Biomedical subjects

S A Akman

Publications and source records attributed to S A Akman.

At least 37 records · Page 2Linked to original sources

PubMed1995

Formation of DNA-protein cross-links in cultured mammalian cells upon treatment with iron ions.

Formation of DNA-protein crosslinks (DPCs) in mammalian cells upon treatment with iron or copper ions was investigated. Cultured murine hybridoma cells were treated with Fe(II) or Cu(II) ions by addition to the culture medium at various concentrations. Subsequently, chromatin samples were isolated from treated and control cells. Analyses of chromatin samples by gas chromatography/mass spectrometry after hydrolysis and derivatization revealed a significant increase over the background amount of 3-[(1,3-dihydrio-2,4-dioxopyrimidin-5-yl)-methyl]- L-tyrosine (Thy-Tyr crosslink) in cells treated with Fe(II) ions in the concentration range of 0.01 to 1 mM. In contrast, Cu(II) ions at the same concentrations did not produce this DPC in cells. No DNA base damage was observed in cells treated with Cu(II) ions, either. Preincubation of cells with ascorbic acid or coincubation with dimethyl sulfoxide did not significantly alleviate the Fe(II) ion-mediated formation of DPCs. In addition, a modified fluorometric analysis of DNA unwinding assay was used to detect DPCs formed in cells. Fe(II) ions caused significant formation of DPCs, but Cu(II) ions did not. The nature of the Fe(II)-mediated DPCs suggests the involvement of the hydroxyl radical in their formation. The Thy-Tyr crosslink may contribute to pathological processes associated with free radical reactions.

Animals↗

PubMed1994

High-dose doxorubicin, etoposide, and cyclophosphamide with stem cell reinfusion in patients with metastatic or high-risk primary breast cancer. City of Hope Bone Marrow Oncology Team.

BACKGROUND: Chemotherapy with a doxorubicin-containing regimen results in high overall response rates in the treatment of metastatic adenocarcinoma of the breast; the combination of doxorubicin, etoposide, and cyclophosphamide has produced a response rate of 84% in untreated patients with stage IV disease. Recent data suggest that selected groups of patients with metastatic disease treated with high-dose chemotherapy and stem cell support may enjoy unmaintained, long-term remission. This study was designed to establish the feasibility of administering the combination of high-dose infusional doxorubicin, etoposide, and cyclophosphamide followed by autologous stem cell rescue in patients with responsive metastatic, or high-risk primary breast cancer. METHODS: Criteria for patient enrollment included the presence of high-risk primary breast cancer (stage II with > or = 10 involved axillary nodes or stages III A or B) or stage IV disease in complete or partial response; Karnofsky performance status of 80% or more; no prior radiation therapy to the left side of the chest; exposure to a 150-mg/m2 or smaller cumulative dose of doxorubicin, and a ventricular ejection fraction of 55% or more. Chemotherapy consisted of escalating doses of doxorubicin given by a 96-hour continuous intravenous infusion, followed by 60 mg/kg of etoposide and 100 mg/kg cyclophosphamide, both given intravenously. On Day 0, autologous bone marrow with or without peripheral stem cells, or granulocyte colony-stimulating factor primed peripheral stem cells alone were reinfused. RESULTS: Thirty-five patients were treated in this study. There were no treatment-related deaths. No patient had a decrease in cardiac ejection fraction below 50% as a consequence of high-dose chemotherapy. Two patients suffered grade 3 mucositis at the highest level of doxorubicin (200 mg/m2). Of 21 patients treated for primary high-risk breast cancer, 19 are recurrence free, with a median follow-up of more than 8 months (> or = 4-36 months). Five of fourteen patients with stage IV disease remain progression free at greater than or equal to 5, 7, 9, 15, and 42 months. For patients with stage IV breast cancer, the median progression-free survival after high-dose chemotherapy was 9 months; the median overall survival had been reached at 22 months. CONCLUSIONS: The phase II dose of doxorubicin in this combination therapy has been established at 165 mg/m2, with dose-limiting toxicity defined as mucositis. Further trials to define the role of this safe and effective high-intensity regimen in the treatment of breast cancer are indicated.

