Biomedical subjects

S Chandrasekaran

Publications and source records attributed to S Chandrasekaran.

At least 37 records · Page 2Linked to original sources

PubMed1998

Darkfield microscopic (DFM) and serologic evidences for leptospiral infection in panuveitis cases.

186 out of 226 (82%) panuveitis cases showed the presence of leptospira in their blood samples by dark field microscopy. 75% cases were found positive for leptospira after low speed centrifugation and an additional 7% became positive after high speed centrifugation. Leptospirosis was four times more common in males than in females. The disease was more prevalent in the age group of 15 to 54 years. MAT was performed in 23 cases of which 9 were positive. ELISA was performed in 20 cases of which 9 were positive. DFM was positive in 19 out of these 23 cases. MAT, ELISA and DFM were positive in six cases. Highest antibody titre was found due to L. autumalis alone in two cases, L. autumnalis, and L. pomona in one case, L. bharathy in one case, L. lanka alone in one case and L. pomona one in one case. DFM was found to be more sensitive in a smal number of cases and hence DFM needs further evaluation by other workers in this field.

Adolescent↗

PubMed1997

Usefulness of dark field microscopy after differential centrifugation in the early diagnosis of leptospirosis in dog and its human contacts.

1. We found leptospira in the blood of two out of three police dogs by dark field microscopic examination after high speed centrifugation. One dog had fever and the other was asymptomatic. Leptospira could not be seen in the urine of one police dog which died of jaundice. 11 out of 21 human contacts were found to be positive for leptospira after low speed centrifugation and 5 after high speed centrifugation. One child had jaundice and an another child had fever. Others had mild symptoms of headache to none. Dark field microscopy after differential centrifugation is useful in the early diagnosis of leptospirosis and thereby could prevent later complications like jaundice.

Adult↗

PubMed1996

Dobutamine stress testing in the cardiac catheterization laboratory.

Dobutamine stress ventriculography is a safe test that appears to separate groups of patients with and without significant coronary artery stenoses. In this study, all 7 patients with significant coronary artery stenoses who reached a heart rate > or = 110 beats/min had a positive stress test, whereas 9 of 10 control patients had a negative stress test.

Adult↗

PubMed1996

An oligodeoxyribonucleotide N3'--> P5' phosphoramidate duplex forms an A-type helix in solution.

The solution conformations of the dinucleotide d(TT) and the modified duplex d(CGCGAATTCGCG)2 with N3'--> P5' phosphoramidate internucleoside linkages have been studied using circular dichroism (CD) and NMR spectroscopy. The CD spectra indicate that the duplex conformation is similar to that of isosequential phosphodiester RNA, a A-type helix, and is different from that of DNA, a B-type helix, NMR studies of model dimers d(TpT) and N3'--> P5' phosphoramidate d(TnpT) show that the sugar ring conformation changes from predominantly C2'-endo to C3'-endo when the 3'-phosphoester is replaced by a phosphoramidate group. Two-dimensional NMR (NOESY, DQF-COSY and TOCSY spectra) studies of the duplex provide additional details about the A-type duplex conformation of the oligonucleotide phosphoramidate and confirm that all furanose rings of 3'-aminonucleotides adopt predominantly N-type sugar puckering.

Base Sequence↗

PubMed1995

Studies on the incidence of leptospirosis and possible transmission of Leptospira during leptospiraemia.

During the year 1991 and in the first half year of 1992 a total of 179 cases and 288 cases respectively were tested for the presence of Leptospira by dark ground microscopy and 86 cases (48%) and 157 cases (54.5%) were found to be positive for Leptospira in their blood samples only. The disease was endemic and more prevalent in the age group of 5 to 14 years and 15 to 54 years and affected both sexes. Clinical categorisation of 169 cases in 1991 and 266 cases in the first half of the year 1992 along with the dark ground microscopy results showed that there was no strict correlation between the concentration of Leptospira in the blood and the severity of infection. Epidemiological data regarding the occupation and the contacts indicated that students and medical staff accounted for more than fifty percent of leptospiral infection and there was the possibility of transmission of Leptospira during leptospiraemia. Dark ground microscopy studies on blood samples from 20 cases who came for repeat testing showed the presence of Leptospira in blood up to 43 days and suggested that the convalescent carrier may have a role in the transmission of Leptospira during Leptospiraemia.

