Search PubMed⌕ Search

Biomedical subjects

R T Walker

Publications and source records attributed to R T Walker.

At least 109 records · Page 6Linked to original sources
PubMed1982

Synthesis and biological properties of 2'-deoxy-5-vinyluridine and 2'deoxy-5-vinylcytidine.

Rapid and efficient syntheses for the preparation of 2'-deoxy-5-vinyluridine and 2'-deoxy-5-vinylcytidine are described starting from nucleoside precursors. Contrary to some previous reports, 2-deoxy-5-vinyluridine has be found to be quite stable under normal laboratory conditions but when tested in animals shows neither toxicity nor anti-leukemic (L1210 cells) or anti-parasitic (Plasmodium berghei) activity. 2'-Deoxy-5-vinylcytidine appears to polymerise readily. It is much less toxic to cell cultures than 2'-deoxy-5'vinyluridine but is almost as active against herpes virus replication (ID50:0.2 microgram/ml) for both type 1 and type 2 herpes virus (selectivity index:225).

Animals↗
PubMed1982

Role of thymidine kinase in the inhibitory activity of 5-substituted-2'-deoxyuridines on the growth of human and murine tumor cell lines.

Twenty-four 5-substituted 2'-deoxyuridines have been evaluated for their inhibitory effects on the growth of three human lymphoblast cell lines (Namalva, RAji and TK- (thymidine kinase deficient) Raji) and these inhibitory effects were compared to those for two murine leukemia cell lines (L1210/0 and L1210/BdUrd). The latter was selected from the parental L1210/0 cell line by its ability to grow at high concentrations of 5-bromo-dUrd and could also be considered as TK-. There was a close correlation between the inhibitory effects of the deoxyuridine analogs on Namalva, Raji and L1210 cells: the correlation coefficient (r) for log ID50 (median inhibitory dose) for L1210 cell growth, on the one hand, and log ID50 for Namalva or Raji cell growth, on the other hand, was 0.902 and 0.929, respectively. There was also a strong correlation (r = 0.936) between the log ID50 values for the two human lymphoblast cell lines. However, there was no significant correlation (r less than 0.40) either between the log ID50 for the TK- Raji cells and the parental TK+ Raji cells, or between the log ID50 for the TK- L1210/BdUrd cells and the parental TK+ L1210/0 cells. We may conclude therefore, that (i) the murine leukemia L1210 cell system is predictive for the growth-inhibitory effects of 5-substituted 2'-deoxyuridines on human lymphoblast cell lines, and (ii) the antitumor cell activity of the 5-substituted 2'-deoxyuridines is, to a large extent, dependent on the thymidine kinase activity of the tumor cells.

Animals↗
PubMed1982

Local recurrence after low anterior resection using the staple gun.

Eleven early anastomotic recurrences have occurred after 34 low anterior resections for carcinoma of the rectum performed during the past 2 years using the EEA staple gun. These recurrences all occurred after resection of locally advanced tumours and caused distressing symptoms, and it is suggested that this technique might be best reserved for more favourable growths.

Aged↗
PubMed1982

Synthesis and antiviral properties of some 2'-deoxy-5-(fluoroalkenyl)uridines.

The following 5-substituted 2,4-dimethoxypyrimidines were synthesized: 5-(2,2,2-trichloro-1-hydroxyethyl), 5-(2,2,2-trichloro-1-fluoroethyl),5-(2,2-dichloro-1-fluorovinyl) (5), and 5-(perfluoropropen-1-yl) (a mixture of E and Z isomers, 6 and 7). Demethylation of 5 gave 5-(2,2-dichloro-1-fluorovinyl)uracil, and demethylation of the mixture of 6 and 7 gave some pure (E)-5-(perfluoropropen-1-yl)uracil. Compound 5 was converted into its 2'-deoxyribonucleoside (12) and its alpha-anomer by standard procedures. 2'-Deoxy-3,5-dilithio-3',5'-O-bis(trimethylsilyl)uridine was reacted with the appropriate fluoroalkene to give the following 5-substituted 2'-deoxyuridines in low yield (6-24%): 5-(2-chloro-1,2-difluorovinyl) (a mixture of E and Z isomers, 15 and 16, which were separated on a small scale), 5-(perfluoropropen-1-yl), 5-(perfluorocyclohexen-1-yl), and 5-(perfluorocyclopenten-1-yl). In these reactions, 2'-deoxy-5-(trimethylsilyl)uridine and 2'-deoxyuridine were also formed. The 5-substituted 2'-deoxyuridines were tested for activity against herpes simplex virus type 1. Compound 12 and the mixture of 15 and 16 had an ID50 of 20-26 micrograms/mL in Vero cells. The activity of the mixture resided in one isomer, which by analogY with the corresponding (Z)- and (E)-5-(2-bromovinyl)-2'-deoxyuridines was concluded to be the Z isomer (16).

Antiviral Agents↗
PubMed1982

Antiviral, antimetabolic, and cytotoxic activities of 5-substituted 2'-deoxycytidines.

