Search PubMed⌕ Search

Biomedical subjects

S Li

Publications and source records attributed to S Li.

At least 1,531 records · Page 85Linked to original sources
PubMed1993

[The effects of cimetidine on splanchnic hemodynamics in cirrhotic patients with portal hypertension].

The effects of histamine H2-receptor antagonist cimetidine on the splanchnic hemodynamics were investigated in 24 cirrhotic patients with portal hypertension and on cardiac output (CO) in 12 of the 24 patients. Cimetidine given intravenously at a dose of 0.4g significantly decreased wedged hepatic venous pressure (-19%, P < 0.01) and hepatic venous pressure gradient (-29%, P < 0.01). The drug also slightly increased left ventricular ejection fraction (+4.1%, P < 0.01). These results show that cimetidine effectively reduce portal venous pressure and not hinder the pump function of the heart.

Adult↗
PubMed1993

[Effect of superoxide dismutase on experimental allergic uveitis].

In this study, experimental allergic uveitis (EAU) in guinea pigs was induced by an injection of bovine serum albumin (BSA) into the vitreous after having pre-immunized them intradermally with BSA plus incomplete Freund adjuvant, and the effect of superoxide dismutase (SOD) on EAU was observed. The result showed that, histopathologically, the phlogistic cell infiltration and exudation within the anterior ocular part of the SOD- treated animals reduced notably. It is suggested that SOD which can scavenge the free radical superoxide anion may alleviate the cellular reaction in the pathological process of uveitis.

Animals↗
PubMed1993

[Study on human gamma-crystallins: IV. Photooxidation of fetal gamma 2-crystallin by ultra-violet irradiation].

Human fetal gamma 2-crystallin solution was irradiated by ultra-violet (UV) (lambda 365 nm) at varying time, and analysed by light scattering, SDS-PAGE with DACM, which could specifically combine to free sulphydryl, as well as tryptophan fluorescence and its quenching with acrylamide. The results showed that light scattering of gamma 2-crystallin solution increased after 24 hour irradiation; SDS-PAGE reveled formation of dimer which did not have free sulphydryl and low molecular weight peptide of gamma 2-crystallin. The tryptophan fluorescence of gamma 2-crystallin decreased, and acrylamide fluorescence quenching effect did not show significant change. It suggested that human fetal gamma 2-crystallin photooxidized by UV could aggreate by disulfide and degrated to low molecular weight peptide, and its tryptophan were also oxidized in some degree.

Crystallins↗
PubMed1993

[The comparative analysis of the complications of extracapsular cataract extraction with and without posterior chamber intraocular lens implantation].

Three-hundred and fourteen eyes that underwent extracapsular cataract extraction (ECCE) were analyzed. ECCE with posterior chamber intraocular lens implantation (PC IOL) was performed in 168 eyes and ECCE alone was performed in 146 eyes. The complications and visual acuity were compared in the two groups. The PC IOL group showed a low incidence of complications. In addition, vitreous loss occurred in 2.38%, cystoid macular edema occurred in 0.6%, and visual acuity recovered to 0.5 or better in 97.62% of the eyes. The incidence of complications in the ECCE group was slightly higher. The postoperative visual acuity in the ECCE group was lower than that in PC IOL group.

Adult↗
PubMed1993

[Amplified 23S rRNA gene of 52 strains of Leptospira and detection of leptospiral DNA in 55 patients by PCR].

