

PubMed2000

[Effect of 5,7-dihydroxytryptamine on the distribution pattern of calcitonin gene-related peptide in different motoneuron pools].

OBJECTIVE: The effect of 5,7-dihydroxytryptamine (5,7-DHT) on distribution pattern of calcitonin gene-related peptide (CGRP) in different motoneuron pools was studied in rats. METHODS: Cholera toxin B subunit coupled with colloidal gold (CB-Au) retrograde labeling combined with CGRP immunocytochemistry technique was mainly used. RESULTS: In control group, there was a different distribution pattern of CGRP-LI content in soleus motoneuron (SOL-Mn) and extensor digitorum longus motoneuron (EDL-Mn) pools. SOL-Mn pools had a higher ratio of neurons lacking CGRP-LI/weak CGRP-LI and a lower proportion of strongly CGRP-LI labeled ones. Comparing with control, there was a marked shift to increasing of CGRP-LI content in SOL-Mn pool and slight decrease in EDL-Mn pools 14 days after 5,7-DHT. All the SOL-Mns were CGRP-LI positive and the ratio of CGRP-LI strongly positive Mns significantly increased (P < 0.001) while 5,7-DHT did not increase the ratio of CGRP-LI strongly positive Mn in EDL-Mn pool. CONCLUSIONS: Except muscular motor activity, the different distribution pattern of CGRP-LI content in SOL-Mn and EDL-Mn pools is related to different 5-HT inputs. SOL-Mns may receive more 5-HT inputs.

5,7-Dihydroxytryptamine↗

PubMed2000

[Identification of early irreversible damage area in a rat model of cerebral ischemia and reperfusion].

OBJECTIVES: To observe the early neuron ischemic damage in focal cerebral ischemia/reperfusion with histostaining methods of argyrophil III (AG III), Toludine blue(TB), and H&E, and to make out the 'separating line' between the areas of reversible and irreversible early ischemic damage. METHODS: Forty-two male Wistar rats were randomly divided into the following groups: pseudo-surgical, blank-control, O2R0(occluded for 2 hours and reperfused for 0 hour), O2R0.5, O2R2, O2R4, O2R24. There were 6 rats in each group. Rats in experimental groups were suffered focal cerebral ischemia/reperfusion through a nylon suture method. After a special processor for tissue manage, the brain were coronal sectioned and stained with H&E, TB, and AG III. The area where dark neurons dwell in (ischemic core) were calculated with image analysis system. RESULTS: The success rate of ischemic model for this experiment is 90%. After being stained with argyrophil III method, normal neurons appear yellow or pale brown, which is hardly distinguished from the pale brown background. The ischemic neuron stained black, and has collapsed body and "corkscrew-like" axon or dentries, which were broken to some extent. The neuropil in the dark neurons dwelt area appears gray or pale black, which is apparently different from the pale brown neighborhood area. The distribution of dark neurons in cortex varies according to different layers, and has a character of columnar form. The dark neurons present as early as 2 hours ischemia without reperfusion with AG III method. CONCLUSIONS: AG III stain could selectively display early ischemic neurons, the area dwelt by dark neurons represent early ischemic core. Dark neuron is possibly the irreversibly damaged neuron. Identification of dark neurons could be helpful in the discrimination between early ischemic center and penumbra.

Animals↗

PubMed2000

[Detection of DNA variation after space flight in Datura innoxia by random amplified polymorphic DNA markers].

OBJECTIVE: To substantiate the effect of space environment on medicinal plants, the seeds of Datura innoxia were set up in retrievable satellites. METHODS: After returning to earth, the DNA variation of different groups was detected by random amplified polymorphic DNA (RAPD) markers. RESULTS: From a pre-screening of 65 primers with 20 oligonucleotide lengths, 15 primers that produced distinct profiles for each DNA sample were selected. In contrast with the earth controlled group, 39 polymorphic bands were produced in weightless group, and its degree of gene polymorphism was 23.1%; 45 polymophic bands were produced in hit group, and its degree of gene polymorphism was 24.4%. The polymorphic bands ranged approximately from 200 to 1990 bp. CONCLUSIONS: These results indicate that weightlessness induce DNA variation to some extents in Datura innoxia, while the compound effect of weightlessness and high energy heavy ions is more notable than the effect of single weightlessness.

