Search PubMed⌕ Search

Biomedical subjects

S Komori

Publications and source records attributed to S Komori.

At least 19 recordsLinked to original sources

Roles of M2 and M3 muscarinic receptors in cholinergic nerve-induced contractions in mouse ileum studied with receptor knockout mice.

BACKGROUND AND PURPOSE: The functional roles of M(2) and M(3) muscarinic receptors in neurogenic cholinergic contractions in gastrointestinal tracts remain to be elucidated. To address this issue, we studied cholinergic nerve-induced contractions in the ileum using mutant mice lacking M(2) or M(3) receptor subtypes. EXPERIMENTAL APPROACH: Contractile responses to transmural electrical (TE) stimulation were isometrically recorded in ileal segments from M(2)-knockout (KO), M(3)-KO, M(2)/M(3)-double KO, and wild-type mice. KEY RESULTS: TE stimulation at 2-50 Hz frequency-dependently evoked a fast, brief contraction followed by a slower, longer one in wild-type, M(2)-KO or M(3)-KO mouse preparations. Tetrodotoxin blocked both the initial and later contractions, while atropine only inhibited the initial contractions. The initial cholinergic contractions were significantly greater in wild-type than M(2)-KO or M(3)-KO mice; the respective mean amplitudes at 50 Hz were 91, 74 and 68 % of 70mM K(+)-induced contraction. Pretreatment with pertussis toxin blocked the cholinergic contractions in M(3)-KO but not in M(2)-KO mice. Cholinergic contractions also remained in wild-type preparations, but their sizes were reduced by 20-30 % at 10-50 Hz. In M(2)/M(3)-double KO mice, TE stimulation evoked only slow, noncholinergic contractions, which were significantly greater in sizes than in any of the other three mouse strains. CONCLUSION AND IMPLICATIONS: These results demonstrate that M(2) and M(3) receptors participate in mediating cholinergic contractions in mouse ileum with the latter receptors assuming a greater role. Our data also suggest that the lack of both M(2) and M(3) receptors causes upregulation of noncholinergic excitatory innervation of the gut smooth muscle.

Anesthetics, Local↗

Volatile female odors activate the accessory olfactory system of male mice without physical contact.

We previously reported that male mice are more attracted to volatile odors from intact female mice than from ovariectomized female mice. In the present study, we investigated male attraction to volatile odors from soiled bedding collected from the cages of estrous or ovariectomized female mice. There was no difference in the total time spent sniffing volatile odors from estrous and ovariectomized female mice, suggesting that female mice emit volatile odors which are not excreted into bedding. To test this possibility, we investigated c-Fos expression in the mitral cell layer and granule cell layer of the accessory olfactory bulb 60 min after exposure of male mice to volatile odors without physical contact. Volatile odors from an estrous female mouse significantly increased the total number of c-Fos positive cells in each of the rostral and caudal granule cell layer, but not in the mitral cell layer. After exposure to volatile odors from estrous bedding, the total number of c-Fos positive cells did not increase. Volatile odors from a male mouse did not increase the total number of c-Fos positive cells. Volatile odors from an ovariectomized female mouse increased c-Fos expression only in the caudal granule cell layer. These results suggest that female mice emit specific volatile odors which are not excreted into bedding, and that the volatile odors activate the accessory olfactory system of male mice without physical contact. To characterize the female-specific volatile odors, we conducted habituation-dishabituation tests. Whereas sham-operated male mice discriminated between volatile odors of estrous and ovariectomized female mice, vomeronasal organ-removed male mice did not. These results suggest that male mice discriminated whether or not female mice were ovariectomized, by volatile odors via the accessory olfactory system, and that the female-specific volatile odors are involved in reproduction.

Analysis of Variance↗

Pharmacological characterization of 5-hydroxytryptamine-induced contraction in the chicken gastrointestinal tract.

