[SLX (sialyl SSEA-1, sialyl Le(x)-i)].
Explore the source record for details and available documents.
Adenocarcinoma↗
Biomedical subjects
Reiji Kannagi
Publications and source records attributed to Reiji Kannagi.
Human P-selectin glycoprotein ligand-1 (PSGL-1) interacts with the skin-associated chemokine CCL27 via sulfated tyrosines at the PSGL-1 amino terminus.
P-selectin glycoprotein ligand-1 (PSGL-1), a sialomucin expressed on leukocytes, is a major ligand for P-selectin and mediates leukocyte rolling on the endothelium. Here we show that human PSGL-1 interacts with CCL27 (CTACK/ILC/ESkine), a skin-associated chemokine that attracts skin-homing T lymphocytes. A recombinant soluble form of PSGL-1 (rPSGL-Ig) preferentially bound CCL27 among several chemokines tested. This interaction was abrogated by arylsulfatase treatment of rPSGL-Ig, suggesting that sulfated tyrosines play a critical role. In contrast, removal of either N-glycans or O-glycans by glycosidase treatment of rPSGL-Ig did not affect the interaction. The binding of CCL27 to a recombinant PSGL-1 synthesized in the presence of a sulfation inhibitor was lower than that produced in normal medium. Moreover, mutation of the tyrosines at the amino terminus of PSGL-1 to phenylalanine abolished the binding, further supporting the role of sulfated tyrosines in the CCL27-PSGL-1 interaction. Functionally, rPSGL-Ig reduced the chemotaxis of L1.2 cells expressing CCR10, the receptor for CCL27. In addition, the expression of human PSGL-1 on CCR10-expressing L1.2 cells resulted in reduced chemotaxis to CCL27. These findings suggest a role for PSGL-1 in regulating chemokine-mediated responses, in addition to its role as a selectin ligand.
Amino Acid Sequence↗
Endomucin, a sialomucin expressed in high endothelial venules, supports L-selectin-mediated rolling.
Lymphocyte homing to lymph nodes is regulated by transient but specific interactions between lymphocytes and high endothelial venules (HEVs), the initial phase of which is mainly governed by the leukocyte adhesion molecule L-selectin, which recognizes sulfated and sialylated O-linked oligosaccharides displayed on sialomucin core proteins. One of the sialomucin proteins, endomucin, is predominantly expressed in vascular endothelial cells of a variety of tissues including the HEVs of lymph nodes; however, whether it functions as a ligand for L-selectin remains to be formally proven. Here we show that the endomucin splice isoform a is predominantly expressed in PNAd+ HEVs and MAdCAM-1+ HEVs, as seen in non-HEV-type vascular endothelial cells. Using affinity purification with soluble L-selectin, we found that HEV endomucin is specifically modified with L-selectin-reactive oligosaccharides and can bind L-selectin as well as an HEV-specific mAb, MECA-79. Our results also indicated that a 90-100 kDa endomucin species is preferentially decorated with L-selectin-reactive sugar chains, whereas an 80 kDa species represents conventional forms expressed in non-HEV-type vascular endothelial cells in lymph nodes. Furthermore, a CHO cell line expressing endomucin together with a specific combination of carbohydrate-modifying enzymes [core-2 beta-1,6-N-acetylglucosaminyltransferase (C2GnT), alpha-1,3-fucosyltransferase VII (FucTVII) and L-selectin ligand sulfotransferase (LSST)] showed L-selectin-dependent rolling under flow conditions in vitro. These results suggest that when endomucin is appropriately modified by a specific set of glycosyltransferases and a sulfotransferase, it can function as a ligand for L-selectin, and that the endomucin expressed in HEVs may represent another sialomucin ligand for L-selectin.
Animals↗
Loss of disialyl Lewis(a), the ligand for lymphocyte inhibitory receptor sialic acid-binding immunoglobulin-like lectin-7 (Siglec-7) associated with increased sialyl Lewis(a) expression on human colon cancers.