Based upon the polymerase chain reaction (PCR), We have developed a sensitive assay for Leptospira interrogans, the agent of leptospirosis. DNA amplification was carried out using primer A: 5'GATCTAATTCGCTGTAGCAGG3' and primer B: 5'ACTTTCACCCTCTATGGTCGG3'. After 30 cycles of amplification, the product could be detected by agarose gel electrophoresis. A segment (124 bp) was amplified in all strains of L. interrogans including 20 Serogroups, 49 Serovars tested, but it was not detected in Patoc I strain, Serovar patoc of Leptospira biflexa and 3055 strain of Leptonema illini (both of which are nonpathogenic). All of the serum (first time) which proved either by blood culture or MAT showed that positive rates were 100%. Leptospiral infection in humans and some domestic animals leads to one or more of a variety of manifestation and persists through a considerable duration of time. However it is relatively difficult to demonstrate the presence of leptospires in serum. The serum (second time) obtained from 55 patients with leptospirosis (6-60 days after on set) showed that PCR positive rates were 74.55% (41/55). The PCR positive rates for healthy subjects were 15% (3/20), P < 0.001. The diagnosis of leptospirosis by using PCR may become a significant addition to the routine laboratory diagnosis and a valuable technique for the investigation of leptospirosis pathogenesis.

Base Sequence↗
PubMed1993

Persistent vegetative state--clinical and electrophysiologic observations of 5 cases.

Five patients who met the criteria of the persistent vegetative state (PVS), were studied for ten years. Among them, two had fallen into a deep coma after cardiopulmonary resuscitation, and the other three cases were due to cerebrovascular disorders. Four patients died within 10 years. Clinically, all five cases showed characteristic features of wakefulness without cognitive function and movement of the extremities. The brain stem reflexes, such as light reflexes of the pupils and corneal reflexes, were present. The electroencephalograms showed ample low amplitude and nonspecific slow waves. None revealed an isoelectric pattern. Brain stem auditory evoked potential (BAEP) studies were normal or slightly abnormal. Median nerve somatosensory evoked potential (SSEP) studies showed absence of a cortical response. These features suggest that the damage in PVS patients is mainly located in the cerebral cortex. Although electrophysiologic examinations are useful diagnostic procedures for PVS, clinical observation remains the basis of the diagnosis.

Adult↗
PubMed1993

Changes of calmodulin contents in single vascular smooth muscle cells from the tail arteries of spontaneously hypertensive rats.

By combining immunohistochemistry and fluorocytometry techniques, total calmodulin (total CaM), Ca(2+)-bound calmodulin (Ca.CaM) and total protein contents in single vascular smooth muscle cells (VSMC) enzymatically dispersed from the tail arteries of young (5-7 weeks old, prehypertensive) and adult (20-24 weeks old, established hypertensive) stroke-prone spontaneously hypertensive rats (SHRsp) were studied and compared with those of age-matched Wistar-Kyoto rats (WKY). No significant difference was found in total CaM, Ca.CaM and protein contents between young SHRsp and WKY. Total CaM and protein contents in adult SHRsp were increased by similar degrees (30.7% and 27.5%, respectively) as in age-matched WKY, suggesting that increased total CaM content may be a consequence of increased synthesis of cellular protein during hypertension. However, Ca.CaM contents in adult SHRsp were significantly increased over those in age-matched WKY by a much higher degree (86.2%), reflecting an abnormal Ca2+ homeostasis in single VSMCs during hypertension.

Age Factors↗
PubMed1993

Postnatal development and aging of esophageal epithelium in mouse: a light and electron microscopic radioautographic study.

DNA synthesis and fine structure of the esophageal epithelium of ddY mouse in different age groups, from neonatal to senescent, were investigated by light and electron microscopic radioautography after 3H-thymidine labeling in vitro. At 1-3 days after birth, the esophagus was lined with two cell types, ciliated and nonciliated cells. From 1 week on, ciliated cells could not be found. At 2 weeks, the superficial cells still possessed nuclei and short microvilli on the apical plasma membranes. From 1 month, the superficial cells became keratinized and the microvilli on the apical plasma membrane disappeared. With aging of the mice, the epithelia became markedly thick. These results show that disappearance of ciliated cells, keratinization of superficial cells and increase of the thickness are the main changes in structure of mouse esophageal epithelium from neonatal to senescent ages. By light microscopic radioautography, labelled cells were almost confined in the basal layer, regardless of the aging stages. The highest labeling index was recorded at 1 day after birth, then decreased with age. By electron microscopic radioautography, silver grains indicating DNA synthesis were observed in nuclei. As compared with those of unlabelled cells in the basal layer, the nuclei and nucleoli of labelled cells were larger, with fewer cell organelles. The present study provides, for the first time, the basic quantitative data regarding cell proliferation of mouse esophageal epithelium from neonatal to senescent stage.