5-Hydroxytryptamine (5-HT) receptor subtypes involved in 5-HT-induced contraction of the chicken gastrointestinal tract were characterized pharmacologically using subtype-selective agonists and antagonists. The proventriculus (area of stomach adjacent to the oesophagus) and ileum are examined. 5-HT applied cumulatively caused sustained contraction of the proventriculus that was not decreased by tetrodotoxin, atropine or l-nitro-arginine methylester (l-NAME). alpha-Methyl-5-HT showed the same potency as that of 5-HT, indicating the involvement of the 5-HT(2) receptor. (+/-)-1-(2,5-dimethoxy-4-iodophenyl)-2-amino-propane (DOI), 5-methoxytryptamine and 1-(3-chlorophenyl)piperazine hydrochloride (mCPP) were potent, and 2-methyl-5-HT, 5-carboxamidotryptamine, BW723C86 and 6-chloro-2-(1-piperazinyl)pyrazine hydrochloride (MK212) were moderate, but (+/-)-8-hydroxy-2-dipropylaminotetralin hydrobromide (8-OH-DPAT), [endo-N-8-methyl-8-azabicyclo-(3,2,1)oct-3-yl]-2,3-dihydro-(1-methyl)ethyl-2-oxo-1H-benzimidazol-1-carboxamide (BIMU-8) and cisapride were weak agonists. Correlation of pEC(50) values of these agonists with documented pEC(50) values for 5-HT(2C) receptor was higher than 5-HT(2A) and 5-HT(2B). Cinanserin, ketanserin, methiothepin, methysergide, mianserin, (8-[5-(2,4-dimethoxy-5-(4-trifluoromethylphenylsulphonamido)phenyl-5-oxopentyl)-1,3,8-triazaspiro[4,5]decane-2,4-dione hydrochloride (RS102221), N-(1-methyl-1H-indolyl-5-yl)-N'-(3-methyl-5-isothiazolyl)urea (SB204741), spiperone and N-desmethylclozapine concentration-dependently inhibited the contractile responses to 5-HT. Correlation of pK(b)/pA(2) of antagonists with documented pK(i) for 5-HT(2C) receptor was highest among 5-HT(2) receptor subtypes. In the methysergide- and ketanserin-treated proventriculus, 5-HT, 2-methyl-5-HT and cisapride did not enhance the electrical field stimulation (5 Hz)-induced cholinergic contractions. 5-HT applied non-cumulatively caused transient contraction of ileum, and the responses were partly decreased by atropine or tetrodotoxin. 5-Methoxytryptamine, alpha-methyl-5-HT, 5-carboxamidotryptamine, L692,247 and DOI were potent agonists. However, 2-methyl-5-HT, cisapride, BW723C86, 8-OH-DPAT and 5-nonyloxytryptamine, mCPP and MK212 were less effective. Ketanserin and methysergide decreased the 5-HT-induced ileal contraction, but neither GR113808 nor SB269970 inhibited the responses. In conclusion, 5-HT causes contraction of the proventriculus via 5-HT(2C)-like receptors present on smooth muscle. 5-HT also causes contraction of the ileum, but the underlying mechanisms are complex, involving neural and smooth muscle components, and both 5-HT(1)- and 5-HT(2)-like receptors. Neural 5-HT receptors similar to 5-HT(3)/5-HT(4) receptors were not found in the chicken proventriculus and ileum.

Anesthetics, Local↗

Muscarinic cationic current in gastrointestinal smooth muscles: signal transduction and role in contraction.

1 The muscarinic receptor plays a key role in the parasympathetic nervous control of various peripheral tissues including gastrointestinal tract. The neurotransmitter acetylcholine, via activating muscarinic receptors that exist in smooth muscle, produces its contraction. 2 There is the opening of cationic channels as an underlying mechanism. The opening of cationic channels results in influxes of Ca2+ via the channels into the cell and also via voltage-dependent Ca2+ channels which secondarily opened in response to the depolarization, providing an amount of Ca2+ for activation of the contractile proteins. 3 Electrophysiological and pharmacological studies have shown that the cationic channels as well as muscarinic receptors exist in many visceral smooth muscle cells. However, the activation mechanisms of the cationic channels are still unclear. 4 In this article, we summarize the current knowledge of the muscarinic receptor-operated cationic channels, focusing on the receptor subtype, G protein and other signalling molecules that are involved in activation of these channels and on the molecular characteristics of the channel. This will improve strategies aimed at developing new selective pharmacological agents and understanding the activation mechanism and functions of these channels in physiological systems.

Acetylcholine↗

[Evaluation of aortic valve replacement involving small severely calcified aortic annulus in elderly patients].

We performed aortic valve replacement in 24 patients aged over 70 with small calcified valves. The surgical management of such patients remains controversial as the extensive calcification compromises implantation. Hence, we used an ultrasonic debridement instrument to remove calcium and selected a small prosthesis with the largest possible orifice without enlargement of the aortic annulus. Echocardiography showed significant reductions in left ventricular mass index compared with preoperative values. Early and mid-term prognosis has been relatively good.