Various 5-substituted 2'-deoxycytidines, including 5-bromo-dCyd, 5-iodo-dCyd, 5-nitro-dCyd, 5-ethynyl-dCyd, 5-propyl-dCyd, (E)-5-(2-bromovinyl)-dCyd, and (E)-5-(2-iodovinyl)-dCyd, were evaluated for their antiviral and antimetabolic properties in primary rabbit kidney (PRK) cell cultures and for their inhibitory effects on murine L1210 cell proliferation. All dCyd analogues proved to be selective inhibitors of herpes simplex virus (HSV) replication: 5-bromo-dCyd, 5-iodo-dCyd, 5-nitro-dCyd, and 5-ethynyl-dCyd were more selective in their anti-HSV activity than were the corresponding 5-substituted 2'-deoxyuridines, whereas 5-propyl-dCyd, (E)-5-(2-bromovinyl)-dCyd, and (E)-5-(2-iodovinyl)-dCyd were as selective as their dUrd counterparts. The dCyd analogues were also less cytotoxic (for both PRK and L1210 cells), as could be monitored by inhibition of either cell proliferation or host-cell DNA synthesis (incorporation of radiolabeled precursors). Of all 5-substituted 2'-deoxycytidines tested, the (E)-5-(2-halogenovinyl) derivatives emerged as the most potent and most selective inhibitors of HSV (Type 1) replication.

Animals↗
PubMed1981

Sister chromatid exchange induced by anti-herpes drugs.

The rate of sister chromatid exchange induced by several anti-herpes agents was measured to assess their potential mutagenicity. The agents--5-iodo-deoxyuridine (IDU), 5-trifluoromethyl-deoxyuridine (TFT), and [E]-5-(2-bromovinyl)-deoxyuridine (BVDU)--were incubated at various concentrations with human lymphocytes and fibroblasts, and that rate of sister chromatid exchanges was measured. In lymphocytes and fibroblasts BVDU and IDU did not induce exchange except at concentrations of 50 mg/l, while TFT increased the rate of exchange at a concentration of 0.5 mg/l. The rate of sister chromatid exchange is a sensitive index of chromosomal damage, and these findings provide information on the safety of some of the antiherpes agents tested. TFT increased the rate of exchange at a concentration that coincides with its minimal antiviral concentration, but BVDU did not induce exchange at therapeutic concentrations.

Antiviral Agents↗
PubMed1981

The nucleotide sequence of the tRNAMMet from the archaebacterium Thermoplasma acidophilum.

Using in vitro labelling techniques, a tRNAMMet from Thermoplasma acidophilum, a member of the Archaebacteriae, has been shown to have the sequence: pGCCGGG Gs4UGGCUCANCUGGAGGAGC m2(2)GCCGGACmUCAUt6AAUCCGGAGGUCUCGGG psi psi CmGAUCCCCGAUCCCGGCACCAOH. Despite the small genome size of this non-parasitic organism, eight modified nucleosides are present, one of which is typically eubacterial, one of which is typically eukaryotic and some of which appear to be unique to the archaebacteria. There is no close sequence homology between this tRNA and that of any other methionine tRNA so far sequenced (less than 70%) but it has almost 90% homology with the nucleotide sequence proposed by Eigen and Oswatitsch for the ancestral quasi-species.

Base Sequence↗
PubMed1981

The nucleotide sequence of the 5S rRNA from the archaebacterium Thermoplasma acidophilum.

The complete nucleotide sequence of the 5S ribosomal RNA isolated from the archaebacterium Thermoplasma acidophilum has been determined. The sequence is: pG GCAACGGUCAUAGCAGCAGGGAAACACCAGAUCCCAUUCCGAACUCGACGGUUAAGCCUGCUGCGUAUUGCGUUGUACU GUAUGCCGCGAGGGUACGGGAAGCGCAAUAUGCUGUUACCAC(U)OH. The homology with the 55 rRNA from another archaebacterial species, Halobacterium cutirubrum, is only 60.6% and other 55 rRNAs are even less homologous. Examination of the potential for forming secondary structure is revealing. T. acidophilum does not conform to the usual models employed for either procaryotic or eucaryotic 5S rRNAs. Instead this 5S rRNA has a mixture of the characteristic features of each. On the whole this 5S rRNA does however appear more eucaryotic than eubacterial. These results give further support to the notion that the archaebacteria represent an extremely early divergence among entities with procaryotic organization.

Base Sequence↗
PubMed1981

Synthesis and antiviral properties of (Z)-5-(2-bromovinyl)-2'-deoxyuridine.

(Z)-5-(2-Bromovinyl)uracil was obtained by photoisomerization of the E. isomer. Similarly, (E)-5-(2-bromovinyl)-2'-deoxyuridine gave the required Z isomer. (Z)-5-(2-Bromovinyl)-2'-deoxyuridine is much less active against herpes simplex virus type 1 (HSV-1) and somewhat less active against herpes simplex virus type 2 than is the E isomer. Both isomers show similar activity against vaccinia virus. Therefore, the highly potent and selective activity of (E)-5-(2-bromovinyl)-2'-deoxyuridine against HSV-1 is due to its E configuration.

Animals↗
PubMed1981

The synthesis and properties of some 5-substituted uracil derivatives.

