Search PubMed⌕ Search

Biomedical subjects

R T Pon

Publications and source records attributed to R T Pon.

At least 55 records · Page 3Linked to original sources
PubMed1989

Primer-mediated enzymatic amplification of cytomegalovirus (CMV) DNA. Application to the early diagnosis of CMV infection in marrow transplant recipients.

A nucleic acid amplification procedure, the polymerase chain reaction (PCR), has been used to establish a diagnostic assay for the identification of cytomegalovirus (CMV) immediate-early sequences in clinical specimens. Preliminary testing against virus-infected cell cultures indicated that the PCR assay was highly CMV-specific, recognizing both wild-type and laboratory strains of CMV. There was no cross-reactivity with human DNA or with DNA from other herpes viruses. The sensitivity of the assay, using cloned CMV AD169 Eco RI fragment-J as template, was 1 viral genome per 40,000 cells. In a prospective study of CMV infection in bone marrow transplant recipients, the PCR assay correctly identified four patients with confirmed CMV infection. In three of these patients who were followed longitudinally, correlation of DNA reactivity with CMV culture and CMV antibody status over time indicated that DNA was the most sensitive marker for the diagnosis of CMV infection.

Adolescent↗
PubMed1988

Parallel stranded DNA.

A series of four hairpin deoxyoligonucleotides was synthesized with a four-nucleotide central loop (either C or G) flanked by the complementary sequences d(T)10 and d(A)10. Two of the molecules contain either a 3'-p-3' or 5'-p-5' linkage in the loop, so that the strands in the stem have the same, that is, parallel (ps) polarity. The pair of reference oligonucleotides have normal phosphodiester linkages throughout and antiparallel (aps) stem regions. All the molecules adopt a duplex helical structure in that (i) the electrophoretic mobilities in polyacrylamide gels of the ps and aps oligomers are similar. (ii) The ps hairpins are substrates for T4 polynucleotide kinase, T4 DNA ligase, and Escherichia coli exonuclease III. (iii) Salt-dependent thermal transitions are observed for all hairpins, but the ps molecules denature 10 degrees C lower than the corresponding aps oligomers. (iv) The ultraviolet absorption and circular dichroism spectra are indicative of a base-paired duplex in the stems of the ps hairpins but differ systematically from those of the aps counterparts. (v) The bis-benzimidazole drug Hoechst-33258, which binds in the minor groove of B-DNA, exhibits very little fluorescence in the presence of the ps hairpins but a normal, enhanced emission with the aps oligonucleotides. In contrast, the intercalator ethidium bromide forms a strongly fluorescent complex with all hairpins, the intensity of which is even higher for the ps species. (vi) The pattern of chemical methylation is the same for both the ps and aps hairpins. The combined results are consistent with the prediction from force field analysis of a parallel stranded right-handed helical form of d(A)n.d(T)n with a secondary structure involving reverse Watson-Crick base pairs and a stability not significantly different from that of the B-DNA double helix. Models of the various hairpins optimized with force field calculations are described.

DNA↗
PubMed1988

Sequence specific molecular recognition by a monocationic lexitropsin of the decadeoxyribonucleotide d-[CATGGCCATG]2: structural and dynamic aspects deduced from high field 1H-NMR studies.

All 1H-NMR resonances of d-[CATGGCCATG]2 and the 1:1 complex of lexitropsin 1 and the DNA were assigned by the NOE difference, COSY and NOESY methods. Addition of 1 causes the base and imino protons for the sequence 5'-CCAT to undergo the most marked drug-induced chemical shift changes, thereby indicating that 1 is located in this base pair sequence. NOEs confirmed the location and orientation of the drug in the 1:1 complex, with the amino terminus oriented to C(6). The van der Waals interaction between H12a,b of 1 and AH2(8) may be responsible for reading of the 3' A.T base pair in the 5'-CCAT sequence. Exchange NMR effects allow an estimate of approximately equal to 62 s-1 for the intramolecular "slide-swing" exchange of the lexitropsin between two equivalent binding sites with delta G = 58 +/- 5 kJ mol-1 at 301 degrees K.

Computer Simulation↗
PubMed1988

Structural and dynamic aspects of binding of a prototype lexitropsin to the decadeoxyribonucleotide d(CGCAATTGCG)2 deduced from high-resolution 1H NMR Studies.