Aged↗

[Effects of additional pulmonary blood flow after bidirectional Glenn procedure].

Thirteen cases of functional single ventricle who had undergone bidirectional Glenn procedure were divided into 2 groups according to presence (5) or absence (8) of additional pulmonary blood flow. Additional flow was preserved in cases with relatively small pulmonary artery index (PA index), and their sources were antegrade pulmonary blood flow (2), and Blalock-Taussig (BT) shunt (3). In the control group, PA index was reduced to about 70% of the preoperative value, while in the additional group, pulmonary artery growth was recognized without significant elevation of mean pulmonary artery pressure. However, atrioventricular valve regurgitation progressed and systemic ventricular volume did not decrease after Glenn in the additional group. Therefore special consideration for the timing of Fontan procedure is mandatory.

Anastomosis, Surgical↗

[Effects of octreotide acetate on intractable chylothorax after surgery for congenital heart diseases].

We experienced 2 infants in whom octreotide acetate was effective on intractable chylothorax after surgery for congenital heart diseases. They were 8- and 5-month-old. They were diagnosed as having corrected transposition of the great arteries (TGA) and tetralogy of Fallot respectively, and underwent bidirectional Glenn anastomosis and right modified Blalock Taussig shunt. Chylothorax was revealed on the 11th and the 1st postoperative day, and was not improved by any conventional therapy in either case. Then octreotide acetate was infused continuously with 0.1-0.6 micorg/kg/hour for 24 and 7 days. Chylothorax disappeared completely without any complications such as disturbance of blood sugar level or growth retardation. Octreotide acetate was effective and safe even in infants in intractable chylothorax after surgery for congenital heart diseases, as long as used for short period.

Cardiac Surgical Procedures↗

DNA sequence diversity of intergenic spacer I region in the non-lipid-dependent species Malassezia pachydermatis isolated from animals.

The non-lipid-dependent species Malassezia pachydermatis is frequently isolated from animals. We analyzed the DNA sequences of the intergenic spacer (IGS) 1 region, which is the most variable region in the rRNA gene, of 43 M. pachydermatis strains obtained from dogs or cats. The lengths of the IGS 1 regions ranged from 552 to 898 bp and, based on the nucleotide sequence, these IGS 1 regions were divided into three major groups with 10 subtypes. Group 1 (552-601 bp long) was characterized by the short sequence repeat (CAGCA)n and had four to 14 repeats, and Group 3 (749-898 bp long), which included the neotype strain of M. pachydermatis, was characterized by the sequence (CAGCATAACATAACACACAACA)n in the IGS1 region. Group 2 possessed partial sequences of both Groups 1 and 3. Each group shared only 41.7-55.4% similarity in the IGS1 region with the other groups. The internal transcribed spacer (ITS) region and D1/D2 26S rDNA in the rRNA gene were also sequenced for representative strains in each IGS group. The groups were distinguished by both ITS (698-712 bp long including 5.8S rDNA) and D1/D2 26S rDNA (624 bp long) sequences with sequence similarities of 91.7-96.0% and 99.7-99.0%, respectively. Our results indicate that the sequence of the IGS region of M. pachydermatis has a remarkable intraspecies diversity, compared with ITS or D1/D2 26S rDNA, and that multiple genotypic strains of M. pachydermatis colonize animal skin.

Animals↗

[Sutureless technique for oozing type postinfarction left ventricular free wall rupture].

We report our experience using a sutureless technique for oozing type postinfarction left ventricular free wall rupture. Several materials such as fibrin seat, autologous or heterologous pericardial patch, fibrin glue, and geratin-resorcin-formaldehyde (GRF) glue have been used. Nine patients, who developed postinfarction left ventricular free wall rupture, underwent surgical repair using a sutureless technique between 1999 and 2004. All patients survived and discharged our hospital without any postoperative complications. And all are alive an exellent condition in 5 to 44 months. A sutureless technique for the treatment of oozing type postinfarction left ventricular free wall rupture is simple, effective, and associated with a favorable outcome.

Aged↗

[Blalock-Taussig shunt and pulmonary artery angioplasty for isolated unilateral absence of the right pulmonary artery; report of a case].

