Anesthetic management for a patient with renal arterio-venous fistula.
Explore the source record for details and available documents.
Journal Article↗
Biomedical subjects
S Iwai
Publications and source records attributed to S Iwai.
Clinical evaluation of irreversible image compression: analysis of chest imaging with computed radiography.
To implement a picture archiving and communication system, clinical evaluation of irreversible image compression with a newly developed modified two-dimensional discrete cosine transform (DCT) and bit-allocation technique was performed for chest images with computed radiography (CR). CR images were observed on a cathode-ray-tube monitor in a 1,024 X 1,536 matrix. One original and five reconstructed versions of the same images with compression ratios of 3:1, 6:1, 13:1, 19:1, and 31:1 were ranked according to quality. Test images with higher spatial frequency were ranked better than those with lower spatial frequency and the acceptable upper limit of the compression ratio was 19:1. In studies of receiver operating characteristics for scoring the presence or absence of nodules and linear shadows, the images with a compression ratio of 25:1 showed a statistical difference as compared with the other images with a compression ratio of 20:1 or less. Both studies show that plain CR chest images with a compression ratio of 10:1 are acceptable and, with use of an improved DCT technique, the upper limit of the compression ratio is 20:1.
Humans↗
Chemical synthesis of oligoribonucleotides for structural studies.
Large-scale synthesis of oligoribonucleotides has been performed successfully on a solid support by the phosphoramidite approach using levulinyl and tetrahydrofuranyl protection for the 5'- and 2'-hydroxyl groups respectively. A hexamer containing inosine and four fragments of a hammerhead-type ribozyme have been synthesized on a 10 mumol scale for structural studies by NMR spectroscopy and X-ray crystallography.
Base Sequence↗
Design of RNA enzymes distinguishing a single base mutation in RNA.
RNA enzymes (ribozymes) which can cleave RNA by recognizing sequences of 9-15 bases are described. Substrates must contain UX (X = U, C or A). A ribozyme consisting of two oligoribonucleotides (19 mer and 15 mer) was shown to cleave a ribo 11 mer catalytically with Km and kcat values of 0.53 microM and 0.03 min-1, respectively. A non-cleavable substrate-ribozyme complex containing 2'-O-methylnucleoside was prepared and CD spectra were compared at different temperature. In order to obtain an efficient ribozyme, a one-strand RNA with a chain length of 37 was prepared. The ribozyme was shown to distinguish a single base mutation in mRNA's which were prepared by transcription of two synthetic DNA duplexes coding for positions 7-26 of c-Ha-ras protein. The mutant (Val-12) mRNA which had GUU was cleaved but the wild type mRNA which contained GGU was not changed, when treated by the ribozymes in the presence of Mg2+.
Base Sequence↗
The effect of hyperoxia on the lungs of rats deficient in essential fatty acids.
Morphological alterations in the lungs of rats deficient in either or both of vitamin E and essential fatty acids were investigated after exposure to hyperoxia for 48 h. In rats deficient in both vitamin E and essential fatty acids, there was damage to type-2 alveolar cells observed as swollen mitochondria and bleb formation in the cytoplasm. None of these changes was found in rats deficient in only one of these substances. Hyperoxia in rats deficient in both substance also caused destruction of the capillary endothelial cells and edema in the interstitium. The lungs of rats deficient in only one of the substances showed some edema in the capillary endothelial cells, but not destruction, and less interstitial edema. These findings suggest that simultaneous deficiency in vitamin E and essential fatty acids facilitates lung damage in rats exposed to hyperoxia.
Journal Article↗
Separation of conjoined twins using chest wall prosthesis.
Explore the source record for details and available documents.
Bone Cements↗
Effect of dopamine on parathyroid hormone release during surgery.
