Search PubMed⌕ Search

Biomedical subjects

S Hill

Publications and source records attributed to S Hill.

At least 73 records · Page 4Linked to original sources
PubMed2000

Do psychosocial variables predict the physical growth of infants with orofacial clefts?

This study sought to determine whether psychosocial variables (parent-infant feeding interactions, infant temperament, maternal social support, family socioeconomic status) are important in predicting the physical growth of infants with orofacial clefts, after controlling for selected medical variables (infant health status, cleft diagnosis, and previous weight). Infant growth (weight-to-height zscores) was tracked for 2 years, and models were developed to predict growth at 3, 12, and 24 months. The authors also examined the growth trajectories of infants with different cleft types: cleft lip and palate (CLP) and cleft palate only (CPO). CPO infants showed some increase in their growth relative to the population mean over time, whereas the growth of CLP infants remained lower than the population mean at all time points. After controlling for medical variables, psychosocial variables collectively accounted for an additional 42% of the variance in infants' growth at 3 months of age, but they did not account for growth at 12 months and 24 months, largely due to the strong effect of previous growth. The authors tentatively conclude that psychosocial variables influence the early growth trajectory of infants with clefts, but subsequent growth becomes increasingly regulated by biological factors.

Child Development↗
PubMed1999

A conformational switch in syntaxin during exocytosis: role of munc18.

Syntaxin 1, an essential protein in synaptic membrane fusion, contains a helical autonomously folded N-terminal domain, a C-terminal SNARE motif and a transmembrane region. The SNARE motif binds to synaptobrevin and SNAP-25 to assemble the core complex, whereas almost the entire cytoplasmic sequence participates in a complex with munc18-1, a neuronal Sec1 homolog. We now demonstrate by NMR spectroscopy that, in isolation, syntaxin adopts a 'closed' conformation. This default conformation of syntaxin is incompatible with core complex assembly which requires an 'open' syntaxin conformation. Using site-directed mutagenesis, we find that disruption of the closed conformation abolishes the ability of syntaxin to bind to munc18-1 and to inhibit secretion in PC12 cells. These results indicate that syntaxin binds to munc18-1 in a closed conformation and suggest that this conformation represents an essential intermediate in exocytosis. Our data suggest a model whereby, during exocytosis, syntaxin undergoes a large conformational switch that mediates the transition between the syntaxin-munc18-1 complex and the core complex.

Animals↗
PubMed1999

Ultrasound densitometry of the os calcis in patients with hemiparesis following a cerebrovascular accident.

Ultrasound densitometry has been measured in the os calcis of 31 stroke patients (14 women, 17 men), ages 46-87 years, to determine whether bone density is lower than expected for normal subjects at this site, and to investigate whether or not the stroke side has lower values than the nonstroke side. We have also measured a large control group of 268(39 men, 228 women) subjects who showed similar values to other published data. Immobility is a known precursor to bone loss and so we also compared ultrasound Stiffness Index with an index of mobility in 22 of the stroke patients. In healthy subjects, ultrasound densitometry (measured as Stiffness) fell by 25% in females from 48-52 to 68-72 years. Stiffness (expressed as z-score) in patients with stroke was low in females (P < 0.02) but not in males, but both stroke side and nonstroke side were equally low. Stiffness did not decline with time since stroke, but did correlate with mobility after stroke, on the stroke (r = 0.73) and nonstroke (r = 0.62) side. The data suggest that stroke patients, particularly females, have low bone density before the stroke event. The greater ultrasound Stiffness with increasing mobility after stroke may suggest that active rehabilitation after stroke may produce denser bone.

Activities of Daily Living↗
PubMed1999

Endoscopic cryotherapy: experimental results and first clinical use.

BACKGROUND: Cryotherapy or the application of extreme cold has many potential applications in gastroenterology including tissue destruction and hemostasis but until now its development has been prevented by the lack of a delivery device suitable for use through the endoscope. We report here our experience with prototype devices using both liquid nitrogen driven by a cryosurgical system and cryogenic refrigerants (nitrous oxide and carbon dioxide) at or near ambient temperature. METHODS: Cryotherapy was applied to the distal esophageal mucosa of dogs via a flexible catheter passed through an upper endoscope. In other dogs, cryotherapy was used for hemostasis in a bleeding ulcer model. The procedure was also used for palliation in a 58-year-old man with unresectable adenocarcinoma of the stomach with pyloric channel obstruction. RESULTS: Freezing of the superficial mucosa was nearly instantaneous. All dogs survived the procedure and appeared to thrive. Histologic evaluation revealed significant necrosis of the superficial epithelial layer accompanied by a fibrinocellular infiltrate on the surface. These markers of acute injury subside by the fourth to sixth day and are replaced by regenerating epithelium, a process that is virtually complete by day 10. In the hemostasis experiments, bleeding ceased immediately after cryospraying of the lesions but resumed on thawing in most cases. Application of cryotherapy in the patient resulted in reduction of the pyloric mass with no immediately apparent adverse effects. CONCLUSIONS: These data, although preliminary, demonstrate the feasibility of endoscopic cryotherapy using a simple hand-held device. This device has broad potential for use in gastroenterology including ablation of superficial epithelium, debulking of large tumors and hemostasis.