Adenocarcinoma↗

PubMed1994

High-dose cisplatin, etoposide, and cyclophosphamide with autologous stem cell reinfusion in patients with responsive metastatic or high-risk primary breast cancer.

BACKGROUND: This study was designed to establish the feasibility of combining high-dose cisplatin, etoposide, and cyclophosphamide followed by stem cell rescue in patients with responsive metastatic or high-risk primary breast cancer. METHODS: Eligibility criteria included the presence of high-risk primary breast cancer (Stage II with 10 or more involved axillary nodes or Stage IIIA or B) or Stage IV disease in complete or partial response; physiologic age 50 years or younger; Karnofsky performance status of 80% or greater; and creatinine clearance of 80 ml/minute or greater. Chemotherapy consisted of escalating doses of cisplatin (50-150 mg/m2 intravenously [IV]) given on days -12 and -5, etoposide (30 mg/kg IV) given on days -12 and -5, and cyclophosphamide (100 mg/kg IV) on day -3. On day 0, autologous bone marrow with or without peripheral stem cells, or granulocyte colony-stimulating factor primed peripheral stem cells alone were reinfused. RESULTS: Thirty patients were enrolled in this study. Twenty-eight patients demonstrated no evidence of persistent renal damage after treatment. Two patients suffered symptomatic peripheral neuropathy, and one patient required a hearing aid 3 months after therapy. Hematopoietic toxicities were acceptable. There were two fatalities; Streptococcus viridans bacteremia and adult respiratory distress syndrome developed in one patient; and one patient who received 262 mg/m2 of cisplatin died of renal failure. Twelve of 18 assessable patients with Stage IV disease are without evidence of progression; 3 of these patients are progression-free at 11+, 12+, and 32+ months. With a median follow-up of 16+ months (range, 4-31 months), 7 patients of the group of 11 treated with high-risk primary breast cancer are without evidence of disease. CONCLUSIONS: The Phase II dose of cisplatin when given on a day -12 and day -5 schedule in combination with etoposide and cyclophosphamide has been established at a total of 250 mg/m2. Dose-limiting toxicity has been defined as renal failure, and response rates were comparable to previously reported high-dose chemotherapeutic regimens.

Adenocarcinoma↗

PubMed1994

Phase I study of 5-day continuous infusion fluorodeoxyuridine and high-dose folinic acid with oral hydroxyurea.

Fluorodeoxyuridine (FUdR), the deoxynucleoside metabolite of 5-fluorouracil (5-FU), can be converted in a single step to fluorodeoxyuridine monophosphate (FdUMP), which binds covalently to thymidylate synthase (TS). Ribonucleotide reductase, an obligatory enzyme in the synthesis of deoxynucleotides, can be inhibited by hydroxyurea. Recognizing the well-established synergism between 5-FU and folinic acid (leucovorin), we hypothesized that the simultaneous administration of FUdR, leucovorin, and hydroxyurea might afford more effective inhibition of TS. Thirty-six patients with neoplastic disease considered refractory to standard therapy were entered into this phase I protocol. Treatment was administered on days 1 through 5 of a 28-day cycle and consisted of folinic acid (500 mg m-2 day-1) and FUdR at escalating doses of 0.1, 0.15, or 0.2 mg kg-1 day-1 both administered by continuous i.v. infusion, and hydroxyurea given p.o. once per day at doses ranging from 0 to 250o mg in 500-mg increments. The hydroxyurea and FUdR levels were escalated in a sequential fashion. The majority of patients had refractory breast or lung cancer. Dose-limiting toxicities were mucositis and diarrhea at the maximally tolerated dose of 0.15 mg/kg FUdR and 2000 mg hydroxyurea per day in conjunction with high-dose folinic acid. Hematological toxicity was minor. Of the 18 patients in whom response could be evaluated, none had evidence of objective disease regression. Mucositis and diarrhea are the dose-limiting toxicities when continuous infusions of FUdR and high-dose folinic acid are combined with oral hydroxyurea, effects that are consistent with the observed toxicities for FUdR when administered alone or in combination with leucovorin.

Administration, Oral↗

PubMed1994

Phase II trial of 5-fluorouracil and high-dose folinic acid as first- or second-line therapy for advanced breast cancer.