Adolescent↗

PubMed1994

Hairpin formation within the human enkephalin enhancer region. 2. Structural studies.

Receptor-mediated induction of the human proenkephalin gene has been mapped to an imperfect palindrome located between -104 and -86, upstream of the transcriptional start site. Several lines of evidence suggest that receptor-mediated transcription of proenkephalin involves a reversible conformational change from duplex to a hairpin state of the enhancer [McMurray, C.T., Wilson, W.D., & Douglass, J.O. (1991) Proc. Natl. Acad. Sci. U.S.A. 88, 666]. To determine the structure that would form if such a conformational change took place, we have synthesized two 23-bp oligonucleotides, d(GCTGGCGTAGGGCCTGCGTCAGC) and d(GCTGACGCAGGCCCTACGCCAGC), whose sequences are identical to the top and the bottom strands of the native enhancer. We have found that each oligonucleotide strand exists primarily as a hairpin structure over a wide range of oligonucleotide concentrations and a wide range of temperatures (0-45 degrees C). The assignment of each imino proton was carried out using 1D and 2D nuclear Overhauser effects (NOE) and by comparison with the spectra of hairpins containing single base substitutions. The hairpin structure for each oligonucleotide contains a 3-member loop, a 10-bp stem, and two mismatched pairs. The hairpin that forms from the top strand of the enhancer and contains two GT mispaired bases creates an alternative binding site for the cyclic adenosine monophosphate element binding protein (CREB), a transcription factor that binds to and regulates the human proenkephalin gene. Circular dichroism and 31P NMR indicate that, despite the presence of mismatched pairs, each oligonucleotide hairpin adopts a B-form conformation with no unusual bending or kinking. The structure of the hairpin may explain the effect on expression of point mutations within the enhancer.

Base Sequence↗

PubMed1994

Relationship between active protection in vaccinated buffaloes against haemorrhagic septicaemia and passive mouse protection test or serum antibody titres.

The relationship between the standard passive mouse protection test or serum antibody titres measured by indirect haemagglutination or enzyme-linked immunosorbent assays and active protection in buffaloes immunized with different types of haemorrhagic septicaemia bacterins was investigated. Groups of 2-3 buffaloes were immunized with the bacterins currently in use in Asia, viz., broth bacterin (BB), alum precipitated vaccine (APV) and oil adjuvant vaccine (OAV) either subcutaneously (BB, APV) or intramuscularly (OAV) and challenged subcutaneously with virulent organisms at different periods post-immunization. Although the passive mouse protection and indirect haemagglutination tests carried out with the pre-challenge sera from vaccinated buffaloes revealed no relationship with active protection in buffaloes, a relationship was observed between the ELISA antibody titres and protection. In contrast, a dose-response relationship was observed between the homologous active and passive mouse protection test.

Animals↗

PubMed1994

Characterization of immune response and duration of protection in buffaloes immunized with haemorrhagic septicaemia vaccines.

Two of the three buffaloes immunized with a non-adjuvanted broth bacterin were found to be protected against experimental challenge at 6 weeks but not at 3 months post-challenge. Similarly all buffaloes (4/4) immunized with alum-precipitated vaccine were protected at 6 months but only 1 of the 2 vaccinated animals were protected at 12 months post-immunization. On the other hand, buffaloes immunized with an oil adjuvant and a double emulsion vaccine were completely protected at 12 months post-immunization. Statistically significant differences between immunized versus non-immune animals became evident at 3 months post-immunization, although analysis of cumulative antibody titres of pre-challenge sera of vaccinated buffaloes surviving versus those succumbing to experimental challenge revealed significant by higher antibody titres in the former as compared to the latter group. These results suggested that there was a relationship between ELISA antibody titres and active protection in buffaloes. There also appeared to be a relationship between cutaneous delayed-type hypersensitivity and active protection in buffaloes. Preliminary analysis of the antibody isotype distribution in the pre-challenge sera of 2 buffaloes vaccinated with the oil adjuvant vaccine revealed predominance of IgG1 and IgG2 subclasses whose role in protection against haemorrhagic septicaemia was not eludicated.

