Search PubMed⌕ Search

Biomedical subjects

S Liang

Publications and source records attributed to S Liang.

At least 109 records · Page 6Linked to original sources
PubMed1995

[Detection of herpes viral genome in corneal buttons of quiescet herpes simplex keratitis with polymerase chain reaction].

PURPOSE: Herpetic keratitis is one of the major cause of blindness. The recent reports have proposed that the herpetic viruses may persist in cornea but provided noconclusive evidence. This study is to determine whether the cornea is another latent site of herpes simplex virus. METHODS: 18 corneal buttons of patients with quiescent herpes simplex keratitis which had quited for at least three months (mean 3.7 years) and were obtained by corneal transplantation were detected using polymerase chain reaction (PCR). The sequences of the primers are: P15'CATCACCGACCCGGAGAGGGAC, P25'GGGCCAGGCGCTTGTTGGTGTA. RESULTS: The positive HSV DNA were found in 17 corneal buttons out of 18 cases. CONCLUSION: The HSV genomes are present in the cornea of quiescent herpetic keratitis, which suggest that the cornea may be another latent site of herpetic virus. The PCR is a simple, specific and sensitive way to detect HSV genomes in cornea.

Adolescent↗
PubMed1995

[Study on human gamma-crystallins: V. Non-enzymatic glycation of fetal lens gamma 1- and gamma 3-crystallins in vitro].

PURPOSE: To compare the non-enzymatic glycation of different human fetal gamma-crystallins induced by glucose and fructose. METHODS: gamma 1- and gamma 2-crystallin were separated by the Sephadex gel chromatography from human fetal lenses. The non-enzymatic glycations of these gamma-crystallins were conducted by incubating with glucose or fructose at 37 degrees C for 20 days. The opacity and pellet formation as well as changes on SDS-polyacrymide gel electrophoresis (SDS-PAGE) pattern and blue fluorescence production were observed. RESULTS: Although the two gamma-crystallins displayed similar alterations, gamma 1-crystallin was easier to produce aggregation and insolublization in early stage (i.e. 3 days). SDS-PAGE showed that there were aggregates, formed through disulfide and non-disulfide cross-links, and degraded peptides produced. The blue fluorescence increased in glycated gamma 3-crystalline solution. Fructose had more significant effects (i.e. aggregation, degradation, producing blue fluorescence) on gamma-crystallins as compared with glucose. CONCLUSION: Human fetal gamma 1- and gamma 3-crystallins are sensitive, at different extent (gamma 1 > gamma 3), to response to non-enzymatic glycation, and fructose has stronger effect than glucose on the glycation.

Crystallins↗
PubMed1994

Heterosubtypic immunity to influenza type A virus in mice. Effector mechanisms and their longevity.

Immunity that cross-reacts between influenza type A viruses of distinct subtypes is called hetero(sub)typic (Het-I). We have studied Het-I by challenging PR8-immune mice with the heterosubtypic virus X31. Het-I did not prevent infection by X31 but, at its height, strongly aided in recovery. The nature of the effector mechanisms involved was investigated by simultaneous challenge with X31 and an immunologically unrelated influenza type B virus and by depleting individual lymphocyte subsets in PR8-immune mice before challenge. The study showed the following: 1) The effector mechanisms were intimately associated with immune recognition events. 2) In the nose, depletion of CD8+ or CD4+ T cells led to partial reduction of Het-I, and simultaneous depletion of both T cell subsets abrogated Het-I almost completely. This T cell-mediated immunity was short lived and had disappeared 4 to 5 mo after induction. 3) In trachea and lung, depletion of CD8+ T cells led to a partial reduction of Het-I, whereas depletion of CD4+ T cells was without significant effect. The CD8-mediated component appeared short lived, whereas the residual immunity (in CD4/8-depleted mice) was long lived and persisted past 7 mos after induction. 4) Depletion of NK cells did not significantly reduce the strength of Het-I in either nose or lung. In conclusion, the study shows that Het-I in this system is mediated by a complex combination of immune mechanisms that differ, in part, between upper and lower respiratory tract.

Animals↗
PubMed1994

Isolation and characterization of Saccharomyces cerevisiae mRNA transport-defective (mtr) mutants.

To understand the mechanisms of mRNA transport in eukaryotes, we have isolated Saccharomyces cerevisiae temperature-sensitive (ts) mutants which accumulate poly(A)+ RNA in the nucleus at the restrictive temperature. A total of 21 recessive mutants were isolated and classified into 16 complementation groups. Backcrossed mRNA transport-defective strains from each complementation group have been analyzed. A strain which is ts for heat shock transcription factor was also analyzed since it also shows nuclear accumulation of poly(A)+ RNA at 37 degrees C. At 37 degrees C the mRNA of each mutant is characterized by atypically long polyA tails. Unlike ts pre-mRNA splicing mutants, these strains do not interrupt splicing of pre-mRNA at 37 degrees C; however four strains accumulate oversized RNA polymerase II transcripts. Some show inhibition of rRNA processing and a further subset of these strains is also characterized by inhibition of tRNA maturation. Several strains accumulate nuclear proteins in the cytoplasm when incubated at semipermissive temperature. Remarkably, many strains exhibit nucleolar fragmentation or enlargement at the restrictive temperature. Most strains show dramatic ultrastructural alterations of the nucleoplasm or nuclear membrane. Distinct mutants accumulate poly(A)+ RNA in characteristic patterns in the nucleus.