Expression of sialyl Lewis(a) is known to be increased in cancers of the digestive organs. The determinant serves as a ligand for E-selectin and mediates hematogenous metastasis of cancers. In contrast, disialyl Lewis(a), which has an extra sialic acid attached at the C6-position of penultimate GlcNAc in sialyl Lewis(a), is expressed preferentially on nonmalignant colonic epithelial cells, and its expression decreases significantly on malignant transformation. Introduction of the gene for an alpha2-->6 sialyl-transferase responsible for disialyl Lewis(a) synthesis to colon cancer cells resulted in a marked increase in disialyl Lewis(a) expression and corresponding decrease in sialyl Lewis(a) expression. This was accompanied by the complete loss of E-selectin binding activity of the cells. In contrast, the transfected cells acquired significant binding activity to sialic acid-binding immunoglobulin-like lectin-7 (Siglec-7)/p75/adhesion inhibitory receptor molecule-1, an inhibitory receptor expressed on lymphoid cells. These results indicate that the transition of carbohydrate determinants from disialyl Lewis(a)-dominant status to sialyl Lewis(a)-dominant status on malignant transformation has a dual functional consequence: the loss of normal cell-cell recognition between mucosal epithelial cells and lymphoid cells on one hand and the gain of E-selectin binding activity on the other. The transcription of a gene encoding the alpha2-->6 sialyltransferase was markedly down-regulated in cancer cells compared with nonmalignant epithelial cells, which is in line with the decreased expression of disialyl Lewis(a) and increased expression of sialyl Lewis(a) in cancers. Treatment of cancer cells with butyrate or 5-azacytidine induced strongly disialyl Lewis(a) expression, suggesting that histone deacetylation and/or DNA methylation may be involved in the silencing of the gene in cancers.
Antigens, Differentiation, Myelomonocytic↗
A novel mechanism for the inhibition of hyaluronan biosynthesis by 4-methylumbelliferone.
Specific inhibitors of hyaluronan (HA) biosynthesis can be valuable therapeutic agents to prevent cancer invasion and metastasis. We have found previously that 4-methylumbelliferone (MU) inhibits HA synthesis in human skin fibroblasts and in group C Streptococcus. In this paper, the inhibition mechanism in mammalian cells was investigated using rat 3Y1 fibroblasts stably expressing HA synthase (HAS) 2. Exposure of the transfectants to the inhibitor resulted in significant reduction of HA biosynthesis and matrix formation. The evaluation of HAS transcripts and analysis of cell-free HA synthesis demonstrated the post-transcriptional suppression of HAS activity by MU. Most interesting, the post-transcriptional suppression of HAS activity was also observed using p-nitrophenol, a well known substrate for UDP-glucuronyltransferases (UGT). We investigated whether the inhibition was exerted by the glucuronidation of MU using both high pressure liquid chromatography and TLC analyses. The production of MU-glucuronic acid (GlcUA) was consistent with the inhibition of HA synthesis in HAS transfectants. MU-GlcUA was also detected at a similar level in control cells, suggesting that the glucuronidation was mediated by an endogenous UGT. Elevated levels of UGT significantly enhanced the inhibitory effects of MU. In contrast, the inhibition by MU was diminished to the control level when an excess of UDP-GlcUA was added to the cell-free HA synthesis system. We propose a novel mechanism for the MU-mediated inhibition of HA synthesis involving the glucuronidation of MU by endogenous UGT resulting in a depletion of UDP-GlcUA.
Animals↗
N-acetylglucosamine 6-O-sulfotransferase-1 regulates expression of L-selectin ligands and lymphocyte homing.
Lymphocyte homing is initiated by the binding of L-selectin on lymphocytes to its ligands on high endothelial venules (HEV). Sialyl 6-sulfo Lewis X is a major capping group of L-selectin ligands. N-Acetylglucosamine (GlcNAc) 6-sulfation is essential for the ligand activity, and is catalyzed by GlcNAc 6-O-sulfotransferases (GlcNAc6STs) of which GlcNAc6ST-1 and GlcNAc6ST-2 are expressed in HEV. Here, we report that mice deficient in GlcNAc6ST-1 were impaired in the elaboration of sialyl 6-sulfo Lewis X in HEV and that an epitope of L-selectin ligands recognized by the MECA-79 anti-body was greatly reduced or abolished in the abluminal aspect of HEV. Lymphocyte homing to peripheral lymph nodes, mesenteric lymph nodes, and Peyer's patches was significantly reduced in GlcNAc6ST-1 null mice. These results demonstrate that GlcNAc6ST-1 is involved in lymphocyte homing in vivo, and indicate that GlcNAc6ST-1 and -2 play complementary roles. The importance of GlcNAc6ST-1 is particularly high-lighted by its involvement in lymphocyte homing to Peyer's patches where GlcNAc6ST-2 expression is undetectable.