The use of leucovorin to modulate 5-fluorouracil (FUra)-mediated inhibition of thymidylate synthase has been shown both in vitro and in vivo to improve the antitumor activity of FUra. Based on the activity of this combination in previously untreated patients, we performed a study of FUra and high-dose leucovorin (HDFA) in patients with metastatic breast cancer and minimal prior chemotherapy. Patients were stratified by prior chemotherapy (or relapse within 12 months of completing adjuvant chemotherapy) versus no prior chemotherapy (or relapse at greater than 12 months since completion of adjuvant chemotherapy). FUra was given daily for 5 days at 370 mg/m2/day with HDFA, 500 mg/m2/day, beginning 24 hours before and continuing 12 hours beyond the first and last FUra doses, respectively. Two objective responses occurred among 21 patients in the pretreated group (10%; 95% confidence interval: 1-30%). Four of 36 eligible patients (11%) in the "no prior therapy group" had complete responses (95% confidence interval: 3-26%). The major toxicities were moderate leucopenia and mucositis. We conclude that FUra plus leucovorin has modest antitumor activity in metastatic breast cancer.

Antineoplastic Combined Chemotherapy Protocols↗

PubMed1993

Modification of DNA bases in chromatin of intact target human cells by activated human polymorphonuclear leukocytes.

We investigated whether phorbol-12-acetate-13-myristate (PMA)-activated human polymorphonuclear leukocytes (PMNs) induce base modifications in target cell DNA in vivo. Human PMNs produced 9.4 +/- 0.8 (SD) nmol of H2O2/10(6) cells during 50 min of exposure to 2 micrograms/ml PMA and 13.7 +/- 2.8 nmol/10(6) cells during exposure to PMA plus 5 mM NaN3. Neither nonstimulated PMNs, nor PMA alone, nor NaN3 alone induced base modifications in chromatin-associated DNA of human Ad293 cells above control levels, when assayed by gas chromatography/mass spectrometry with selected-ion monitoring. However, a 60-min exposure to 1.7 +/- 0.4 x 10(6) PMNs/ml in the presence of 2 micrograms/ml PMA induced a 2-3-fold increase in the level of all modified bases detected by gas chromatography/mass spectrometry with selected-ion monitoring. The guanine-derived products 8-hydroxyguanine and 2,6-diamino-4-hydroxy-5-formamidopyrimidine, and the adenine-derived product 4,6-diamino-5-formamidopyrimidine were induced to the highest levels among those bases detected. These data demonstrate that exposure to activated PMNs causes DNA base modifications in target cells in vivo typical of those induced by hydroxyl radical attack. The induction of potentially promutagenic modified bases may contribute to the mutagenicity of activated PMNs.

Cell Line↗

PubMed1993

Copper ion-mediated modification of bases in DNA in vitro by benzoyl peroxide.

The mouse skin tumor promoter benzoyl peroxide (BzPO), in conjunction with Cu(I), causes promutagenic damage in DNA. Because free radical intermediates are produced by the reaction of BzPO with Cu(I), we sought to determine whether BzPO plus Cu(I) caused DNA base damage typical of that caused by the hydroxyl radical. A broad range of modified DNA bases were measured by GC-MS with selected-ion monitoring after exposure of purified plasmid pCMV beta gal DNA to BzPO +/- Cu(I). Exposure to BzPO/Cu(I) caused up to 20-fold increases in the levels of adenine-derived modified bases, up to 4-fold increases in guanine- and cytosine-derived modified bases, and only a < 2-fold increase in thymine-derived modified bases. The guanine-derived modified base 8-hydroxyguanine was elevated to the highest net amount, approximately 160 molecules/10(5) DNA bases. Exposure to BzPO alone or Cu(I) alone induced only minor (< < 2-fold) DNA base modification. Also, benzoic acid, the major non-radical metabolite of BzPO, or BzPO plus Fe(II) were ineffective at inducing DNA base modification. The hydroxyl radical scavenger dimethyl sulfoxide inhibited BzPO/Cu(I)-induced base modification by 10-50%. These data suggest that the reaction of BzPO with Cu(I) generates hydroxyl radical or a similarly reactive intermediate which causes DNA base damage. This damage may be responsible for BzPO/Cu(I)-mediated mutagenesis.