Structural and dynamic properties of the self-complementary decadeoxyribonucleotide d(CGCAATTGCG)2 and the interaction between a prototype lexitropsin, or information-reading oligopeptide, and the decadeoxyribonucleotide are deduced by using high-resolution 1H NMR techniques. The nonexchangeable and imino proton resonances of d(CGCAATTGCG)2 have been completely assigned by two-dimensional NMR studies. The decadeoxyribonucleotide exists as a right-handed B-DNA. In the 1H NMR spectrum of the 1:1 complex, the selective chemical shifts and removal of degeneracy of AH2(4), AH2(5), T-CH3(6), and T-CH3(7) due to the anisotropy effects of the heterocyclic moieties of the ligand, and with lesser effects at the flanking base sites C(3) and G(8), locate the drug centrally in the decadeoxyribonucleotide. This conclusion is supported by plots of individual chemical shift changes across the decadeoxyribonucleotide. Similarly, imino protons IV and V experience larger shifts and II and III smaller shifts in accord with this conclusion while drug complexation permits the detection of imino proton I. Strong nuclear Overhauser effects (NOEs) between pyrrole H5 and AH2(5), and weaker NOEs to AH1'(5), TH3'(6), and AH2'(5), firmly locate the ligand in the minor groove. Intraligand NOEs between the adjacent heterocyclic moieties indicate that the lexitropsin is subject to propeller twisting about the N6-C9 bond in both the bound and free forms. Nuclear Overhauser effect spectroscopy (NOESY) and correlated spectroscopy (COSY) experiments also indicate that the removal of degeneracy of the C16 methylene protons upon complexation may arise from restricted rotation about the C15-N9, C15-C16, and C16-C17 bonds. Specific hydrogen bonds between amide NH groups on the concave face of the ligand (N4H, N6H, N9H) and adenine N3 or thymine O2 on the floor of the minor groove are in accord with displacement of the hydration shell by the drug. NOE measurements on the decadeoxyribonucleotide in the 1:1 complex confirm it exists as a right-handed helix and belongs to the B family. Exchange NMR effects permit an estimate of a rate of approximately equal to 44 s-1 for the two-site exchange of the lexitropsin between two equivalent sites on the decamer with delta G++ approximately equal to 70 +/- 5 kJ mol-1 at 294 K. Alternative mechanisms for this exchange process are considered.

Base Sequence↗
PubMed1988

Structural and dynamic aspects of the sequence specific binding of netropsin and its bis-imidazole analogue on the decadeoxyribonucleotide d-[CGCAATTGCG]2.

High field 1H-NMR techniques have been used to examine the sequence dependent binding of a lexitropsin, the bis-imidazole analogue of netropsin 1, to the decadeoxyribonucleotide d-[CGCAATTGCG]2. The non-exchangeable and imino protons of the 1:1 lexitropsin:DNA complex are assigned by 1D-NOE difference and COSY methods. Addition of 1 to the DNA resulted in marked drug induced chemical shift changes of both the non-exchangeable and imino protons of A(4,5) and T(6,7). These results suggest that the lexitropsin is located in the minor groove along A(4) to T(7) of the DNA. Weaker chemical shift changes are observed for C(3) and G(8) which suggest that the bisimidazole moiety of 1 can also accept G.C sites. Specific NOEs seen between the lexitropsin (H2, H14 and H15) and DNA (AH2(4) and AH2(5] confirmed that the N to C-terminii of 1 is, on average, bound centrally to the sequence in the direction 5'-AATT-3'. However, netropsin 2 is shown to bind tightly only to the AATT sequence. Exchange NMR effects permit the estimate of the rate of exchange of the lexitropsin 1 between the two equivalent sites on the DNA to be approximately 160s and 24s for netropsin under comparable conditions. Several factors contributing to the sequence specificity of lexitropsin binding are discussed.

Base Sequence↗
PubMed1988

Sequence specific molecular recognition and binding of a monocationic bis-imidazole lexitropsin to the decadeoxyribonucleotide d-[(GATCCGTATG).(CATACGGATC)]: structural and dynamic aspects of intermolecular exchange studied by 1H-NMR.