Biological Transport↗
PubMed1994

Polyclonal antiidiotypic antibodies mimicking gp120 of HIV-1.

Rabbit antiidiotypic antibodies (Ab2) were produced against anti-HIV-1 antibody 0.5 beta (Ab1), which binds to gp120 of HIV-1 and shows virus-neutralizing activity. The Ab2 bound specifically to the Ab1 and their binding to Ab2 was inhibited by a recombinant fragment of gp120 (PB1) or a peptide (residues 301-324 of gp120), both expressing the Ab1-defined epitope. The Ab2 induced in rats antiantiidiotypic antibodies (Ab3) that were Ab1-like in their binding reactivities to PB1, native gp120 or peptide and shared idiotopes with the Ab1. However, the Ab2 did not induce virus-neutralizing Ab3, probably a reflection of the low avidity of the Ab3 as compared to the Ab1.

Animals↗
PubMed1994

The relationship of dietary animal protein and electrolytes to blood pressure: a study on three Chinese populations.

The relationship of diet to blood pressure was studied in a total of 705 men and women aged 40-59 from three Chinese population samples having different mean blood pressure and dietary sodium and animal protein intake. Two groups were farmers from Shanxi in northern China, and Guangxi in southern China, and the third were fishermen from Zhejiang, eastern China. Three 24-hour dietary recalls were done for each participant. Serum and overnight urine amino acids were measured in random subsamples. Determination of electrolytes in three 24-hour urine specimens was done in an additional sample of 59 men in each population. Results of multiple or stepwise regression showed: 1) in the pooled group, individual intake of sodium was positively associated with systolic blood pressure; 2) when stratifying by median calcium intake, a positive association of dietary sodium or sodium/potassium was found only in the group with calcium intake lower than the median; 3) daily intake of animal protein, urinary sulphate and certain serum and urine amino acids formed from protein metabolism, were inversely associated with blood pressure.

Adult↗
PubMed1994

Alpha and beta thalassaemia among Chinese children in Guangxi Province, P.R. China: molecular and haematological characterization.

We have studied nearly 100 patients with beta-thalassaemia major and 60 patients with Hb H disease who were attending the Haematology Clinic of Guangxi Medical College. Treatment of the patients was limited and only a few patients with beta-thalassaemia major received blood transfusion(s). As a result, the severe anaemia has led to early death at 3-4 years for beta zero-thalassaemia homozygotes, and 8-12 years for beta(+)-thalassaemia homozygotes. Four beta-thalassaemia alleles are responsible for nearly 90% of all beta-thalassaemia chromosomes. This information has resulted in the initiation of a prenatal testing programme at the local level. The patients with Hb H disease maintained a haemoglobin level of 6-10 g/dl and early death was infrequently observed. The --SEA deletion was the major type of alpha-thalassemia-1, while three smaller deletions (-2.7, -3.7 and -4.2 kb) and two nondeletional alpha-thalassaemia determinants (Hbs Constant Spring and Quong Sze) were the alpha-thalassaemia-2 types.

Alleles↗
PubMed1994

[Study on soluble proteins in human fetal lens].

Soluble proteins from corter of human fetal clear lenses were separated by column chromatography with Sepharyl S-300 (superfine) and determined by disc-PAGE and SDS-PAGE. The results documented from 18W, 21W (2 cases) and 24W fetal lenses suggested that a negative correlation tended to be presented between the age of fetus and fraction of alpha, beta 1 crystallins (r = -0.9542; r = -0.9674) and a positive correlation between the age of fetus and fraction of beta 2, gamma crystallins (r = 0.9666; r = 0.9970). There was no change in the alpha, beta 1, beta 2 crystallins on disc-PAGE. Among the fetuses of different ages, the blurred band of gamma crystallin seen in 18W and 21W fetal lenses was thickened in the 24W fetal lens. The SDS-PAGE showed that there was no significant difference among the polypeptides in each of alpha, beta 1, beta 2, gamma crystallins in the studied fetal lenses of different age groups. It is presumed that the normal lens is proportionally composed of four fractions of crystallin. This is hypothetically contributed to the maintenance of normal structure of the lens, why the proper proportion of four fractions of crystallins is depended either on proteins synthesis or on protein molecular assembly is not yet clear.

Chromatography, Gel↗
PubMed1994

The study on improved cryopreservation technique of the ultrastructure of corneal endothelial cells.