A 7-month-old girl was referred to us for further examination of absence of the right pulmonary artery. She had no symptom at that time. Diagnosis was made by chest computed tomography (CT) and cardiac catheterization. Though the size of the right pulmonary artery was not apparent, right pulmonary vein wedge angiography revealed the distal portion of right pulmonary artery sufficient for surgical repair. But the distance between the pulmonary trunk and right pulmonary artery was too far to perform direct anastomosis, and some systemic collaterals had already been recognized. Pulmonary vasculature was also not inadequate. Therefore we planned a palliative procedure. At the age of 7 months, right modified Blalock-Tausig shunt using 5mm expand-polytetrafluoroethylene (ePTFE) tube and angioplasty of the distal portion of right pulmonary artery using autologous pericardium roll with Dacron mesh was performed. Postoperative course was uneventful. She has been followed up for 6 months after the palliation. In the near future the completion of the definitive repair will be considered.

Anastomosis, Surgical↗

[Jatene procedure with arch repair; usefulness of rapid two-stage repair].

Four cases of Jatene procedure with arch repair were performed since 2000 in our department. Two-stage repair was used in all cases and the extended end-to-end anastomosis and pulmonary artery banding (PAB) were performed in 3 cases as the initial repair. In a recent case of TGA type I with coarctation of the aorta (CoA), only subclavian flap aortoplasty was performed when he was 6-day-old and patent ductus arteriosus (PDA) was preserved and rapid two-stage Jatene procedure was performed when he was 8-day-old. There was no hospital or late death, or reoperation. The results of the two-stage Jatene procedure with arch repair was good and safe. Rapid two-stage repair was thought to be a useful choice especially for TGA type I with arch anomaly.

Aorta, Thoracic↗

Receptor signaling mechanisms underlying muscarinic agonist-evoked contraction in guinea-pig ileal longitudinal smooth muscle.

1 In guinea-pig ileal longitudinal muscle, muscarinic partial agonists, 4-(N-[3-chlorophenyl]-carbomoyloxy)-2-butynyl-trimethylammonium (McN-A343) and pilocarpine, each produced parallel increases in tension and cytosolic Ca(2+) concentration ([Ca(2+)]c) with a higher EC(50) than that of the full agonist carbachol. The maximum response of [Ca(2+)]c or tension was not much different among the three agonists. The Ca(2+) channel blocker nicardipine markedly inhibited the effects of all three agonists 2 The contractile response to any agonist was antagonized in a competitive manner by M(2) receptor selective antagonists (N,N'-bis[6-[[(2-methoyphenyl)methyl]amino]hexyl]-1,8-octanediamine tetrahydrochloride and 11-[[2-[(diethlamino)methyl]-1-piperidinyl]acetyl]-5,11-dihydro-6H-pyrido[2,3-b][1,4] benzodiazepine-6-one), and the apparent order of M(2) antagonist sensitivity was McN-A343>pilocarpine>carbachol. M(3) receptor selective antagonists, 1,1-dimethyl-4-diphenylacetoxypiperidinium iodide and darifenacin, both severely depressed the maximum response for McN-A343, while darifenacin had a similar action in the case of pilocarpine. Both M(3) antagonists behaved in a competitive manner in the case of the carbachol response. 3 McN-A343 failed to release Ca(2+) from the intracellular stores, and the Ca(2+)-releasing action of pilocarpine was very weak compared with that of carbachol. All three agonists were capable of increasing Ca(2+) sensitivity of the contractile proteins. 4 McN-A343 rarely produced membrane depolarization, but always accelerated electrical spike discharge. Pilocarpine effect was more often accompanied by membrane depolarization, as was usually seen using carbachol. 5 The results suggest that muscarinic agonist-evoked contractions result primarily from the integration of Ca(2+) entry associated with the increased spike discharge and myofilaments Ca(2+) sensitization, and that Ca(2+) store release may contribute to the contraction indirectly via potentiation of the electrical membrane responses. They may also support the idea that an interaction of M(2) and M(3) receptors plays a crucial role in mediating the contraction response.

(4-(m-Chlorophenylcarbamoyloxy)-2-butynyl)trimethy↗

Effects of G-protein-specific antibodies and G beta gamma subunits on the muscarinic receptor-operated cation current in guinea-pig ileal smooth muscle cells.