Aging↗
PubMed1993

[Induction of micronucleus by organophosphorus pesticides both in vivo and in vitro].

A total of 22 organophosphorus pesticides (OPPs), including 8 ethyl-, 9 methyl-, and 5 other OPPs, were tested for mutagenicity in micronucleus assay system both in 615 mouse marrow cells in vivo with multi-intraperitoneal administrations and in cultured Chinese hamster lung (CHL) cells in vitro; and structure-mutagenicity relationship of OPPs was analyzed. Among the OPPs tested in vivo, 5 ethyl-(diazinon, chlorpyrifos, disulfoton, ethion, and parathion), and only 1 methyl-(dimethoate) were found mutagenic, while the other OPPs were negative. Six ethyl- (azinphos ethyl, chlorpyrifos, ethion, parathion, phosaione, and quinaphos), 8 methyl- (azinophos methyl, chlorpyrifos methyl, dichlorvos, dimethoate, fenitrothion, malathion, parathion methyl, and trimethyl phosphate), and 2 other OPPs (EII and MIA), however, induced micronucleus in CHL cells in vitro. The results indicated that most of the ethyl-OPPs tested showed the ability to induce micronucleus both in vivo and in vitro, and that most of the methyl-OPPs were positive only in vitro. The mechanism for the adversity of mutagenic activity in micronucleus assay in vivo and in vitro produced by different kinds of OPPs was also discussed.

Animals↗
PubMed1993

Prognostic impact of mutated K-ras gene in surgically resected non-small cell lung cancer patients.

Mutated K-ras oncogenes have been detected in a third of lung adenocarcinomas, located usually in codon 12, its presence correlating negatively with survival. To further define the role of K-ras point mutations in non-small cell lung cancer, we studied the presence of mutated K-ras genes in surgical specimens from 66 patients. Polymerase chain reaction was performed from sections of formalin-fixed paraffin-embedded tissue. We screened for point mutations in codons 12, 13 and 61 of the K-ras gene by dot blot hybridization analysis with mutation-specific oligonucleotide probes. Ras gene mutations were present in 13 of 66 carcinomas (20%), nine in codon 12 and four in codon 61. Three squamous cell carcinomas harbored two different point mutations in K-ras codon 12. Mutated K-ras genes were found more frequently in squamous cell carcinomas (eight of 38) than in adenocarcinoma (three of 22). Analysis of nucleotide sequence disclosed a multifarious mutation pattern of K-ras codon 12, where the most common conversion was from glycine (GGT) to valine (GTT). K-ras point mutation positive subset had poorer survival, nine of the 13 patients died during the follow-up period as compared with 22 of 53 patients with no mutation in the K-ras gene (P = 0.01). The difference was also strikingly significant when stratified according to node status.

Adult↗
PubMed1993

Development and longevity of Nosopsyllus laeviceps kuzenkovi (Siphonaptera) from Inner Mongolia under laboratory conditions.

The development and longevity of Nosopsyllus laeviceps kuzenkovi (Yagubyants), a major plague vector among sylvan and campestral rodents in Inner Mongolia, China, was studied under controlled laboratory conditions of 11, 14, 17, 20, 23, 26, 29, and 35 C at 76% relative humidity (R.H.), and 32, 53, 76, 87, and 100% at 23 C. Development from egg to adult was shortest (21-23 days) under favorable conditions of 26 C at 76% R.H., but maximum survival to adulthood (84%) occurred at 23 C. Average longevity was 13.25 days (13.70 in females and 12.80 in males) at 17 C and 76% R.H.; it was longer at cooler and shorter at warmer temperatures. Findings provided experimental data that helped clarify seasonal fluctuations, summer mortality, generation cycles, and survival of compared flea species from Russia, Azerbaidzhan, and China.