Adenine↗

PubMed1993

Phase I trial of interleukin-2 plus doxorubicin.

Interleukin-2 (IL-2) and doxorubicin have synergistic antitumor activity in selected animal models and may interact favorably in the therapy of human tumors. In order to explore the interactions between these agents and to define a maximum tolerated dosage for the combination, we performed a phase I clinical trial of IL-2 administered by continuous intravenous infusion (c.i.) plus doxorubicin given by intravenous bolus. Fifteen patients were treated on one of two schedules; the first seven patients received IL-2, 9 mIU/m2/day (3 patients) or 13.5 mIU/m2/day (4 patients) by c.i. on days 1-5, 8-12, and 15-19 with doxorubicin, 25 mg/m2 on day 14. Eight patients received IL-2, 18 mIU/m2/day by c.i. on days 1-5 and 8-12 with doxorubicin, 25 mg/m2 (4 patients) or 50 mg/m2 (4 patients) on day 7. The toxicities of the combination were no greater than those expected from each agent individually. Patients at all three planned IL-2 dosage levels received similar percentages of the planned total dosage (median 100%; > 95% in 60% of cycles), and all patients received the planned dosages of doxorubicin with only one brief delay for resolution of hyperbilirubinemia. The doses recommended for further study are IL-2, 18 mIU/m2/day, on days 1-5 and 8-12 with doxorubicin, 50 mg/m2 on day 7, a regimen which is not associated with significant organ toxicity.

Adult↗

PubMed1992

Pharmacokinetics and toxicity of continuous infusion (6S)-folinic acid and bolus 5-fluorouracil in patients with advanced cancer.

Twenty-seven patients with advanced cancer were entered in a phase I study of bolus i.v. 5-fluorouracil at a dose of 370 mg/m2/day for 5 days combined with a continuous i.v. infusion of (6S)-folinic acid for 5.5 days, starting 24 h in advance of the first 5-fluorouracil dose. The dose of (6S)-folinic acid was escalated in cohorts of patients from 250 mg/m2/day to a maximum of 1000 mg/m2/day. The pharmacokinetics of (6S)-folinic acid were studied in the 3 patients given 250 mg/m2/day and in 6 patients given 1000 mg/m2/day. The mean steady-state plasma concentrations of (6S)-folinic acid and its principal metabolite (6S)-5-methyltetrahydrofolate at the 250 mg/m2/day dose were 2.7 and 5.1 microM, respectively. Both concentrations were comparable to the concentrations produced when (6S)-folinic acid was administered as half of a (6R,S)-folinic acid mixture (E. M. Newman et al., Cancer Res., 49:5755-5760, 1989). At the 1000 mg/m2/day dose of (6S)-folinic acid, the concentration of (6S)-folinic acid was 15.3 microM, more than the 4-fold increase predicted by linear pharmacokinetics, while the concentration of (6S)-5-methyltetrahydrofolate was only 16.5 microM. The change in the ratio of the parent compound to its metabolite was accounted for by a decrease in the nonrenal clearance of (6S)-folinic acid, probably indicating saturation of its metabolism. The toxicities observed in this phase I trial, including stomatitis, diarrhea, neutropenia, and anemia, did not differ in nature or severity from those produced by 5-fluorouracil and (6R,S)-folinic acid when administered on the same schedule. Finally, the degree of toxicity did not appear to depend on the dose of (6S)-folinic acid over the range of doses tested.

Adult↗

PubMed1992

DNA base modifications induced in isolated human chromatin by NADH dehydrogenase-catalyzed reduction of doxorubicin.