(1) The effects on the whole-cell carbachol-induced muscarinic cationic current (mIcat) of antibodies against the alpha-subunits of various G proteins, as well as the effect of a Gbetagamma subunit, were studied in single guinea-pig ileal smooth muscle cells voltage-clamped at -50 mV. Ionized intracellular calcium concentration, [Ca(2+)](i), was clamped at 100 nM using a 1,2-bis(2-aminophenoxyl-ethane-N,N,N',N'-tetraacetic acid)/Ca(2+) mixture. (2) Application of ascending concentrations of carbachol (1-300 micro M) activated mIcat (mean amplitude 0.83 nA at 300 micro M carbachol; EC(50) 8 micro M; Hill slope 1.0). A 20 min or longer intracellular application via the pipette solution of G(i3)/G(o) or G(o) antibodies resulted in about a 70% depression of the maximum response without change in the EC(50) value. In contrast, antibodies against alpha-subunits of G(i1), G(i1)/G(i2), G(i3), G(q)/G(11) or G(s) protein over a similar or longer period did not significantly reduce mIcat. Antibodies to common Gbeta or infusion of the Gbetagamma subunit itself had no effect on mIcat. (3) If cells were exposed briefly to carbachol (50 or 100 micro M) at early times (<3 min) after infusion of antibodies to Galpha(i3)/Galpha(o) or to Galpha(o) had begun, carbachol responses remained unchanged even after 20-60 min; that is, the depression of mIcat by these antibodies was prevented. (4) These data show that Galpha(o) protein couples the muscarinic receptor to the cationic channel in guinea-pig ileal longitudinal smooth muscle and that Gbetagamma is not involved. They also show that prior activation of the muscarinic receptor presumably causes a long-lasting postactivation change of the G protein, which is not reflected in mIcat, but acts to hinder antibody binding.

Animals↗

Epitope analysis for human sperm-immobilizing monoclonal antibodies, MAb H6-3C4, 1G12 and campath-1.

Human monoclonal antibody, MAb H6-3C4, possesses strong sperm immobilizing activity. MAb H6-3C4 has been suggested by several research groups to react with a carbohydrate moiety of male reproductive tract CD52 (mrtCD52). In the present study, we analysed the epitope on mrtCD52 for MAb H6-3C4 and found that it was polymorphic in Western blot analysis and disappeared after enzymatic removal of the N-linked carbohydrate moiety. Two other monoclonal antibodies (1G12, campath-1) with sperm-immobilizing activity recognized mrtCD52 in a polymorphic manner similar to MAb H6-3C4. Further analysis showed that 1G12 recognized a structure formed by the peptide and/or a glycosylphosphatidylinositol (GPI) anchor portion as does campath-1. Results of a lectin binding assay suggested the presence of O-linked carbohydrates on mrtCD52. Our results also indicated that the peptide portion of CD52 could serve as an epitope for sperm-immobilizing antibodies. It was concluded that the epitope of MAb H6-3C4 is similar to, but distinct from, those of 1G12 and campath-1, and that mrtCD52 contains different antigenic epitopes.

Antibodies, Monoclonal↗

Peptidergic and nitrergic inhibitory neurotransmissions in the hamster jejunum: regulation of vasoactive intestinal peptide release by nitric oxide.

Regulation of vasoactive intestinal peptide (VIP) release by nitric oxide (NO) was investigated in the hamster jejunum. Electrical field stimulation and applied NO (3-100 microM) evoked biphasic hyperpolarizations consisting of an initial transient hyperpolarizing component followed by a second more slowly developing component (late component). The NO synthase inhibitor N(G)-nitro-L-arginine methyl ester (200 microM) abolished the biphasic inhibitory junction potential evoked by electrical field stimulation. The NO scavenger oxyhemoglobin (50 microM) and the guanylate cyclase inhibitor 1H-[1,2,4]oxadiazolo-[4,3-a]quinoxalin-1-one (ODQ; 10 microM) abolished both components of the inhibitory junction potentials and the NO-induced hyperpolarizations. VIP(6-28) (1 microM), which abolished VIP (3 microM)-induced hyperpolarizations, also inhibited the late components of the inhibitory junction potentials and the NO-induced hyperpolarizations. ODQ inhibited VIP release and cAMP production by electrical field stimulation and NO application. N(6)-2,0-Dibutyryladenosine 3',5'-cyclic monophosphate (0.1-3 mM) caused a membrane hyperpolarization. These results suggest that NO may stimulate VIP release from enteric nerves in the hamster jejunum. In addition, we propose that NO and NO-stimulated VIP contribute to the early and late components of the inhibitory junction potentials, respectively, in the circular smooth muscle cells of the hamster jejunum.