Adenocarcinoma↗
PubMed1999

Inhibition of endotoxin-induced TNF-alpha production in macrophages by 5Z-7-oxo-zeaenol and other fungal resorcylic acid lactones.

Resorcylic acid lactones are fungal metabolites that exhibit a wide range of biological properties which includes oestrogenic, antifungal, phytotoxic and anti-inflammatory activity. The capacity of 5Z-7-oxo-zeaenol, a resorcylic lactone of fungal origin and six naturally occurring analogues to inhibit lipopolysaccharide (LPS)-induced cytokine production in phorbol 12-myristate-13-acetate (PMA)-treated cultured myelomonocytic cells (U937) was compared. The activity of the natural analogues in the U937 assay varied over 10(4)-fold, with 5Z-7-oxo-zeaenol the most potent of those tested inhibiting tumour necrosis factor-alpha (TNF alpha) production in these cells with IC50 of 6 nM. The isomeric 7-oxo-zeaenol and structurally more distant monorden (radicicol) were the next most active compounds with IC50 approximately 500 nM, and zearalenone, the least active with IC50 > 400 microM. 5Z-7-oxo-zeaenol retained activity in LPS-stimulated peripheral blood mononuclear cells with an IC50 of 10-25 nM. This compound also inhibited LPS-induced TNF alpha production in whole blood experiments (IC50 100-1000 nM) and lowered serum levels of TNF alpha in mice when administered prior to LPS. 5Z-7-oxo-zeaenol was shown to inhibit the phosphorylation and activation of mitogen-activated protein kinase (MAPK) induced by LPS. These data are consistent with a mechanism of action at or upstream of MAPK with resultant downstream effects. This series of naturally occurring analogues represents an interesting group of compounds with diverse biological properties. Of this series, 5Z-7-oxo-zeanenol has exceptionally potent anti-inflammatory properties exhibited by its strong inhibition of cytokine production.

Adult↗
PubMed1999

A pilot study to evaluate the effects of floatation spa treatment on patients with osteoarthritis.

OBJECTIVE: To conduct a preliminary investigation of the effects on floatation spa therapy on quality of life in patients with osteoarthritis to see if controlled trials are warranted. DESIGN: Uncontrolled clinical trial. SETTING: Private floatation spa therapy centre. PATIENTS: Fourteen patients with chronic osteoarthritis of the weight-bearing joints, of whom four dropped out. INTERVENTION: Six weekly sessions of floatation spa therapy. OUTCOME MEASURES: SF36, AIMS2 and MYMOP quality-of-life questionnaires. MAIN RESULTS: All patients improved. Differences between baseline and discharge scores showed statistically significant improvement for MYMOP, but not AIMS2 or SF-36. CONCLUSIONS: Controlled trials of floatation spa therapy for patients with osteoarthritis are warranted.

Aged↗
PubMed1999

Disclosing special needs to parents. Have we got it right yet?

Parents' perceptions of how they were told that their child has special needs were examined. Thirty-nine families on the Isle of Wight completed a structured interview. Participants formed two groups. The first group comprised of 23 families who had a child aged from birth to 5 years with special needs. In the second group there were 16 families who had a child aged between 15 and 20 years with special needs. Parents were asked about their perceptions of how their child's special needs were disclosed, their satisfaction with how they were told and what improvements they would have liked. Differences between the two cohorts were examined, and changes in how services were perceived were investigated. Overall, parents in the group with younger children were more satisfied about the way in which they were told that their child had special needs than those with older children. Implications for service delivery and future research are considered.

Adolescent↗
PubMed1999

The effects of information framing on the practices of physicians.