Cosmic Radiation↗

PubMed2000

[Dynamic penumbra in a rat model of focal cerebral ischemia and reperfusion].

OBJECTIVES: To identify the ischemic core and penumbra of variant ischemia and reperfusion period by the dark neuron method, observe them dynamically, and elicit the morphological character of ischemic pneumbra. METHODS: Total 72 male Wistar rats were randomly divided into the following groups: pseudo-surgical, blank-control, O24R0 (sustained ischemia for 24 hours), O4R24(ischemia for 4 hours and reperfused for 24 hours, the following may be deduced by analogy), O2R0, O2R0. 5, O2R2, O2R4, O2R8, O2R24, O2R48, O2R96. There were 6 rats in each group. Rats in experimental groups were suffered focal cerebral ischemia-reperfusion through a nylon suture method. After perfusion fixed, the brains were coronal sectioned and stained with HE, TB and acetum plumbi/silver nitrate. Sections were observed with light microscope and electron microscope. The area of ischemic core and penumbra was measured and analyzed with an image analysis system. RESULTS: The penumbra expanded rapidly in a short period after reperfusion, and reach its apex when reperfused for 2 hours (P < 0.05). The penumbra was relatively stable during 4 to 48 hours reperfusion. There were many cell types in ischemic core and penumbra, the proportion of cells changed according to reperfusion time. CONCLUSIONS: Reperfusion could aggravate cerebral edema and make the ischemic penumbra to expand during the first hours.

Animals↗

PubMed2000

[Analysis of poly(dA).poly(dT) structure by Raman spectroscopy and lattice dynamics].

Poly(dA).poly(dT) is a kind of DNA which one strand contains adenine(A) bases, and the other only thymine(T) bases. This DNA possesses flexible structure and the X-ray diffraction for poly(dA).poly(dT) fiber gives three different structures. So it is of interest to study poly(dA).poly(dT) structure in solution. In this paper, Raman spectrum of poly(dA).poly(dT) in 0.2 mol.L-1 NaCl solution was recorded over the spectral range 750-1000 cm-1. The Raman bands at 817 cm-1 and 843 cm-1 exist simultaneously. This implied that the secondary structure of poly(dA).poly(dT) is neither A-conformation nor B-conformation. Normal mode analysis of heteronomous secondary structure from poly(dA).poly(dT) fibers was carried out by the lattice dynamics. Normal modes were assigned by potential energy distribution (PED). The calculated frequencies are good agreement with the observed Raman spectrum. This indicated that poly(dA).poly(dT) in solution probably has the same structure as poly(dA).poly(dT) fiber, namely the poly(dA) chain has the C-3'-endo ring pucker while the poly(dT) chain has the C-2'-endo ring pucker.

DNA↗

PubMed2000

[Modern spectral estimation of ICP-AES].

The inductively coupled plasma atomic emission spectrometry (ICP-AES) and its signal characteristics were discussed using modern spectral estimation technique. The power spectra density (PSD) was calculated using the auto-regression (AR) model of modern spectra estimation. The Levinson-Durbin recursion method was used to estimate the model parameters which were used for the PSD computation. The results obtained with actual ICP-AES spectra and measurements showed that the spectral estimation technique was helpful for the better understanding about spectral composition and signal characteristics.

Regression Analysis↗

PubMed2000

[Study on color reaction of copper(II)-neocuprine-glutathione-alcohol system].