Animals↗

PubMed1994

Oligomannosides initiate cell spreading of laminin-adherent murine melanoma cells.

Murine melanoma cells readily bind and spread on murine laminin. Uncoupling of spreading from adhesion occurs when unglycosylated laminin is used as the cellular substratum; spreading is restored by soluble glycosylated laminin or soluble glycopeptides of laminin. In this study, using kifunensine, we produced and characterized an oligomannoside-rich glycoform of laminin. When used as a substratum for cell attachment and spreading, this laminin was as effective as mature glycosylated laminin. When added in solution to unglycosylated laminin-adherent cells, kifunensine-laminin was more effective in promoting cell spreading than mature glycosylated laminin. Reconstitution with soluble polysaccharides showed that cell spreading was initiated rapidly by microgram amounts of mannan but not other polysaccharides and approached a maximum within 1 h; titration with mannan yielded an adsorption isotherm profile. Mannose was an antagonist, preventing mannan from restoring cell spreading, but it was not an agonist. A Pronase digest of mature glycosylated laminin, depleted of its oligomannoside-peptides, was unable to restore cell spreading, whereas a control digest was fully active. Melanoma cells were unable to bind to three different neoglycoprotein surfaces, but when soluble unglycosylated laminin was present in the medium the cells adhered to and spread only upon mannosylated bovine serum albumin. Of the various cell lines known to interact with glycosylated laminin only murine melanoma cells showed oligomannoside-dependent spreading on an unglycosylated laminin substratum. The composite results indicate that oligomannosides are necessary to initiate murine melanoma cell spreading on laminin but are not sufficient for cell adhesion.

Alkaloids↗

PubMed1994

Characterization of oligomannoside binding to the surface of murine melanoma cells. Potential relationship to oligomannoside-initiated cell spreading.

The spreading of murine melanoma cells on unglycosylated laminin is initiated by soluble glycosylated laminins containing oligomannosides, or by mannan, and is inhibited by mannose (Chandrasekaran, S., Tanzer, M. L., and Giniger, M. S. (1994) J. Biol. Chem. 269, 3356-3366). In the present study, melanoma cell recognition of oligomannosides was explored by several different methods. Comparison of cell spreading, initiated by related branched oligomannosides, showed that micromolar concentrations of Man6 and Man9 were able to restore cell spreading maximally, whereas Man3 was ineffective. Man9 bound to the melanoma cells in a bimodal manner at micromolar concentrations, reaching saturation, whereas Man3 showed linear binding in the same and higher ranges. Comparison of Man9 binding with Man9-initiated cell spreading demonstrated that maximal spreading occurred at approximately half-saturation. Competition experiments showed that mannose or mannan effectively impaired Man9 binding to the cells, whereas galactose or fucose was ineffective. Mannan-conjugated fluorescent beads bound in a diffuse pattern to the surface of melanoma cells, whereas underivatized beads did not bind. The distribution of laminin-binding beta 1 integrin on the cell surface was compared with surface mannan binding. The beta 1 integrin staining pattern did not match the mannan staining pattern either in attached, nonspread cells or in attached, spread cells. The composite results support a model in which occupancy of both an integrin and a cell surface lectin is required for murine melanoma cells to spread on glycosylated laminin.

Animals↗

PubMed1993

Secondary structure creates mismatched base pairs required for high-affinity binding of cAMP response element-binding protein to the human enkephalin enhancer.

Transactivation studies of the enkephalin enhancer indicate that two cAMP response elements (CRE-1 and CRE-2) are needed to mediate the transcriptional response to cAMP and to the CRE-binding protein (CREB) transcription factor. CRE-1 and CRE-2 are contained within a nearly palindromic region that can form stable hairpin structures in vitro. CREB binds only weakly to the native duplex enhancer and only within CRE-2. In contrast, CREB binds with high affinity to the hairpin in which CRE-1 and CRE-2 come together to form a CREB site with two G.T base pairs. NMR and binding studies show that high-affinity binding to the G.T hairpin requires one of the mismatched G.T pairs. Insertion of that G.T pair into the duplex confers high-affinity binding. Parallel studies with the somatostatin CRE show that the T in one G.T pair is crucial for high-affinity binding. The existence within a short enhancer of alternative sites for a single factor suggests a mechanism for regulation of transcription by DNA structure.