Animals↗
Hypoxia induces adhesion molecules on cancer cells: A missing link between Warburg effect and induction of selectin-ligand carbohydrates.
Cancer cells undergo distinct metabolic changes to cope with their hypoxic environment. These changes are achieved at least partly by the action of transcriptional factors called hypoxia-inducible factors (HIFs). We investigated gene expression in cultured human colon cancer cells induced by hypoxic conditions with special reference to cell-adhesion molecules and carbohydrate determinants having cell-adhesive activity by using DNA-microarray and RT-PCR techniques. Hypoxic culture of colon cancer cells induced a marked increase in expression of selectin ligands, the sialyl Lewis x and sialyl Lewis a determinants at the cell surface, which led to a definite increase in cancer cell adhesion to endothelial E-selectin. The transcription of genes for fucosyltransferase VII (FUT7), sialyltransferase ST3Gal-I (ST3O), and UDP-galactose transporter-1 (UGT1), which are all known to be involved in the synthesis of the carbohydrate ligands for E-selectin, was significantly induced in cancer cells by hypoxic culture. In addition, a remarkable induction was detected in the genes for syndecan-4 (SDC4) and alpha5-integrin (ITGA5), the cell-adhesion molecules involved in the enhanced adhesion of cancer cells to fibronectin. The transcriptional induction by hypoxia was reproduced in the luciferase-reporter assays for these genes, which were significantly suppressed by the co-transfection of a dominant-negative form of HIF. These results indicate that the metabolic shifts of cancer cells partly mediated by HIFs significantly enhance their adhesion to vascular endothelial cells, through both selectin- and integrin-mediated pathways, and suggest that this enhancement further facilitates hematogenous metastasis of cancers and tumor angiogenesis.
Antigens, Tumor-Associated, Carbohydrate↗
Selective expression and functional characteristics of three mammalian hyaluronan synthases in oncogenic malignant transformation.
Malignant transformation of fibroblasts and epithelial cells is often accompanied by increased hyaluronan production and accumulation. Despite recent progress in the study of hyaluronan biosynthesis, the mechanisms underlying the transformation-induced overproduction of hyaluronan have not been elucidated. Here we report that activity and transcriptional levels of hyaluronan synthase (HAS) significantly increased after oncogenic malignant transformation of a rat 3Y1 fibroblast cell line. Of three HAS isoforms (HAS1, HAS2, and HAS3), only HAS2 gene expression was increased in the v-Ha-ras transformed 3Y1 cells, which show less malignancy. In contrast, both HAS1 and HAS2 expressions were elevated in the highly malignant cells transformed with v-src and/or v-fos. To assess the contribution of HAS expression to the oncogenic malignant transformation, we established stable cell transfectants expressing sense and antisense HAS genes. Antisense suppression of the HAS2 expression significantly decreased hyaluronan production in the cells transformed by the oncogenic v-Ha-ras and eventually led to a reduction in tumorigenicity in the rat peritoneum. The introduction of the HAS1 and HAS2 genes promoted the growth of subcutaneous tumors in a manner dependent on the levels of hyaluronan synthesis. Significant growth promotion was observed within a wide range of HAS1 expression. In contrast, the growth stimulation was only seen within a narrow range of HAS2 expression, and high levels of HAS2 expression even inhibited tumor growth. These results suggest that proper regulation of the expression of each HAS isoform is required for optimal malignant transformation and tumor growth.
Animals↗
Core 2 GlcNAc transferase and kidney tubular cell-specific expression.