The antineoplastic benzanthroquinone drug doxorubicin can undergo flavoenzyme-catalyzed one-electron reduction which, in an aerobic environment, leads to the generation of oxygen-derived species. We therefore sought to determine whether doxorubicin in the presence of NADH dehydrogenase and the transition metal ions Fe(III) or Cu(II) induces DNA base modifications in isolated human chromatin. NADH dehydrogenase-catalyzed reduction of doxorubicin (25-100 microM) caused hydroxyl radical production detected as methane generated from dimethyl sulfoxide; addition of isolated human chromatin to the system produced a concentration-dependent quenching of detectable hydroxyl radical formation. Doxorubicin (5-50 microM)-stimulated enzyme-catalyzed oxidation of NADH was also diminished, but still detectable, in the presence of chromatin. Doxorubicin-induced DNA base modifications in chromatin were measured by gas chromatography/mass spectrometry with selected-ion monitoring. Production of modified bases required the addition of transition metal ion and was enhanced by the addition of active flavoenzyme. The non-redox cycling analogue 5-iminodaunorubicin induced significantly less base modification than did doxorubicin. In the presence of Fe(III), NADH dehydrogenase-catalyzed reduction of doxorubicin caused enhancement in the content of all modified bases over control levels. Substitution of Cu(II) for Fe(III) altered both the degree and the pattern of doxorubicin/NADH dehydrogenase-induced base modifications. The scavengers of hydroxyl radical mannitol and dimethyl sulfoxide or catalase did not significantly affect doxorubicin/NADH/NADH dehydrogenase/transition metal ion-induced base modifications. Superoxide dismutase further enhanced production of all base modifications. The data demonstrate that flavoenzyme-catalyzed redox cycling of doxorubicin generates typical hydroxyl radical-induced base modifications in the DNA of isolated human chromatin, suggesting a possible mechanism for the mutagenicity of doxorubicin in vivo.

Chromatin↗

PubMed1992

The role of NAD(P)H:quinone oxidoreductase in mitomycin C- and porfiromycin-resistant HCT 116 human colon-cancer cells.

A mitomycin C (MMC)- and porfiromycin (PFM)-resistant subline of the HCT 116 human colon-cancer cell line was isolated after repeated exposure of HCT 116 cells to increasing concentrations of MMC under aerobic conditions. The MMC-resistant subline (designated HCT 116-R30A) was 5 times more resistant than the parent cells to MMC and PFM under aerobic conditions. Both the MMC-resistant cells and the parent HCT 116 cells accumulated similar amounts of PFM by passive diffusion, but levels of macromolecule-bound PFM were about 50% lower in the resistant cell line, implying a decrease in PFM reductive activation in the resistant cells. The finding that microsomes from either sensitive or resistant cells showed an equal ability to reduce MMC and PFM indicated that the activity of NADPH cytochrome P-450 reductase (EC 1.6.2.4) was not changed in the resistant subline. Soluble extracts of HCT 116 cells reduced MMC and PFM more effectively at pH 6.1, and NADH and NADPH were utilized equally well as electron donors under both aerobic and anaerobic conditions. These data suggest that quinone reductase (EC 1.6.99.2; DT-diaphorase) in soluble extracts is responsible for the reduction of MMC. Quinone reductase activities in soluble extracts of HCT 116-R30A cells for the reduction of dichlorophenol indophenol (DCPIP) and menadione-cytochrome c at optimal pHs were decreased by 95% as compared with those obtained in parent cells. However, the MMC-reducing activity of HCT 116-R30A soluble extracts was only 50% lower than that of the parent cell extracts. The kinetic constants (Km, Vmax) found for quinone reductase in the two cell lines with respect to the substrates DCPIP and menadione differed. Two species of mRNA for quinone reductase (2.7 and 1.2 kb) were detected in both cell lines, and there was no detectable difference between parent and resistant cells in the steady-state level of either of these mRNA species. Furthermore, incubation with the quinone reductase inhibitor dicoumarol rendered HCT 116 cells more resistant to MMC. Alteration of the quinone reductase activity in HCT 116-R30A cells appears to be the mechanism responsible for their resistance to MMC and PFM.

2,6-Dichloroindophenol↗

PubMed1992

Copper-dependent site-specific mutagenesis by benzoyl peroxide in the supF gene of the mutation reporter plasmid pS189.