Animals↗

PubMed1993

Role of laminin carbohydrates on cellular interactions.

Laminins, a family of large multidomain glycoproteins of the basal lamina, have been implicated in the development and maintenance of cellular and tissue organization. Considerable interest has arisen concerning the ways in which laminin carries out its biological functions. Previously these biologic responses have been primarily attributed to the peptide sequences of laminin, however, newer studies suggest that laminin carbohydrates may also participate in such cellular activities. Recently, a subpopulation of laminin molecules purified from EHS sarcoma by lectin affinity chromatography has been shown to contain about 25 to 30% carbohydrate. Most of the carbohydrates present are complex-type asparagine-linked oligosaccharides encompassing many different structures, some of which are unique to laminin. To date, the biological function of the carbohydrates of laminin remains somewhat unclear. They do not appear to be needed for heparin binding or to enhance proteinase stability, however, current evidence suggests they are important in cellular spreading and neurite outgrowth. It is our hypothesis that in the covalently-linked carbohydrate moieties of laminin will ultimately prove to be involved in information transfer to responsive cells. It is the purpose of this review to delineate current concepts of the structure and function of this unique glycoprotein's sugar chains.

Animals↗

PubMed1993

Delayed traumatic extradural haematomas.

A total of 76 patients with traumatic extradural haematoma were treated within a period of 3 years. Four patients developed delayed extradural haematomas. These cases are reported in view of the unusual sequence and the importance of early diagnosis.

Adolescent↗

PubMed1993

Laminin oligosaccharides play a pivotal role in cell spreading.

The basement membrane glycoprotein laminin promotes cell adhesion, spreading and neurite outgrowth. We can uncouple cell adhesion and spreading (or neurite outgrowth) when unglycosylated laminin is used as a substratum. Mouse melanoma cells, B16F1 line, readily attach to unglycosylated laminin but fail to spread once adherent. Spreading can be restored by titration with glycosylated laminin or with laminin glycopeptides. When the laminin substratum is absent in the test chambers, the cells do not adhere when either intact laminin or its glycopeptides are then added. Analyses show that these added substances are recoverable from the culture medium and do not bind to the chamber surfaces. Use of selective inhibitors which interfere with carbohydrate processing yields several glycoforms of laminin which we have isolated and examined for their ability to support cell adhesion and spreading. Laminin which is enriched in high mannose oligosaccharides is much more effective in promoting cell spreading than laminin which is enriched in hybrid oligosaccharides. These results are consistent with earlier studies which showed that ConA, which primarily recognizes mannose residues, could also uncouple cell adhesion and spreading. Although mono- and disaccharides failed to restore cell spreading, we have found that addition of various mannose oligosaccharides to adherent cells effectively reestablishes their spreading behavior. The extent of cell spreading which is achieved by the added saccharides is related to their amount, their duration of addition, and their molecular structures.(ABSTRACT TRUNCATED AT 250 WORDS)

Animals↗

PubMed1992

Cloning and developmental expression of the alpha 3 chain of chicken type IX collagen.