The expression of glycan chains is precisely regulated in a time- and space-dependent manner. We summarize here our recent work on the kidney tubular cell-specific regulation of core 2 beta-1,6-GlcNAc transferase. Gsl5 gene was first identified by genetic analysis on the basis of polymorphic expression of kidney glycolipids among inbred strains of mice and turned out to be a regulatory gene controlling the level of mRNA of kidney-specific core 2 beta-1,6-GlcNAc transferase. This kidney-specific core 2 GlcNAc transferase takes glycolipids having Gal beta 1-3GalNAc at their termini, Gal beta 1-3GalNAc alpha 1- and beta 1-oligosaccharide derivatives, and glycoproteins having core 1 structure, as substrates. Immunohistochemistry with anti-core 2-Le( x ) monoclonal antibody demonstrated that vesicles located just below the microvillous membrane of proximal tubule cells were clearly stained in a Gsl5 -wild type mouse. Western blotting with the monoclonal antibody detected a major glycoprotein with a molecular mass of 500 kDa in the microsomal fraction of the wild type mouse kidney. In situ hybridization with anti-sense cDNA of kidney-specific core 2 GlcNAc transferase confirmed that Gsl5 gene controls the expression of the core 2 beta-1,6-GlcNAc transferase mRNA in a proximal tubular cell-specific manner. The 5' upstream sequences of the kidney-specific core 2 GlcNAc transferase gene in inbred and wild-derived strains of mice were analyzed, and the phylogenetic analysis of these sequences suggests that functional Gsl5 gene might be produced by the time of subspeciation of M. musculus, about one million years ago.
Animals↗
Molecular mechanism for cancer-associated induction of sialyl Lewis X and sialyl Lewis A expression-The Warburg effect revisited.
Cell adhesion mediated by selectins and their carbohydrate ligands, sialyl Lewis X and sialyl Lewis A, figures heavily in cancer metastasis. Expression of these carbohydrate determinants is markedly enhanced in cancer cells, but the molecular mechanism that leads to cancer-associated expression of sialyl Lewis X/A has not been well understood. Results of recent studies indicated involvement of two principal mechanisms in the accelerated expression of sialyl Lewis X/A in cancers; 'incomplete synthesis' and ' neo synthesis.' As to 'incomplete synthesis,' we have recently found further modified forms of sialyl Lewis X and sialyl Lewis A in non-malignant colonic epithelium, which have additional 6-sulfation or 2 --> 6 sialylation. The impairment of GlcNAc 6-sulfation and 2 --> 6 sialylation upon malignant transformation leads to accumulation of sialyl Lewis X/A in colon cancer cells. Epigenetic changes such as DNA methylation and/or histone deacetylation are suggested to lie behind such incomplete synthesis. As to the mechanism called ' neo synthesis,' recent studies have indicated that cancer-associated alterations in the sugar transportation and intermediate carbohydrate metabolism play important roles. Cancer cells are known to exhibit a metabolic shift from oxidative to elevated anaerobic glycolysis (Warburg effect), which is correlated with the increased gene expression of sugar transporters and glycolytic enzymes induced by common cancer-specific genetic alterations. The increased sialyl Lewis X/A expression in cancer is a link in the chains of these events because our recent results indicated that these events accompany transcriptional induction of a set of genes closely related to its expression.
Animals↗
Carbohydrate-mediated cell adhesion in cancer metastasis and angiogenesis.
Malignant transformation is associated with abnormal glycosylation, resulting in the synthesis and expression of altered carbohydrate determinants including sialyl Lewisa and sialyl Lewisx. The sialyl Lewisa and sialyl Lewisx determinants appear in the sera of patients with cancer, and are extensively utilized for serum diagnosis of cancers in Japan. Sialyl Lewisa and sialyl Lewisx are involved in selectin-mediated adhesion of cancer cells to vascular endothelium, and these determinants are thought to be closely associated with hematogenous metastasis of cancers. Recent progress in this area includes the following: 1. Substantial increases in solid clinical statistics that further confirm the contribution of these determinants in the progression of a wide variety of cancers; 2. Elucidation of the ligand specificity of the three family members of selectins and evaluation of the roles of these molecules in cancer cell adhesion; and 3. Advances in the study of the mechanism that leads to the enhanced expression of the sialyl Lewis(a/x) determinants in malignant cells. These recent results have confirmed that these determinants are not merely markers for cancers, but are functionally implicated in the malignant behavior of cancer cells. The results also suggested that the increase of these determinants in malignant cells is an inevitable consequence of the malignant transformation of cells. Considerable new knowledge has also been accumulated regarding the therapeutic implications for suppression of hematogenous metastasis targeting this cell adhesion system.