OBJECTIVE: The presentation format of clinical trial results, or the "frame," may influence perceptions about the worth of a treatment. The extent and consistency of that influence are unclear. We undertook a systematic review of the published literature on the effects of information framing on the practices of physicians. DESIGN: Relevant articles were retrieved using bibliographic and electronic searches. Information was extracted from each in relation to study design, frame type, parameter assessed, assessment scale, clinical setting, intervention, results, and factors modifying the frame effect. MAIN RESULTS: Twelve articles reported randomized trials investigating the effect of framing on doctors' opinions or intended practices. Methodological shortcomings were numerous. Seven papers investigated the effect of presenting clinical trial results in terms of relative risk reduction, or absolute risk reductions or the number needing to be treated; gain/loss (positive/negative) terms were used in four papers; verbal/numeric terms in one. In simple clinical scenarios, results expressed in relative risk reduction or gain terms were viewed most positively by doctors. Factors that reduced the impact of framing included the risk of causing harm, preexisting prejudices about treatments, the type of decision, the therapeutic yield, clinical experience, and costs. No study investigated the effect of framing on actual clinical practice. CONCLUSIONS: While a framing effect may exist, particularly when results are presented in terms of proportional or absolute measures of gain or loss, it appears highly susceptible to modification, and even neutralization, by other factors that influence doctors' decision making. Its effects on actual clinical practice are unknown.

Clinical Trials as Topic↗
PubMed1999

Microscopic anatomy of the posterior interosseous and median nerves at sites of potential entrapment in the forearm.

We describe the macroscopic and microscopic anatomy of the posterior interosseous (PIN) and median nerves, at the arcade of Frohse and pronator arch respectively, in nerves obtained from five cadavers. Nerves were either constricted at sites of potential entrapment; appeared swollen proximal to these sites; or exhibited neither swelling nor constriction. Renaut bodies were present in all nerves. In the PIN, most Renaut bodies were found beneath a tendinous arcade of Frohse, whereas in the median nerve most were found proximal to the pronator arch. We propose that since Renaut bodies appear to displace normal endoneurial components, and may be associated with low-grade axonal drop-out, their presence may adversely affect the functional outcome of surgical decompression of either the PIN or median nerve.

Aged↗
PubMed1999

Homologous human and murine antisense oligonucleotides targeting stat6. Functional effects on germline cepsilon transcript.

Interleukin (IL)-4 and (IL)-13 induce immunoglobulin (Ig)E synthesis via activation of the transcription factor signal transducer and activator of transcription (Stat)6. The present study describes the identification and characterization of antisense oligonucleotides to Stat6 as an approach to interrupt IL-4 and IL-13 signaling and thereby to attenuate germline Cepsilon transcription, a prerequisite to IgE synthesis. A limited gene-walk was performed with chemically modified oligonucleotides to identify sequences capable of downregulating both human and murine Stat6. A chimeric oligonucleotide (9b, base sequence GTGAGGTCCTGTTCAGTGGG) demonstrated high levels of antisense activity in both species. Further characterization of 9b showed a dose-dependent Stat6 messenger RNA (mRNA) and protein downregulation (concentration that produces 50% inhibition of effect = 168 and 215 nM, respectively) through a ribonuclease H-dependent antisense mechanism with no effect on closely related members of the Stat family. Further, pretreatment of DND39 cells (human Burkitt lymphoma cell line) with oligonucleotide 9b before IL-4 stimulation successfully downregulated germline Cepsilon transcription. Because Stat6 represents an attractive but technically challenging drug discovery target, antisense oligonucleotides may provide an alternative approach to low molecular-weight compounds for inhibiting IL-4 and IL-13 signaling.

Animals↗
PubMed1999

Anniversary reactions in Gulf War veterans: a follow-up inquiry 6 years after the war.

OBJECTIVE: The goal of this study was to assess the occurrence of anniversary reactions in Gulf War veterans 6 years after the conclusion of the war. METHOD: Subjects were administered questionnaires and asked to identify specific months of best and worst functioning and months of least or most symptoms of posttraumatic stress disorder (PTSD) for the 12 months before the study. Months of negative experiences were compared with previously documented dates of exposure to traumatic events during the war. Similar reports were also obtained from the veterans' spouses in order to assess corroborative evidence for the occurrence of anniversary reactions. RESULTS: Anniversary reactions occurred with a frequency greater than chance and most often in individuals exposed to a greater number of traumatic events. Overall, spouse reports matched the veterans' reports of anniversary reactions. In addition, spouses identified anniversary reactions that were not endorsed by their veterans. CONCLUSIONS: These data suggest that anniversary reactions occur in numbers greater than those expected by chance, are correlated to the occurrence of traumatic events, and may be a part of the syndrome of PTSD.

Adjustment Disorders↗
PubMed1999

Conducting qualitative research in the health sector: researcher issues and dilemmas.

This article contributes to bridging the gap between research activity and the practical implementation of management decision making in the health sector by reflecting upon some of the issues and dilemmas for researchers, whether academics or managers, in conducting qualitative research in this sector. The article presents the methodological issues addressed by a team of researchers engaged on a project about manager learning and development in an NHS Trust, and highlights concerns about ethical issues that emerged from the research process. The study had involved a series of interviews with senior managers and clinical staff, doctors, nurses and therapists, and it addressed issues surrounding change within the organization, the impact on individuals' jobs, and the resultant learning and development required and undertaken. The article emphasizes that engaging in reflection on the research process is valuable and suggests that it should become a mainstream part of such research. It concludes that there is an important role of qualitative management research in the health sector and that for it to be acceptable and valued, it must be operationally sensitive, ethically robust and methodologically rigorous.