The colour reaction of glutathione with copper(II)-neocuproine-alcohol was investigated in the present paper. The absorbance increased distinctly by about 13.8% when alcohol was added to the system. The maximum absorption wavelength lambda max of [Cu (neocuproine)2]+ was at 456 nm and the apparent molar absorptivity was 1.2 x 10(4) L.mol-1.cm-1 in the selected system. Linear dynamic relationship was obtained in the concentration range of 2-24 micrograms.mL-1 for glutathione. The regression equation was as following: A = 0.0104 + 0.0385c. The correlation coefficients was 0.9998. The recoveries obtained were between 98.5% and 99.9%. The relative standard deviations were less than 0.9% for all analyses. This method was used to determine glutathione in soybean extracts by the electromagnetic field technique and satisfactory results were obtained.

Antineoplastic Agents↗

PubMed1999

Isolation and characterization of a gene encoding human Kruppel-like factor 5 (IKLF): binding to the CAAT/GT box of the mouse lactoferrin gene promoter.

The mouse lactoferrin gene promoter includes a CAAT/GT box, GGGCAATAGGGTGGGGCCAGCCC, which functions as the epidermal growth factor response element (EGFRE) in human endometrial carcinoma RL95-2 cells (RL95). A positive clone, EGFREB, of 2575 bp length, was isolated from an expression library of RL95 cells with a multimer of the EGFRE sequence. In this work, we have identified that EGFREB encodes the C-terminus of Kruppel-like factor 5 (KLF5). This mRNA is most abundant in human colon and small intestine. A full-length cDNA clone was isolated from a human colon library using EGFREB as the hybridization probe. The full-length cDNA consists of 3336 bp with a 302 bp 5'-UTR, a 1663 bp 3'-UTR, and a 1371 bp sequence coding for a 457 amino acid polypeptide. Based on its tissue distribution and sequence homology to the mouse IKLF, we renamed this protein IKLF. DNase I footprinting and electrophoresis mobility shift assay confirmed the binding of IKLF to the EGFRE. The human IKLF gene spans >20 kb in length and is organized into four exons, whose intron/exon junctions follow the GT/AG rule. The three zinc fingers are encoded by three exons. Nuclear localization of IKLF was demonstrated by green fluorescence protein (GFP)-tagged IKLF in transfection experiments and western analysis. Overexpression of IKLF in RL95 cells represses the activity of reporter constructs containing the CAAT/GT box of the mouse lactoferrin gene. These findings imply that IKLF is a nuclear transcription factor that binds to the CAAT/GT box, and functions as a modulator of the mouse lacto-ferrin gene promoter activity.

5' Untranslated Regions↗

PubMed1999

Binding of paxillin to alpha4 integrins modifies integrin-dependent biological responses.

The alpha4 integrins are indispensable for embryogenesis, haematopoiesis and immune responses, possibly because alpha4 regulates cellular functions differently from other integrins through its cytoplasmic tail. We used novel mimics of the alpha4 tail to identify molecules that could account for alpha4-specific signalling. Here we report that the alpha4 tail, but not several other alpha-subunit tails, binds tightly to the signalling adaptor paxillin. Paxillin physically associated with alpha4 integrins in Jurkat T cells at high stoichiometry, and joining the alpha4 tail to alphaIIb resulted in a complex of integrin alphaIIbbeta3 with paxillin. This association markedly enhanced the rates of alphaIIbbeta3-dependent phosphorylation of focal adhesion kinase and cell migration. It also reduced cell spreading, focal adhesion and stress fibre formation. A point mutation within the alpha4 tail that disrupts paxillin binding reversed all of these effects. Furthermore, alpha4beta1-dependent adhesion to VCAM-1 led to spreading of mouse embryonic fibroblasts derived from paxillin-null but not from wild-type mice. Thus, the tight association of paxillin with the alpha4 tail leads to distinct biochemical and biological responses to integrin-mediated cell adhesion.

Animals↗

PubMed1999

The effects of pain severity on health-related quality of life: a study of Chinese cancer patients.