Antigens, Tumor-Associated, Carbohydrate↗
Attachment of human colon cancer cells to vascular endothelium is enhanced by N-acetylglucosaminyltransferase V.
Expression of N-acetylglucosaminyltransferase V (GnT-V) in colon cancer has been shown to be related to hematogenous metastasis and poor prognosis. To investigate the mechanism by which cancer cells expressing GnT-V metastasize to distant organs, we established GnT-V-overexpressing DLD-1 and WiDr cells (human colon cancer cell lines) by transfecting them with a GnT-V expression vector. Attachment to endothelial cells expressing E-selectin was studied, and expression of the E-selectin ligand, sialyl Lewis x, in colon cancer cells was investigated. Both of the cell lines showed reduced adhesion to fibronectin as compared with mock transfectants. In contrast, attachment to human umbilical vein endothelial cells expressing E-selectin was significantly enhanced by GnT-V expression (p < 0.01). Sialyl Lewis x is a ligand for E-selectin and a marker for poor prognosis of colon cancer. Its synthesis in cells has been shown to involve GnT-V. We demonstrated that expression of sialyl Lewis x in colon cancer cells was induced by GnT-V expression. These results suggest that GnT-V induces sialyl Lewis x expression and leads colon cancer cells to metastasize by enhancing their ability to attach to vascular endothelium in distant organs, such as liver or lung. Inhibition of GnT-V activity may prevent metastasis in colon cancer patients with high sialyl Lewis x expression.
Biomarkers, Tumor↗
Studies on the endogenous L-selectin ligands: systematic and highly efficient total synthetic routes to lactamized-sialyl 6-O-sulfo Lewis X and other novel gangliosides containing lactamized neuraminic acid.
Systematic syntheses of lactamized neuraminic acid-containing gangliosides GM4, sulfated sialylparagloboside, and sulfated/nonsulfated sialyl Lewis X are described. The highly efficient, one-step lactamization of neuraminic acid was accomplished by treatment of the N-deacetylated sialic acid (neuraminic acid)-containing gangliosides with HBTU and HOBt in DMF at 65 degrees C. Both the lactamized neuraminic acid residue and the sulfate group at O-6 of the GlcNAc residue were found to be involved in the antigenic determinant defined by G159 monoclonal antibody, while the fucose residue may not be critical for the recognition by G159 mAb.
Antibodies, Monoclonal↗
Synthesis of disialyl Lewis a (Le(a)) structure in colon cancer cell lines by a sialyltransferase, ST6GalNAc VI, responsible for the synthesis of alpha-series gangliosides.
Biosynthesis of disialyl Lewis a (Lea) was analyzed using previously cloned ST6GalNAc V and ST6GalNAc VI, which were responsible for the synthesis of alpha-series gangliosides. Among lactotetraosylceramide (Lc4), neolactotetraosylceramide, and their sialyl forms, only sialyl Lc4 was sialylated with ST6GalNAc V and ST6GalNAc VI. The products were confirmed to be disialyl Lea in TLC-immunostaining. Compared with the original substrate GM1b, the synthetic rates of disialyl Lea were 22 and 38% with ST6GalNAc V and ST6GalNAc VI, respectively. Since sialyl Lea could not be converted to disialyl Lea, disialyl Lea was produced only from disialyl Lc4. Therefore, it appears that ST6GalNAc V/VI and fucosyltransferase III (FUT-3) compete for sialyl Lc4, their common substrate. The results of either one transfection or co-transfection of two genes into COS1 cells revealed that both ST6GalNAc VI and FUT-3 contributed in the synthesis of disialyl Lea but partly compete with each other. Many colon cancer cell lines expressed the ST6GalNAc VI gene more or less, and some of them actually expressed disialyl Lea. None of them expressed ST6GalNAc V. These results suggested the novel substrate specificity of ST6GalNAc VI, which is responsible for the synthesis of disialyl Lea but not for alpha-series gangliosides in human colon tissues.
Animals↗
[Recent advances in the study of lymphocyte homing involving selectins and CD44].
Explore the source record for details and available documents.
Animals↗
[Molecular mechanisms involved in colon carcinogenesis].