The traditional corneal cryopreservation technique was improved. We carried out an experimental study that rabbit corneas were cryopreserved by using polyvinylpyrolidone (PVP) as cryoprotective agent and dimethylsulfoxide (DMSO) as the control. The endothelia of cryopreserved corneas were evaluated by scanning and transmission electron microscopy and vital staining. The study shows that PVP is an excellent extracellular cryoprotective agent and has the characteristic of low toxicity or not toxicity to corneal endothelia. PVP is able to enhance the cryoprotective action of DMSO when combined with DMSO. The changes of the ultrastructure of endothelial cells are able to reflect the endothelial viability.

Animals↗
PubMed1994

The biological study of the cultured human lens epithelial cells in vitro.

The human lens epithelial cells (HLE) cultured in vitro was established in normal and cataractous lenses. The biological feature, histological characteristics and the ultrastructure of the cultured HLE cells were investigated. The results reveal that the proliferative capacity of the cultured HLE cells is reversely proportional to the donor age; the cultured HLE cells has the limited proliferative capacity in vitro. The relieve of the contact inhibition is the effective trigger of the HLE cell proliferation. This research work is possible to make a basis for the further study of the regeneration of the lens and the roles of the lens epithelial cells in the development of the cataract.

Adolescent↗
PubMed1993

Movement of embryonic chick sympathetic neurons on laminin in vitro is preceded by neurite extension.

Chick sympathetic neurons (E-9) are capable of moving on a laminin substrate but not on more adhesive substrates in vitro. The effect of laminin is dose-dependent and reduced by the addition of anti-laminin antibodies, whereas soluble laminin does not stimulate movement. The onset of neuronal movement is preceded by, and highly correlated with, the onset of neurite formation. The addition of 1,2 dioctanoyl-sn-glycerol (DAG), a stimulator or protein kinase C that has been shown to inhibit neurite outgrowth, was found to delay both process formation and neuronal movement but did not affect the correlation between these two measures. These results support the conclusion that laminin stimulates primary neuronal movement in vitro and suggest that the mechanism underlying movement involves process formation followed by "towing" of the cell body by the advancing process. The similarities of this in vitro behavior to that observed in vivo suggest that similar mechanisms may underlie neuronal movement in the developing nervous system as suggested by Morest (Z Anat Entwicklungsgesch 130:265-305, 1970) and Liesi (EMBO J 4:1163-1170, 1985; Exp Neurol 117:103-113, 1992).

Animals↗
PubMed1993

Assignment of the three disulfide bridges of huwentoxin-I, a neurotoxin from the spider selenocosmia huwena.

The positions of the disulfide bonds of huwentoxin-I, a neurotoxin from the spider Selenocosmia huwena, have been determined. The existence of three disulfide bonds in the native toxin was demonstrated by mass spectroscopy and the lack of reactivity with a thiol reagent. The assignment procedure involved a combination of tryptic digestion of the native toxin and sequence analysis of both intact and in situ S-carboxymethylated toxin. In situ carboxymethylation is shown to be a useful procedure in sequencing of cysteine- and cystine-containing peptides. Sequence analysis of the intact, cross-linked toxin indicated that no amino acid phenylthiohydantoin (PTH) derivative is seen for the first half-cystine in a cross-linked pair, but that the PTH of dehydroalanine, which can be detected at 313 nm, is seen at the position of the second half-cystine. By sequencing disulfide cross-linked tryptic fragments, the three disulfide linkages in huwentoxin-I could be assigned as Cys2-Cys17, Cys9-Cys22, and Cys16-Cys29.

Amino Acid Sequence↗
PubMed1993

Monoclonal anti-idiotypic antibodies that mimic the epitope on gp120 defined by anti-HIV-1 monoclonal antibody 0.5 beta.

OBJECTIVE: To develop effective, specific and safe anti-idiotypic antibody (Ab2) vaccines against HIV-1. DESIGN: Murine monoclonal Ab2 were generated against anti-HIV-1 antibody 0.5 beta (Ab1), which binds to gp120, neutralizes HIV-1 and inhibits virus-induced syncytia formation. METHODS: Mice were immunized with Ab1, and Ab2 were produced from immunized mice by the hybridoma technique. The Ab2 were characterized in vitro, injected into rabbits, and the anti-anti-idiotypes (Ab3) induced in the rabbits were analyzed for binding and antiviral reactivities by enzyme-linked immunosorbent assay, p24gag release and syncytia formation assays. RESULTS: Seven Ab2 bound to the antigen-combining site of Ab1, one of which (UD7) induced Ab3 in rabbits that were Ab1-like in their binding reactivities to PB1 (recombinant gp120 fragment) or peptides of gp120, and shared idiotypes with the Ab1. Crude Ab3-containing sera specifically and effectively neutralized the virus. CONCLUSION: Monoclonal Ab2 UD7 has potential as a vaccine against HIV-1.

AIDS Vaccines↗