Animals↗
PubMed1992

Dopamine regulation of gonadotropin-releasing hormone (GnRH) gene expression in the female rat brain.

The effects of the dopaminergic antagonist haloperidol (HAL) as well as the D2 dopamine receptor agonist bromocriptine (BRO) on gonadotropin-releasing hormone (GnRH) mRNA levels in intact and hypophysectomized rats were investigated by quantitative in situ hybridization. In situ hybridization was performed using a 35S-labelled 48-base oligodeoxynucleotide complementary to the GnRH coding region of the GnRH DNA. In intact animals, a 14-day treatment with BRO increased by 70% the number of silver grains per neuron while HAL decreased by 20% the value of this parameter. Hypophysectomy which induced a 32% decrease in the hybridization signal could not prevent the effects of BRO or HAL. The present data clearly demonstrate that GnRH mRNA levels are positively regulated by dopamine and that the effects of BRO and HAL on GnRH mRNA are not mediated by variations in pituitary hormone secretion.

Animals↗
PubMed1992

Frequent loss of heterozygosity on chromosomes Xp and 13q in human ovarian cancer.

Loss of heterozygosity (LOH) was examined at 27 loci on chromosomes 3p, 6q, 11p, 13q, 17 and X in 42 human ovarian tumors. LOH was detected in 12 of 26 (46%) and 5 of 12 (42%) informative cases at 2 chromosome 13q loci, D13S32 and D13S34 respectively. On chromosome Xp, tumor-specific allele loss was observed in 9 out of 15 informative cases (60%) at the ornithine transcarbamylase (OTC) gene locus. Examination of 12 additional Xp and 13q loci has mapped the common deletion regions to Xp21.1-->p11.4 and 13q33-->q34. The observation of significant LOH on Xp represents a strong indication of genetic changes in the X chromosome in a human malignancy. The allele losses on 13q which have been reported for other cancers suggest that chromosome 13, in addition to the retinoblastoma gene, may contain other growth-regulating gene(s) important in the development of several tumor types, including ovarian malignancies.

Chromosome Deletion↗
PubMed1992

Direct detection of Epstein-Barr virus in peripheral blood and comparison of Epstein-Barr virus genotypes present in direct specimens and lymphoblastoid cell lines established from nasopharyngeal carcinoma patients and healthy carriers in Hong Kong.

By means of a PCR assay, EBV was demonstrated directly in peripheral blood of previously infected individuals. The virus was detected in approximately 80% of specimens from EBV-seropositive individuals, but not in cord-blood lymphocytes by this method. When virus present in peripheral blood was compared to that observed directly in NPC biopsies or throat washings, it was distinct from that seen in biopsies in 4/15 cases (27%) and from that seen in throat washes in 1/22 cases (5%). The throat-wash virus differed from the biopsy virus in 3/20 cases (15%). The prototype F virus was found in 7/10 LCLs (70%) established from NPC patients' peripheral blood, but was only detected in 2/9 specimens (22%) directly analyzed by the PCR assay. This finding suggests selective isolation of prototype F EBV in spontaneous LCLs established from NPC patients.

Blotting, Southern↗
PubMed1992

Current status of education and training in occupational health and their development programs in China.

There are 40 post graduate schools of public health in China, from where 1,400 students are graduating every year. Fourteen percent of them are going into occupational health field. A total of about 25,000 specialists are now working in the occupational health field. However, this number is only 1 percent of all health workers in China. Facts on the educational resources in China including responsible institutions and programs for such occupational health specialists are introduced and discussed. Finally a program for increasing the number of occupational health specialists in the Eighth Five-year Plan of China is introduced.

China↗