Benzoyl peroxide (BzPO) enhances tumor promotion and malignant conversion in mouse epidermis. DNA damage may contribute to these processes. BzPO reacts with Cu(I) to produce the benzoyloxyl radical, which in turn causes strand breaks in plasmid DNA. In this study we investigated whether BzPO with or without Cu(I) caused promutagenic DNA damage in the supF gene of the mutation reporter plasmid pS189 replicating in human Ad293 cells. Exposure of pS189 in vitro to BzPO (0.1-1 mM) inhibited plasmid replication; however, addition of Cu(I) (0.1 mM) did not augment BzPO-induced plasmid toxicity. Exposure to BzPO with or without 0.1 mM Cu(I) was also associated with a concentration-dependent increase in mutation frequency, up to > 100-fold above the spontaneous mutation frequency. Supplemental Cu(I) was not required for mutagenesis; however, it both raised the maximal mutation frequency observed and lowered the threshold concentration of BzPO necessary to discern mutagenesis above the spontaneous background. Neither the hydroxyl radical scavengers mannitol or DMSO, the spin trap N-tert-butyl-alpha-phenylnitrone, nor reduced glutathione altered BzPO/Cu(I)-induced mutagenesis; however, mutagenesis was suppressed by the chelator EDTA. Twenty-four of 32 individual BzPO/Cu(I)-induced mutants characterized by sequencing contained point mutations; 22/25 point mutations occurred at G-C base pairs. There were five large deletions and four small deletions. Three additional BzPO-induced mutants contained four point mutations, all occurring at G-C base pairs. Two BzPO/Cu(I)-induced mutational clusters at d(pGGG)-d(pCCC) sites were observed. These data suggest that BzPO may interact with Cu(I) bound to G-C base pairs in DNA to produce site-specific promutagenic DNA damage.

Base Sequence↗

PubMed1992

Phase I trial of interleukin-2 plus gamma-interferon.

Interleukin-2 (IL-2) and gamma interferon (gamma-IFN) may be synergistic in inducing cell-mediated antitumor cytotoxicity. In order to determine the dose-limiting toxicities and define a maximum tolerated dose of these two agents in combination, we performed a Phase I clinical trial of intravenous IL-2 plus intramuscular gamma-IFN. Patients received both agents on a thrice-weekly schedule consisting of 4 weeks of treatment followed by 2 weeks of rest. Twenty-five patients were treated and received gamma-IFN doses between 0.05-0.25 mg/m2 (1-4 x 10(6) U/m2) with IL-2 doses from 0.33 mg/m2 to 2.33 mg/m2 (6-42 x 10(6) IU/m2). Two patients had partial responses of melanoma and adenocarcinoma of the lung lasting greater than 11 and 8 months, respectively. The toxicities of the combination were those expected from each agent, with no unusual effects, no irreversible organ toxicities, and no patient deaths. The doses recommended for outpatient administration on this schedule are IL-2, 2.0 mg/m2 plus gamma-IFN, 0.25 mg/m2, a dose combination that is unassociated with significant organ toxicity.

Adenocarcinoma↗

PubMed1992

Phase II trial of cisplatin and alpha-interferon in advanced malignant melanoma.

PURPOSE: To evaluate the antitumor activity of combination cisplatin (CDDP) and alpha-interferon (alpha-IFN) in advanced, measurable metastatic melanoma. PATIENTS AND METHODS: Adult patients with metastatic melanoma were required to have bidimensionally measurable lesions and a Karnofsky performance status > or = 60%. Serum creatinine < or = to 1.5 mg/dL, creatinine clearance > or = 60 mL/min, adequate organ and bone marrow function, and radiologic proof of the absence of brain metastases were required. CDDP 40 mg/m2 intravenously (IV) on day 1 and day 8, and alpha-IFN 3 million units/m2 subcutaneously on days 1 to 5 and 8 to 12 were administered every 3 to 4 weeks. RESULTS: Forty-two patients were entered onto this phase II trial and were assessable for response and toxicity. Three patients achieved complete responses (CRs) that lasted 31+, 5, and 8+ months. Seven patients had partial responses (PRs) and a median response duration of 4.4 months. The overall objective response rate was 24% (95% confidence interval, 12% to 39%). Toxicities were mild. Only 11% of the courses required dose reduction of alpha-IFN, and three of 128 courses required CDDP dose reduction for reversible nephrotoxicity. CONCLUSION: The combination of moderate-dose CDDP and alpha-IFN as administered in this schedule is well tolerated and possesses encouraging activity in metastatic melanoma.