There is much evidence that dopamine (DA) may play an important role in modulating parathyroid gland function. DA stimulates parathyroid hormone (PTH) secretion in cattle, which increases ionized calcium, but is without such effect on humans under normal physiological conditions. Ionized calcium plays a major role in muscle contraction including myocardial contractility. Therefore, we studied the PTH response to infusion of DA (4 micrograms/kg/min) under pathophysiological states during two different types of surgery; gastrectomy with halothane anesthetics and open heart surgery with high-dose fentanyl anesthetics. There was no change in PTH concentration, as measured by radioimmunoassay, in patients undergoing gastrectomy, although infusion of DA in these patients was effective in lowering the prolactin levels. However, plasma PTH concentration significantly increased where DA was applied (4 micrograms/kg/min) in patients undergoing open heart surgery. These results suggest that DA may stimulate PTH secretion by an indirect mechanism in humans under pathophysiological states, although details of the mechanism are unknown, and that there is the possibility that DA would indirectly regulate the levels of electrolytes such as ionized calcium and phosphate in patients undergoing open heart surgery mediated by elevation of PTH.
Calcium↗
Endothelium-dependent relaxation in isolated pulmonary arteries from rabbits exposed to hyperoxia.
The effects of hyperoxia and superoxide dismutase (SOD) administration on endothelium-dependent relaxation induced by acetylcholine in isolated rabbit pulmonary artery (PA) preparations were examined. Relaxation responses to papaverine, and contractile responses to KCl and norepinephrine were also assessed using a bioassay technique. Prolonged hyperoxia in rabbits for 3 days produced loss of endothelium-dependent relaxation of the PA, and significant attentuation of contractile response to KCl and relaxation response to papaverine. These changes were prevented by subcutaneous SOD administration. Histological examination using light and electron microscopy revealed focal edema, destruction, and detachment of the PA endothelium in the PA strip preparations from these rabbits. Thus, it is concluded that a high concentration of oxygen exposure in rabbits for 3 days produces not only histological damage in the PA endothelium, but also causes impairment of vascular reactivity to constricting and relaxing agents. Subcutaneous SOD administration prevented oxygen-induced PA damage.
Acetylcholine↗
Design of RNA enzymes for sequence-dependent cleavage of RNA.
We have designed synthetic ribozymes which can cleave specific sites of RNA. An undecamer, 5S rRNA and transcripts using T7 RNA polymerase were hydrolyzed at the X position of RNA containing (N)nUX(N)n (N = A, G, C and U; X = A, C and U) by these ribozymes.
Base Sequence↗
Radiosensitivity test for cancer of the uterine cervix.
In selecting the method of treating uterine cervical cancer, radiosensitivity is one of the most important factors. To know this factor before treatment, we are trying to estimate radiosensitivity with changes of primary tumors before and after the irradiation. Tumors must be irradiated uniformly with small doses, and based on these considerations, we are attempting external test irradiation for estimation of radiosensitivity. Radiosensitivity was determined histopathologically by comparing the results of histological specimens taken before and seven days after test irradiation. Radiosensitivity is closely related to prognosis: of 183 cases with good sensitivity, 146 cases (79.8%) were surviving at five years after radiotherapy. On the other hand, the five-year survival rate of cases with poor sensitivity was only 37.2%. Comparing radiation with operation in operable cases of stage I and II, the five-year survival rate in cases with good sensitivity was about the same (90%). On the contrary, in cases with poor sensitivity, there was a substantial difference: that is, 66.0% of operated cases had a five-year survival compared with 39.7% of radiated cases.
Female↗
Cleavage of specific sites of RNA by designed ribozymes.
Two ribozymes were designed for site-specific cleavage of RNA. A UA site in an undecaribonucleotide was cleaved by a ribozyme consisting of two partially paired oligoribonucleotides with chain lengths of 19 and 15. The other ribozyme, which consists of a 19-mer and a 13-mer, recognized a UC sequence at positions 42 and 43 of 5 S rRNA.
Base Sequence↗
5'-Levulinyl and 2'-tetrahydrofuranyl protection for the synthesis of oligoribonucleotides by the phosphoramidite approach.
The levulinyl group has been employed for protection of the 5'-hydroxyl group in the synthesis of oligoribonucleotides by the phosphoramidite approach, using the acid-labile 2'-tetrahydro-furanyl group. The hydrazine treatment was performed for 10 minutes in order to remove the levulinyl group on controlled pore glass. Four decaribonucleotides (AAAAAAAAAU, GGGGGGGGGU, CCCCCCCCCU and UUUUUUUUUU) and a heneicosamer (GCCUAGCUGAUGAAGGGUGAU) were prepared with an automatic synthesizer in good yields.