The non-exchangeable and imino proton NMR resonances of the non self-complementary decadeoxyribonucleotide d-[(GATCCGTATG).(GATACGGATC)] as well as those of the 1:1 complex of the monocatonic bis-imidazole lexitropsin 1 to this sequence have been assigned by using a combination of NOE difference, COSY and NOESY techniques. Confirmation of complete annealing of the two non self-complementary decamer strands to give the duplex decadeoxyribonucleotide is obtained by the detection of ten imino protons. It is established that the sugar-base orientations of all the bases in the duplex decamer are anti. From NOE studies, it is concluded that the duplex oligomer is right-handed and adopts a conformation in solution that belongs to the B family. A population analysis reveals that the sugar moieties exist predominantly in the S-form (2'-endo-3'-exo). Addition of 1 to the DNA solution leads to doubling of the resonances for CH6(4,5), GH8(6), TH6(7) and T-CH3(7). The base, anomeric H1' and imino proton signals for the base sequence 5'-CCGT undergo the most marked drug-induced chemical shift changes. These results provide evidence that the lexitropsin is bound to the sequence 5'-CCGT in the minor groove of the DNA. NOE measurements between the amide protons (NH1 and NH4) and the imino proton (IV and V) signals confirmed the location and orientation of 1 in the 1:1 complex, with the imino terminus oriented to C(4). The specific binding of 1 to the sequence 5'-CCGT-3' deduced in this study is in agreement with the footprinting data obtained using the Hind III/Nci fragment from pBR322 DNA [Kissinger et al. 1987 (13)]. Intramolecular NOEs observed between H4 and H9 of the lexitropsin suggest that the molecule is not planar, but subjected to propeller twisting, in both the free and bound forms. Furthermore, NOE measurements permit assignment of the DNA duplex in the 1:1 complex to the B-form, which is similar to that of the free DNA. The [(T7A8T9).(A12T13A14)] segment of the DNA shows better stacking, by propeller twisting, compared to the rest of the molecule in the free as well as the complex forms. The intermolecular rate of exchange of 1 between the equivalent 5'-CCGT sites, at a concentration of 12 mM, is estimated to be approximately 88s-1 at 308 degrees K with delta G not equal to of 63 +/- 5 KJ mol-1.

Base Sequence↗
PubMed1988

Derivatization of controlled pore glass beads for solid phase oligonucleotide synthesis.

An improved and simplified procedure for the attachment of nucleosides onto long chain alkylamine controlled pore glass beads (LCAA-CPG) is presented. This procedure uses 1-(3-dimethylamino-propyl)-3-ethylcarbodiimide (DEC) to couple nucleoside 3'-succinates directly to the LCAA-CPG. The preparation of nucleoside 3'-succinate anhydrides, p-nitrophenyl, or pentachlorophenyl esters and the use of highly toxic dicyclohexylcarbodiimide (DCC) is no longer required. Procedures involving acidic activation of the LCAA-CPG before derivatization and a pre-synthesis capping are also described, which prevent the formation of oligonucleotides linked by 3'-phosphates to the LCAA-CPG. Evidence is presented indicating that this type of linkage is responsible for the apparently greater than 100% coupling yields observed for the first coupling cycle.

Colorimetry↗
PubMed1987

A general method for the purification of synthetic oligodeoxyribonucleotides containing strong secondary structure by reversed-phase high-performance liquid chromatography on PRP-1 resin.

Synthetic 5'-dimethoxytritylated oligodeoxyribonucleotides, which contained strong secondary structure, were satisfactorily denatured and purified by reversed-phase HPLC on PRP-1 columns when strongly alkaline conditions (0.05 M NaOH) were employed. This procedure was suitable for the purification of hairpin structures, e.g., d(CG)nT4(CG)n (n = 4, 5, 6), and oligo(dG) sequences, e.g., d(G)24, as well as oligodeoxyribonucleotide probes which contained degenerate base sites. Oligodeoxyribonucleotides as long as 50 bases in length were purified. Recovery of injected oligonucleotides was typically 90% or better. The high capacity of the PRP-1 resin also allowed purification to be performed on a preparative scale (2-8 mg per injection). Enzymatic degradation and HPLC analysis indicated that no modification of the heterocyclic bases occurred under the alkaline conditions described.

Base Sequence↗
PubMed1987

Analysis of functional domains on reovirus cell attachment protein sigma 1 using cloned S1 gene deletion mutants.