Fibrous and nonfibrous collagens comprise two major groups within the collagen family and both groups are found in a diverse variety of tissue fabrics. Type IX collagen is in the nonfibrous group; three different subunits of type IX collagen have been identified and the alpha 1 and alpha 2 subunits have been cloned. Using molecular cloning methods we have isolated, from an embryonic chicken cartilage library, cDNA clones which code for the entire alpha 3 chain of chicken type IX collagen. The cDNA clones encompass 2416 base pairs which have a conceptual open reading frame for a protein containing 675 amino acids including 193 Gly-X-Y repeats. These collagen repeats are in three separate domains which are interspersed with four major noncollagen domains. The collagen repeats also have four minor interruptions. This chain organization directly aligns with both the alpha 1 and alpha 2 chains of chicken type IX collagen. Comparison of the deduced amino acid sequence with peptide sequences of type IX collagens shows identity with 95 of the 96 known residues of the chicken alpha 3 chain and 81 of the 98 known residues of the bovine alpha 3 chain. The identical residues match those in five peptide fragments, two from the bovine protein and three from the chicken protein. The chicken and bovine alpha 3 chains have conserved cross-linking sites, separated by 137 residues which span 40 nm, the length of the hole zone in a collagen fibril. The NC3 domain of the chicken alpha 3 chain contains a repeat Cys-Pro motif which is present in both vertebrate and invertebrate nonfibrillar collagens. Northern blot hybridization exhibits a major mRNA of about 3.3 kilobases; this transcript is found in cartilaginous tissues in the embryo, including the developing limb and is not detected in other tissues or in the precondensation stage of limb development. The composite data delineate the primary structure of the alpha 3 chain of chicken type IX collagen, show its close relationship to the alpha 1 and alpha 2 chains, demonstrate its mRNA transcript, and show the appearance of that transcript in tissues of the developing chick embryo.

Amino Acid Sequence↗

PubMed1992

MHA-Tp testing on HIV positive and negative women in vigilance home at Madurai.

In the study group of 94 cases of female prostitutes and their children 55 cases showed positive for HIV infection by ELISA and Western Blot tests. They showed positive also for syphilis in 37 cases by VDRL and in 43 cases by MHA-Tp tests among HIV positive and negative women. The association of HIV infection and syphilis was observed in this study due to sexual transmission of these infections. But congenital spread from infected mother to their children was not observed in this study since both mothers and their children were negative for these infections. MHA-Tp testing confirmed VDRL test results in 27 cases and also increased specificity of MHA-Tp test result over VDRL result in 16 cases and exclusion of biological false positive by VDRL in 10 cases were noticed in this study.

Adult↗

PubMed1992

A case of Dandy Walker cyst with porencephaly.

A 27-year-old gravida two para one mother delivered a term male baby by caesarean section. The baby was referred for enlarged head. This neonate with large head was found to have Porencephalic cyst with dilated Triventricular system. There was a posterior fossa cyst communicating with fourth ventricle. A diagnosis of Dandy Walker Cyst with Porencephaly was made. Ventriculo-Peritoneal shunt was done on the ninth day of life. The baby had an uneventful postoperative period and was subsequently discharged.

Adult↗

PubMed1991

Laminin carbohydrates are implicated in cell signaling.

We have examined how laminin carbohydrates participate in cellular responses and have focused upon cell spreading and neurite outgrowth. Our earlier studies showed that unglycosylated laminin fully supported cell adhesion but did not promote subsequent spreading of mouse melanoma cells or neurite outgrowth of rat pheochromocytoma cells (Dean et al. (1990): J Biol Chem 265:12553-12562). In the present experiments, we determined whether those cellular responses could be restored to adherent cells. When a mixture of unglycosylated and glycosylated laminins was used as a substratum for mouse melanoma cells, some cells began to spread when 30% glycosylated laminin was present. At least 65% glycosylated laminin was required to elicit a maximal spreading response by the majority of the cells. In separate experiments, we found that cell spreading was fully restored by a pronase digest of glycosylated laminin; a similar digest of unglycosylated laminin had no effect. These results indicate that laminin carbohydrates, rather than polypeptide sequences, were responsible for cell spreading. We also conclude that substrate attachment of the carbohydrate moieties was not essential. In other experiments, laminins containing immature oligosaccharides were produced using two glycosylation pathway inhibitors, swainsonine or castanospermine. When such laminins were used to study cell spreading or neurite outgrowth, laminin containing immature oligosaccharides was as effective as laminin which contains fully processed oligosaccharides. In contrast, laminin with partially processed oligosaccharides had incomplete activity. These composite reconstitution experiments show that laminin carbohydrates provide essential information to responsive cells, enabling them to progress from an adherent state to a spread form or to extend neurite processes.

Animals↗