Aminolevulinic Acid↗
Continuous infusion of vecuronium in children.
The average dose of vecuronium required in children continuous infusion to attain a steady state block of 90% was determined. The electromyographic (EMG) response and mechanical response to supramaximal stimulation of the ulnar never recorded simultaneously, were significantly correlated in four children. The steady-state infusion rate requirement of vecuronium was 1.4 +/- 0.03 micro g/kg/min during 2% enflurane anesthesia and 3.1 +/- 0.03 micro g/kg/min during 1% halothane anesthesia. The spontaneous recovery time to 25% of the control by EMG during halothane and enflurane anesthesia was 12.6 +/- 1.1 and 10.3 +/- 1.5 min, respectively, after termination of the infusion. There was no cumulative effect after prolonged vecuronium infusion.
Journal Article↗
Construction of a series of several self-cleaving RNA duplexes using synthetic 21-mers.
Two fragments (21-mers) containing consensus sequences for the self-cleavage domain in transcripts of satellite DNA of the newt were chemically synthesized and found to be cleaved in the presence of Mg2+. The cleaved product contained the 3'-terminal 2',3'-cyclic phosphate. Twenty-five combinations of partially double-stranded 21-mer RNA which contained different bases within the consensus sequences and at the cleavage sites were tested for self-cleavage. It seemed that guanosine 3'-phosphate was not susceptible to transesterification at the cleavage site.
Animals↗
Isoenzymes of alkaline phosphatase in germinoma cells.
Utilizing 18 germinomas, the characteristics of isoenzymes of alkaline phosphatase (ALP) in germinoma cells were examined by light and electron microscopic enzymohistochemical and immunohistochemical techniques and biochemical methods including inhibition tests, electrophoresis and electrosyneresis. ALP in germinoma cells was generally located on the cell surface. In a few germinoma cells, however, ALP was seen not only on the cell membrane but also in the endoplasmic reticulum. Enzymohistochemically as well as biochemically, ALP in germinoma cells was little sensitive to L-phenylalanine, moderately sensitive to L-homoarginine and somewhat resistant to heat in its inhibition tests. Immunohistochemical examinations and electrosyneresis showed the presence of the placental type of ALP in germinoma cells and biochemical analyses revealed that the heat-stable component of ALP in germinoma cells was consistent with the D-variant of the placental type of ALP. Therefore, germinoma cells possessed mixed isoenzymes of ALP, consisting mainly of the liver/bone type and a small amount of D-variant of the placental type on the cell surface. The prominent expression of ALP in germinoma cells may be due to the enhanced expression of gonadal genes active in the germinoma genome.
Adult↗
Reconstruction of the trachea in children with tracheal stenosis by using jet ventilation.
Explore the source record for details and available documents.
Female↗
Regulation of [3H]GABA release from strips of guinea pig urinary bladder.
The presence of receptors that regulate the release of gamma-aminobutyric acid (GABA) was studied in strips of the guinea pig urinary bladder. GABA (10(-8)-10(-5) M) and muscimol (10(-8)-10(-5) M), but not baclofen (10(-5) M), reduced the Ca2+-dependent, tetrodotoxin-resistant release of [3H]GABA evoked by high K+ from the urinary bladder strips preloaded with [3H]GABA. The inhibitory effect of muscimol was antagonized by bicuculline and potentiated by diazepam, clonazepam, and pentobarbital sodium. The potentiating effect of clonazepam was antagonized by Ro 15-1788. Acetylcholine (ACh) inhibited the high K+-evoked release of [3H]GABA. The inhibitory effect of ACh was antagonized by atropine sulfate and pirenzepine but not by hexamethonium. Norepinephrine (NE) inhibited the evoked release of [3H]GABA. The inhibitory effect of NE was mimicked by clonidine, but not by phenylephrine, and was antagonized by yohimbine but not by prazosin. These results provide evidence that the release of GABA from strips of guinea pig urinary bladder is regulated via the bicuculline-sensitive GABAA receptor, M1-muscarinic, and alpha 2-adrenergic receptors.
Acetylcholine↗