Adult↗

PubMed1992

Effective initial therapy of advanced breast cancer with fluorouracil and high-dose, continuous infusion calcium leucovorin.

PURPOSE: The use of leucovorin (LV) to modulate fluorouracil (FU)-mediated inhibition of thymidylate synthase has been shown both in vitro and in vivo to improve the antitumor activity of this drug. Based on our previous demonstration that this combination was active in heavily pretreated patients with prior FU exposure, we performed a phase II study of FU and high-dose intravenous calcium LV in patients with advanced breast cancer who had been exposed to no more than one prior chemotherapy regimen. PATIENTS AND METHODS: Fifty-one female patients with metastatic breast cancer were entered onto this trial. Patients with metastatic disease limited to soft tissue, lymph nodes, skin, and pulmonary nodules were allowed no prior chemotherapy for advanced disease. Those with metastases in the liver or a lymphangitic pattern on chest x-ray were allowed either a single prior regimen for advanced disease or no therapy for metastatic disease if less than 1 year had elapsed since the completion of adjuvant chemotherapy. FU was given daily for 5 days at 400 mg/m2/d with calcium LV, 500 mg/m2/d, beginning 24 hours before and continuing 12 hours after the first and last FU doses, respectively. RESULTS: The overall objective response rate among 45 eligible patients was 36% (95% confidence interval, 22% to 51%). Fourteen of 31 patients in the soft tissue category responded (45%), and two of 14 in the visceral category experienced an objective response (14%). The median response duration was 5 months. Toxicities were moderate leukopenia and mucositis. CONCLUSIONS: FU plus LV is an active first-line regimen with antitumor efficacy comparable to that of the anthracyclines, which warrants further exploration in combination with other agents active in advanced breast cancer. FU plus LV in this schedule is also an excellent alternative for patients with medical contraindications to more intensive combination chemotherapy regimens.

Adult↗

PubMed1991

Quadruplex DNA formation in a region of the tRNA gene supF associated with hydrogen peroxide mediated mutations.

A hot spot for H2O2/Fe-mediated mutation has been observed between bases 154 and 170 of the supF gene in the mutation reporter plasmid pZ189 [Moraes et al. (1990) Carcinogenesis 11, 283; Akman et al. (1991) Mutat. Res. (in press)]. To further characterize this hot spot, we synthesized the 33mer d(pAAAGTGATGGTGGTGGGGGAAGGATTCGAACCT) (pZ33), which is complementary to bases 159-191 of the supF gene. pZ33 annealed spontaneously in 10 mM Tris-HCl (pH 8.0)-1 mM EDTA-100 mM NaCl at 50 degrees C into two major forms, one of which migrates more slowly than does d(pT)33 on nondenaturing 12% polyacrylamide gels. We propose that this form is a four-stranded structure stabilized by Hoogsteen-type deoxyguanosine quartets involving all deoxyguanosines of the sequence d-(pGGTGGTGGGGG) because of the following. (1) pZ33 migrates as a single form that comigrates with d(pT)33 on denaturing 20% acrylamide-8 M urea gels. (2) Annealing an equimolar mixture of 5'-32P-labeled pZ33 and the oligodeoxynucleotide d(pTTTTTTTTpZ33TTTTTTTT) (pZ49), as well as 5'-32P-labeled pZ49 and pZ33, caused the formation of four, discreet slowly migrating bands on nondenaturing 12% polyacrylamide gels. Mixing 5'-32P-labeled pZ33 with 5'-32P-labeled pZ49 resulted in five slowly migrating bands. (3) An oligodeoxynucleotide identical with pZ33 except that every deoxyguanosine has been replaced with deoxyinosine did not anneal into a slowly migrating form. (4) Dimethyl sulfate protection studies demonstrated that all deoxyguanosines of the sequence d(pGGTGGTGGGGG) were protected at N-7 in the slowly migrating form but not in single-stranded pZ33. These data suggest that a hot spot for H2O2/Fe-mediated base substitutions is located adjacent to a sequence that can spontaneously adopt a quadruplex structure in which deoxyguanosine quartets are Hoogsteen bonded.