BACKGROUND: The health-related functioning of patients with cancer is compromised by several factors, including the disease process, treatment, and the various symptoms that are produced by both disease and treatment. This study was designed to specify the relationship between patients' pain severity and their self-reported quality of life. METHODS: The study enrolled 216 consecutive consenting adult patients from 2 Chinese cancer centers with pathologically-diagnosed metastatic cancer who could understand and complete the self-report measures. The majority had cancer-related pain and were receiving analgesics. The Chinese version of the Brief Pain Inventory was used to assess the severity and interference of pain. A Chinese translation of the Medical Outcomes Study 36-Item Short-Form Health Survey (SF-36) was used to assess health-related functional status. Patients' physicians completed a form that indicated characteristics of the patients' cancer, Eastern Cooperative Oncology Group performance status, pain, and current pain treatment. RESULTS: Increasing severity of pain was associated with worsening health-related functioning, even when an estimate of disease severity was taken into account. The correlation between pain severity and impairment was nonlinear. The functional health and well-being of cancer patients with no or mild pain was significantly less impaired than that of patients with moderate or severe pain. The impairment of patients with moderate and severe pain did not differ. CONCLUSIONS: Pain severity is an important variable to be taken into account when quality of life outcome measures are considered. The functioning of cancer patients with well-controlled (mild) pain did not differ significantly from that of patients without pain. Providing pain relief should significantly improve the functional status of cancer patients.

Adolescent↗

PubMed1999

Heteroarotinoids inhibit head and neck cancer cell lines in vitro and in vivo through both RAR and RXR retinoic acid receptors.

A class of less toxic retinoids, called heteroarotinoids, was evaluated for their molecular mechanism of growth inhibition of two head and neck squamous cell carcinoma (HNSCC) cell lines SCC-2 and SCC-38. A series of 14 heteroarotinoids were screened for growth inhibition activity in vitro. The two most active compounds, one that contained an oxygen heteroatom (6) and the other a sulfur heteroatom (16), were evaluated in a xenograph model of tumor establishment in nude mice. Five days after subcutaneous injection of 10(7) SCC-38 cells, groups of 5 nu/nu mice were gavaged daily (5 days/week for 4 weeks) with 20 mg/kg/day of all-trans-retinoic acid (t-RA, 1), 10 mg/kg/day of 6, 10 mg/kg/day of 16, or sesame oil. After a few days, the dose of t-RA (1) was decreased to 10 mg/kg/day to alleviate the side effects of eczema and bone fracture. No significant toxic effects were observed in the heteroarotinoid groups. All three retinoids caused a statistically significant reduction in tumor size as determined by the Student t-test (P < 0. 05). Complete tumor regression was noted in 3 of 5 mice treated with t-RA (1), 4 of 5 mice treated with 16, 1 of 5 mice treated with 6, and 1 of 5 mice treated with sesame oil. Reverse transcriptase polymerase chain reaction (RT-PCR) was used to determine that the expression levels of RARalpha, RXRalpha, and RXRbeta were similar in the two cell lines, while RARbeta expression was higher in SCC-2 over SCC-38, and RARgamma expression was higher in SCC-38 over SCC-2. Receptor cotransfection assays in CV-1 cells demonstrated that 16 was a potent activator of both RAR and RXR receptors, while 6 was selective for the RXR receptors. Transient cotransfection assays in CV-1 cells using an AP-1 responsive reporter plasmid demonstrated that t-RA (1), 6, and 16 each inhibited AP-1-driven transcription in this cell line. In conclusion, the growth inhibition activity of the RXR-selective 6 and the more potent growth inhibition activity of the RAR/RXR pan-agonist 16 implicate both RARs and RXRs in the molecular mechanism of retinoid growth inhibition. Moreover, the chemoprevention activity and the lack of toxicity of heteroarotinoids demonstrate their clinical potential in head and neck cancer chemoprevention.

Animals↗

PubMed1999

ADP-ribosylation factor 6 and endocytosis at the apical surface of Madin-Darby canine kidney cells.