Animals↗

Inhibitory effects of organotin compounds on voltage-dependent, tetrodotoxin-resistant Na+ channel current in guinea pig dorsal root ganglion cells.

The effects of organotin compounds on voltage-dependent, tetrodotoxin (TTX)-resistant Na+ channel current (I(Na)) in single cells isolated from guinea pig dorsal root ganglion were investigated using a whole cell patch clamp technique. Extracellular application of tributyltin (TBT) inhibited I(Na) in a concentration-dependent manner with an IC50 of 7.2 microM. TBT (100 microM), when applied intracellularly, was without effect. Triphenyltin (TPT, 100 microM) and dibutyltin (DBT, 100 microM), applied extracellularly, inhibited I(Na) with an efficacy ranking of TBT>TPT>DBT. Monobutyltin (100 microM), whether applied externally or internally, had little effect on I(Na). TBT (30 microM) significantly prolonged both time to peak and half-decay time of I(Na) and shifted the activation curve of I(Na) in the positive direction without changing the slope. No such effect was produced by TPT (100 microM). The results indicate that organotin compounds inhibit voltage-dependent, TTX-resistant Na+ channel activity and suggest that the inhibitory action may account, at least in part, for their neurotoxic effects.

Animals↗

Muscarinic agonist potencies at three different effector systems linked to the M(2) or M(3) receptor in longitudinal smooth muscle of guinea-pig small intestine.

1. The abilities of muscarinic agonists (arecoline, bethanechol, carbachol, McN-A343, methacholine, pilocarpine) to inhibit isoprenaline-induced cyclic AMP production in chopped fragments (via M(2) receptors), and to evoke cationic current (I(cat)) (via M(2) receptors) or calcium store release (via M3 receptors) in enzyme-dispersed, single voltage-clamped cells from longitudinal smooth muscle of the guinea-pig small intestine were examined. 2. All muscarinic agonists (1 - 300 microM) examined inhibited isoprenaline (1 microM)-induced accumulation of cyclic AMP, the IC(50) varying from 52 to 248 microM. However, their relative potencies to evoke this M(2) effect were not significantly correlated with their ability to evoke I(cat), also a M(2) effect, whether or not calcium stores were depleted; pilocarpine and McN-A343 inhibited the I(cat) response to carbachol. 3. Muscarinic agonists (concentration 300 or 1000 microM), except pilocarpine and McN-A343 which were ineffective, evoked Ca(2+)-activated K(+) current (I(K-Ca)) resulting from Ca(2+) store release (M(3) effect). Their effectiveness was tested by estimating residual stored calcium by subsequent application of caffeine (10 mM). The relative potencies to evoke Ca(2+) store release (M(3)) and for I(cat) activation (M(2)) were closely correlated (P<0.001). 4. These data might be explained if M(2)-mediated adenylyl cyclase inhibition and I(cat) activation involve different G proteins, or involve different populations of M(2) receptors. The observed correlation of agonist potency between I(cat) activation and Ca(2+) store release supports the proposal (Zholos & Bolton, 1997) that M(3) activation can potentiate M(2)-cationic channel coupling through Ca(2+)-independent mechanisms.

Animals↗

Genetic analysis of a variant luteinizing hormone in an infertile woman.

In a woman with infertility and an endometrial polyp, we analyzed the nucleotide sequence of the beta-subunit of her luteinizing hormone which showed anomalous immunogenecity in that it was recognized by time resolved-fluoroimmunoassay but not by immunoradiometric assay. The sequence analysis showed two substitutional mutations of beta-subunit Trp (TGG) to Arg (CGG) and Ile (ATC) to Thr (ACC). The variant luteinizing hormone might have had some relation to the infertility and the endometrial polyp. been described [2, 4, 13-15]. Although the role of the variant LH is still unclear, it has different biologicl activity as compared to normal LH and may play a role in causing infertility, menstrual disorder, endometriosis and spontaneous miscarriage [1, 3, 4, 9, 10, 17]. We now report a study of the DNA sequence of beta-subunit of anomalous LH in an infertile patient with an endometrial polyp.

Adult↗