Base Composition↗

PubMed1991

Mutation of potassium permanganate- and hydrogen peroxide-treated plasmid pZ189 replicating in CV-1 monkey kidney cells.

We examined the effect of the oxidation of plasmid pZ189 by KMnO4, which does not produce free radicals, and H2O2/Fe(2+)-diethylenetriaminepentaacetic acid (DTPA), which does, on the mutation frequency of pZ189 transfected into monkey kidney CV-1 cells. Treatment with 1.5 mM KMnO4 increased the content of certain modified bases, principally Thy and Cyt modified at C-5 and C-6, by up to 300-fold, as measured by GC/MS; however, the mutation frequency increased only 5-fold above background. 1.0 mM H2O2/0.1 mM Fe(2+)-DTPA treatment, which increased the mutation frequency 10-fold above background, increased the content of certain modified bases by up to 4-fold. Sequence analysis revealed both deletions and point mutations, with a predominance of C-G substitutions, among H2O2/Fe(2+)-DTPA-associated mutations. These data suggest that KMnO4-modified DNA is only weakly mutagenic in DNA replicating in mammalian nuclei, despite substantial production of Thy glycol and other base modifications, whereas H2O2/Fe(2+)-DTPA-modified DNA is more mutagenic. H2O2/Fe(2+)-DTPA generated mutations occur predominantly at C-G base pairs.

Animals↗

PubMed1990

Antioxidant and xenobiotic-metabolizing enzyme gene expression in doxorubicin-resistant MCF-7 breast cancer cells.

We investigated the expression of the genes for several antioxidant and xenobiotic-detoxifying enzymes in the multidrug-resistant variant of the human breast cancer cell line MCF-7, MCF-7/Dox. MCF-7/Dox is greater than 500-fold resistant to doxorubicin by clonogenic assay. Enzyme activity determinations in the cytoplasmic compartment of MCF-7/Dox revealed a 25-fold increase in glutathione peroxidase level compared to the parent line (mean +/- SD, 10 +/- 2.8 versus 0.4 +/- 0.24 nmol/min/mg; P less than 0.005). The activity of the other major hydrogen peroxide-detoxifying enzyme, catalase, was diminished in MCF-7/Dox (2.0 +/- 0.4 versus 4.8 +/- 1.4 mumol/min/mg; P less than 0.025 compared to MCF-7). Superoxide dismutase activity did not differ between the two cell lines. The specific activity of the xenobiotic-detoxifying enzyme DT-diaphorase was 4-fold lower in MCF-7/Dox compared to MCF-7 (DT-diaphorase, 117 +/- 45 versus 509 +/- 123 nmol/min/mg; P less than 0.005). Daunorubicinol-producing carbonyl reductase activity was equal in the two lines. Northern blot analysis demonstrated a 0.9-kilobase band of glutathione peroxidase mRNA in MCF-7/Dox; no glutathione peroxidase mRNA was detected in MCF-7. A 2.4-kilobase catalase and 0.7- and 1.4-kilobase superoxide dismutase mRNAs were detectable in MCF-7/Dox and MCF-7. When normalized to 28S RNA, no difference in the mRNA levels of catalase and superoxide dismutase in MCF-7/Dox and MCF-7 could be determined. DT-diaphorase mRNAs of 1.4 and 2.7 kilobases were found in both MCF-7/Dox and MCF-7 cells. A 1.2-kilobase mRNA homologous to the putative carbonyl reductase cDNA was also easily detectable in both MCF-7 and MCF-7/Dox. The amount of mRNA for both xenobiotic-detoxifying enzymes was decreased 2- to 4-fold in the doxorubicin-resistant cells. Southern blot analysis of PstI- and MspI-restricted genomic DNA revealed no evidence for amplification or rearrangement of the glutathione peroxidase gene. These results indicate that, in addition to the previously described overexpression of anionic glutathione S-transferase in MCF-7/Dox cells, an augmented glutathione peroxidase mRNA level is the major alteration in antioxidant and xenobiotic-detoxifying enzyme expression that could contribute to doxorubicin insensitivity in these multidrug-resistant breast cancer cells.

Alcohol Oxidoreductases↗