The problems encountered in the synthesis of 5-vinyl-2'-deoxyuridine are outlined and the synthesis of 5-bromoethynyl-2'-deoxyuridine described. E-5-(2-Bromovinyl)-2'-deoxyuridine is the most potent and specific agent against some herpes viruses yet discovered; we have now synthesised the Z-isomer and this appears to be essentially biologically inert.

Animals↗
PubMed1980

The nucleotide sequence of glycine tRNA from Mycoplasma mycoides sp. capri.

Using in vitro labelling techniques, a tRNAGly from M. mycoides sp. capri PG3 has been shown to have the sequence : pGCAGGUGs4UAGUUUAAUGGCAGAACUUC AGCCUUCCm6AAGCUGAUUGUGAGGGU psi CGAUUCCCUUCACCUGCUCCAOH. The anticodon is UCC and no other tRNAGly has been detected in the crude tRNA isolated from this organism. As is the case with some mitochondrial tRNAs, where the genome size of the organelle is small, it is possible that this tRNA is used to read all four glycine codons GGN.

Anticodon↗
PubMed1980

Incorporation of 5-substituted uracil derivatives into nucleic acids. The isolation and gamma-radiation-sensitivity of bacteriophage T3 containing the thymine analogue 5-vinyluracil.

Bacteriophage T3 was produced in a form that contained 32% of its normal DNA thymine residues replaced with 5-vinyluracil residues by infecting a thymine-requiring strain of Escherichia coli with phage T3 in a medium containing 5-vinyluracil. When 2'-deoxy-5-vinyluridine was added to the medium instead, no incorporation was observed into the phage DNA, and the presence of the deoxyribonucleoside severely decreased the number of viable phage particles produced. The analogue-containing phage, although initially viable, rapidly lost viability when stored, but it was no more sensitive than was normal phage T3 to the effect of gamma-radiation.

Base Composition↗
PubMed1980

Comparative efficacy of antiherpes drugs against different strains of herpes simplex virus.

A large variety of antiherpes compounds was compared for their inhibitory activity against laboratory strains and clinical isolates of herpes simplex virus (HSV) type 1 and type 2. From studies performed in primary rabbit kidney cell cultures, six, E-5-(2-bromovinyl)-2'-deoxyuridine, E-5-(2-iodovinyl)-2'-deoxyuridine, 5-vinyl-2'-deoxyuridine, 2'-fluoro-5-iodoaracytosine, acycloguanosine, and 5-iodo-2'-deoxycytidine, emerged as the most potent and selective antiherpes agents. For HSV type 1, the 50% inhibitory doses (ID50) were 0.008, 0.012, 0.018, 0.017, 0.04, and 0.06 micrograms/ml, respectively; those for HSV type 2 were 1, 2, 0.1, 0.05, 0.04, and 0.3 microgram/ml, respectively. These compounds did not inhibit host-cell metabolism or replication of vaccinia virus except at concentrations 100--10,000 times greater than the ID50 for any HSV. All were significantly less inhibitory for a thymidine kinase (TK)-deficient mutant of HSV type 1 than for normal strains, suggesting that phosphorylation by virus-induced TK was required to produce specific inhibition of HSV replication.

Antiviral Agents↗
PubMed1980

(E)-5-(2-bromovinyl)-2'-Deoxyuridine in the treatment of experimental herpes simplex keratitis.

IDU (5-iodo-2'-deoxyuridine), BVDU [(E)-5-(2-bromovinyl)-2'-deoxyuridine] and placebo ointments were studied for their effects on experimental herpes simplex (type 1) keratoconjuncitivitis in rabbits. When treatment was begun 65 h after virus inoculation, both BVDU and IDU prevented development of keratitis. Both BVDU and IDU were also effective in suppressing the severity of conjunctivitis, and in this respect, BVDU proved significantly better than IDU. When treatment was started 110 h after virus inoculation, BVDU proved significantly better than IDU in promoting healing of established keratitis.

Animals↗
PubMed1980

The synthesis and properties of some 5-substituted uracil derivatives.

The chemical syntheses of some 5-substituted uracil deorivatives, in particular 5-vinyl-2'-deoxyuridine, 5-ethynyl-2'-deoxyuridine and 4-(2-bromovinyl)-2'-deoxy-uridine are reviewed and their potential as radiation sensitizing agents, anti-cancer agents and antiviral agents is discussed. 5-Ethynyl-2'-deoxyuridine is not incorporated into DNA; is a thymidylate synthetase inhibitor and has a possible use as an anti-cancer drug. 5-Vinyl-2'-dexyuridine can replace thymidine residues in DNA of phage T3; does not cause the organism to be significantly more sensitive to gamma-radiation but its presence in DNA causes the organisms to be significantly more sensitive to gamma-radiation but its presence in DNA causes the organism to lose viability, possibly through chemical cross-linking reactions of the vinyl group. 5-(2-Bromovinyl)-2'-deoxyuridine is the most specific and potent antiherpes compound yet known. Its mode of action and its affects on herpes virus in vitro and in vivo with animal models and clinical observations are described.

Bromodeoxyuridine↗