We report that the small GTPase, ADP-ribosylation factor 6 (ARF6), is present only on the apical surface of polarized MDCK epithelial cells. Overexpression of a mutant of ARF6, ARF6-Q67L, which is predicted to be in the GTP-bound form, stimulates endocytosis exclusively at this surface. Surprisingly, overexpression of the mutant ARF6-T27N, which is predicted to be in the GDP-bound form, also stimulated apical endocytosis, though to a lesser extent. ARF6-stimulated endocytosis is inhibited by a dominant-negative form of dynamin, or a dominant-negative hub fragment of clathrin heavy chain, indicating that it is mediated by clathrin. Correspondingly, overexpression of either mutant of ARF6 leads to an increase in the number of clathrin-coated pits at the apical plasma membrane. When ARF6-Q67L is overexpressed in the presence of the dominant-negative dynamin, the ARF6-Q67L colocalizes with clathrin and with IgA bound to its receptor. We conclude that ARF6 is an important modulator of clathrin-mediated endocytosis at the apical surface of epithelial cells.

ADP-Ribosylation Factor 6↗

PubMed1999

Glutamate modulates neurotransmission in the submucosal plexus of guinea-pig small intestine.

Effects of glutamate on synaptic transmission in the submucosal plexus of guinea-pig small intestine were studied with intracellular electrophysiological recording methods. Glutamate suppressed stimulus-evoked slow excitatory postsynaptic potentials (EPSPs) and increased the amplitude of slow inhibitory postsynaptic potentials (IPSPs) in submucosal neurons. The actions of glutamate were mimicked by the group I metabotropic glutamate receptor (mGluRs) agonist DHPG, but not by the group II agonist S-4C3HPG, the group III agonist L-AP4, or selective agonists for ionotropic glutamate receptors (iGluRs). Glutamate actions were suppressed by the selective group I mGluRs antagonist S-4CPG, but not by group II and III mGluRs antagonist CPPG or iGluRs antagonists. Glutamate suppressed substance P- and 5-HT-evoked slow EPSP-like responses and potentiated norepinephrine-induced slow IPSP-like responses. The results suggest that group I mGluRs mediate glutamate-induced suppression of slow EPSPs and potentiation of slow IPSPs in S-type uniaxonal submucosal neurons.

Animals↗

PubMed1999

Long-term beta-carotene supplementation and risk of type 2 diabetes mellitus: a randomized controlled trial.

CONTEXT: Recent data suggest a protective role of carotenoids in the development of type 2 diabetes mellitus (DM), possibly via an antioxidant effect, but no randomized trial has directly assessed the efficacy of beta-carotene to prevent DM. OBJECTIVE: To determine whether long-term beta-carotene supplementation reduces the risk of developing type 2 DM. DESIGN, SETTING, AND PARTICIPANTS: A total of 22, 071 healthy US male physicians aged 40 to 84 years in a randomized, double- blind, placebo-controlled trial, from 1982 to 1995. More than 99% of the participants had complete follow-up (median duration, 12 years). INTERVENTION: Subjects were randomly assigned to receive beta-carotene (50 mg on alternate days) or placebo. MAIN OUTCOME MEASURE: Incidence of type 2 DM. RESULTS: A total of 10, 756 subjects were assigned to beta-carotene and 10, 712 to placebo. Incidence of type 2 DM did not differ between groups: 396 men in the beta-carotene group and 402 men in the placebo group developed type 2 DM (relative risk, 0.98; 95% confidence interval, 0.85-1.12). The lack of association between beta-carotene supplementation and incidence of type 2 DM persisted despite multivariate adjustment. There was no evidence of benefit when the period of risk was subdivided into years of follow-up or increasing duration of treatment. CONCLUSION: In this trial of apparently healthy men, supplementation with beta-carotene for an average of 12 years had no effect on the risk of subsequent type 2 DM.

Adult↗