Confidentiality↗
PubMed1999

Can renal replacement be deferred by a supplemented very low protein diet?

Patients with chronic renal failure are commonly started on renal replacement therapy (RRT) as soon as (or, in some centers, before) the usual criteria for severity are met, i.e., GFR <10 ml/min for nondiabetic patients and <15 ml/min for diabetic patients. To determine whether RRT can safely be deferred beyond this point, adults with all types of chronic renal failure who met these criteria on presentation (23 patients) or who reached these levels of severity during treatment (53 patients) were managed conservatively until RRT was judged necessary by their chosen dialysis or transplantation team, without input into this decision from the present authors. Patients were prescribed a very low protein diet (0.3 g/kg) plus supplemental essential amino acids and/or ketoacids and followed closely. The intervals between the time at which GFR became less than 10 ml/min (15 ml/min in diabetic patients) and the date at which renal replacement therapy was started were used as estimates of renal survival on nutritional therapy. Kaplan-Meier analysis showed median renal survival of 353 d. Acidosis and hypercholesterolemia were both predictive of shorter renal survival. Signs of malnutrition did not develop. Final GFR averaged 5.6 +/- 1.9 ml/min. Two patients died; thus, annual mortality was only 2.5%. Hospitalizations totaled 19 in 93 patient-years of treatment, or 0.2 per year. Thus, these well motivated patients with GFR <10 ml/min (<15 ml/min in diabetic patients) were safely managed by diet and close follow-up for a median of nearly 1 yr without dialysis. It is concluded that further study of this approach is indicated.

Adolescent↗
PubMed1998

Clinical differentiation between Proteus syndrome and hemihyperplasia: description of a distinct form of hemihyperplasia.

Proteus syndrome is a rare and highly variable hamartomatous syndrome that can affect multiple organ systems. It is characterized by hyperplastic lesions of connective tissue, vascular malformations, linear verrucous epidermal nevi, and hyperostoses. The cause of the disorder is unknown, but the current working hypothesis is that it is caused by a mosaic alteration that leads to a highly variable phenotype, equal sex ratio, sporadic occurrence, and discordant monozygotic twins. Herein we describe our experience with 18 patients with a referring diagnosis of Proteus syndrome. It was found that imaging studies are very useful for the characterization of the syndrome. One finding was that splenic hyperplasia can be a manifestation of Proteus syndrome. Analysis of the clinical data shows that Proteus syndrome is frequently confused with "hemihyperplasia." A distinct subtype of hemihyperplasia is defined that includes static or mildly progressive hemihyperplasia and multiple lipomata.

Adolescent↗
PubMed1998

Electron donation to the flavoprotein NifL, a redox-sensing transcriptional regulator.

Transcriptional control of the nitrogen fixation (nif) genes in response to oxygen in Azotobacter vinelandii is mediated by nitrogen fixation regulatory protein L (NifL), a regulatory flavoprotein that modulates the activity of the transcriptional activator nitrogen fixation regulatory protein A (NifA). CD spectra of purified NifL indicate that FAD is bound to NifL in an asymmetric environment and the protein is predominantly alpha-helical. The redox potential of NifL is -226 mV at pH 8 as determined by the enzymic reduction of NifL by xanthine oxidase/xanthine in the presence of appropriate mediators. The reduction of NifL by xanthine oxidase prevented NifL from acting as an inhibitor of NifA. In the absence of electron mediators NifL could also be reduced by Escherichia coli flavohaemoprotein (Hmp) with NADH as reductant. Hmp contains a globin-like domain with haem B as prosthetic group and an FAD-containing oxidoreductase module. The carboxyferrohaem form of Hmp was competent to reduce NifL, suggesting that electron donation to NifL originates from the flavin in Hmp rather than by direct electron transfer from the haem. Spinach ferredoxin:NAD(P) oxidoreductase, which adopts a folding similar to the FAD- and NAD-binding domains of Hmp, also reduced NifL with NADH as reductant. Re-oxidation of NifL occurs rapidly in the presence of air, raising the possibility that NifL might sense intracellular oxygen. We propose a physiological redox cycle in which the oxidation of NifL by oxygen and hence the activation of its inhibitory properties occurs rapidly, in contrast with the switch from the active to the reduced form of NifL, which occurs more slowly.

Azotobacter vinelandii↗