Explore the source record for details and available documents.
Animals↗
Transactivation of the fucosyltransferase VII gene by human T-cell leukemia virus type 1 Tax through a variant cAMP-responsive element.
Human T-cell leukemic virus type 1 (HTLV-1)-infected T cells express the fucosyltransferase (Fuc-T) VII gene involved in the biosynthesis of the leukocyte sialyl Lewis X, which may be related to tissue infiltration in patients with malignant adult T-cell leukemia. HTLV-1 induces Fuc-T VII transcription through the viral transactivator Tax, although the underlying molecular mechanism remains unknown. In the present study, we analyzed the role of the cis-activating element in Tax activation using reporter constructs bearing the 5'-regulatory region of Fuc-T VII in Jurkat T cells. A sequence (GGCTGTGGGGGCGTCATATTGCCCTGG) covering a half-palindromic cyclic adenosine monophosphate (cAMP)-responsive element (CRE) was found to be required for Tax activation of the Fuc-T VII promoter. We further demonstrated that transcription factors of the CRE-binding protein (CREB)/activating transcription factor (ATF) family bind to this CRE-like sequence and that Tax binds in association with CREB and the coactivator CREB-binding protein (CBP) in Jurkat T cells. This element, containing the G+C-rich flanking sequences, is homologous to the Tax-responsive viral CREs in the HTLV-1 long terminal repeat (LTR)-promoter. Furthermore, CREM alpha, an isoform of CREB deficient in the glutamine-rich domains, was found to activate the Fuc-T VII promoter in a phosphorylation-independent manner, similar to the viral CRE in HTLV-1 LTR but in contrast to the phosphorylation-dependent activation of the cellular CREs by Tax. These findings indicate that the Fuc-T VII promoter is transactivated by Tax in concert with CBP through a CRE-like sequence in a manner similar to that of viral CRE in HTLV-1 LTR.
5' Untranslated Regions↗
Roles of cell adhesion molecules in tumor angiogenesis induced by cotransplantation of cancer and endothelial cells to nude rats.
Roles of cell adhesion molecules mediating the interaction of cancer and endothelial cells in tumor angiogenesis were investigated using new in vitro and in vivo model systems with a cultured murine endothelial cell line (F-2) and human cultured epidermoid cancer cells (A431). The A431 cells exhibited typical in vitro cell adhesion to the endothelial F-2 cells. The initial step of adhesion was mediated by sialyl Lewis(x) (Le(x)) and sialyl Le(a), the carbohydrate determinants expressed on the cancer cells, and E-selectin expressed constitutively on F-2 cells. Prolonged culture led to the implantation of cancer cells into the monolayer of the F-2 cells, which was mediated mainly by alpha(3)beta(1)-integrin. F-2 cells cultured on Matrigel showed evident tube formation, and coculture of F-2 cells with A431 cells led to the formation of A431 cell nests constantly surrounded by tube-like networks consisting of F-2 cells. This in vitro morphogenesis was inhibited by the addition of anti-sialyl Le(x)/Le(a) or anti-beta(1)-integrin antibodies, which led to the formation of cancer cell aggregates that were independent from the F-2 cell networks. This in vitro morphological appearance was exactly reproduced in the in vivo tumors, which were formed when the mixture of A431 and F-2 cells at the ratio of 10:1 were cotransplanted s.c. into the back of nude rats. The tumors of A431 supplemented with F-2 cells were profoundly vascularized throughout by the tubular structures formed by F-2 cells, the lumen of which contained the host rat blood cells. The tumor mass thus formed was an average 5.8-fold as large as control A431 tumors that were grown without F-2 cells. The co-injection of anti-Le(x)/Le(a) or anti-beta(1)-integrin antibodies produced a marked reduction in the size of A431 tumors, which were not vascularized and accompanied an independent tiny remnant clump of F-2 cells. The size of these A431 tumors did not differ significantly from those of control A431 tumors raised without F-2 cells. These results indicate that the interaction of tumor cells and endothelial cells in orderly tumor angiomorphogenesis is highly dependent on the action of cell adhesion molecules mediating the adhesion of cancer cells to endothelial cells, inhibition of which remarkably retards tumor growth and angiogenesis.
Animals↗