Previously a reovirus (serotype 3) S1 gene cDNA was inserted into the lac cloning site of pUC13 and expressed in Escherichia coli to yield a sigma 1 fusion protein (F-sigma 1) capable of binding to mouse L fibroblasts and of agglutinating human red blood cells (S.A. Masri, L. Nagata, D. C. W. Mah, and P. W. K. Lee, 1986, Virology 149, 83-90). To probe the functional domains on the sigma 1 protein, restriction enzymes which divide the S1 gene into four segments (5'-I-II-III-IV-3') of similar size were used to generate five in-frame deletion mutants (D1-D5). Corresponding mutant forms of sigma 1 were expressed in E. coli and were assayed for (i) host cell (mouse L fibroblasts) binding activity; (ii) glycophorin (reovirus erythrocyte receptor) binding activity (R. W. Paul and P. W. K. Lee, 1987. Virology 159, 94-101 and (iii) recognizability by a library of neutralizing monoclonal anti-sigma 1 antibodies. It was found that mutant sigma 1 forms with segment III or segment IV deleted did not exhibit any detectable L-cell binding activity, whereas mutants with these two segments intact (but lacking segment II or segments I and II) were capable of attaching to L-cell receptors, albeit with reduced efficiencies. On the other hand, only F-sigma 1, but none of the mutants, could bind immobilized glycophorin. These data clearly suggest that the host cell binding domain of sigma 1 is distinct from its hemagglutination domain. Also, the five neutralizing anti-sigma 1 monoclonal antibodies tested were all found to recognize epitopes on either the middle segments or the carboxy-terminal half of sigma 1.

Animals↗
PubMed1987

Sequence dependent conformation and local geometry of the conserved branch site sequence element d(TpApCpTpApApC), essential for yeast mRNA splicing, deduced from high resolution 1H-NMR.

The conserved sequence element and branch site splice signal d(TpApCpTpApApC) has been synthesized by a solid phase procedure. All the non-exchangeable protons have been assigned using a combination of one-dimensional and two-dimensional 1H-NMR analytical procedures. On the basis of the low NOE intensities in the 1D-NOE and NOESY experiments, the heptamer exists in solution as a random coil. The deoxyribose rings towards the 5' terminus exist predominantly in the S form (2'-endo-3'-exo) while residues on or adjacent to the 2' branch site in the eventual lariat structure [A(6) of TACTAAC] show more N-character (3'endo-2'-exo). In addition unique propeller twisting at contiguous AT base pairs in the consensus 5'-splice site occurs in the region in which there is partial complementarity with the branch splice signal TACTAAC. These subtle structural features, if carried over to the corresponding RNA, may have significance either as a recognition signals or for stereochemical reasons in the formation of the lariat intermediate in the maturation process of mRNA.

Base Sequence↗
PubMed1987

Structure and conformation of the duplex consensus 5'-splice site d[(CpApGpGpTpApApGpT).(ApCpTpTpApCpCpTpG)] deduced from high field 1H-NMR of the non-exchangeable and imino protons.

The complementary consensus donor exon intron junction d(ApCpTpTpApCpCpTpG) has been synthesized by a solid phase procedure. The non-exchangeable proton assignments were obtained using one- and two-dimensional NMR techniques including NOE, COSY, NOESY and 1H-1H-INADEQUATE. The non self-complementary nonamer exists as a random coil form in aqueous buffer at 21 degrees C as evidenced by the temperature variable 1H-NMR and NOE measurements. The nonamer was annealed to the primary consensus donor junction d(CpApGpGpTpApApGpT) and confirmation of complete annealing was obtained by detection and assignment of base pair imino protons in D2O/H2O mixtures. Application of one- and two-dimensional NMR techniques permitted the complete assignment of all the non-exchangeable protons in the duplex nonamer. These data, together with determination of vicinal coupling constants in the individual deoxyribose moieties, permits the following conclusions on the structure and conformation of the consensus donor junction: (i) it exists in aqueous solution in a conformation that belongs to the B family (ii) the sugar-base orientations are anti (iii) the deoxyribose units exist predominantly in the S conformation (2'-endo-3'-exo) (iv) the contiguous A.T base pairs d[T(5)-A(6)-A(7)].d[T(12)-T(13)-A(14)], two positions removed downstream from the splice site (5'-CAG decreases GTAAGT-3'), are uniquely propeller twisted. The propeller twisting occurs in the region in which there is partial complementarity with the branch site splice signal TACTAAC. The cross-correlation rates were used to derive the interproton distances between adjacent AH2 protons of 4.00 A in the T(5)-A(6).T(13)-A(14) step and of 3.87 A in the A(6)-A(7).T(12)-T(13) step. This structural and conformational feature if carried over into the primary RNA transcripts may serve as a recognition signal for this critical site in the genome.

DNA↗
PubMed1986

Prevention of guanine modification and chain cleavage during the solid phase synthesis of oligonucleotides using phosphoramidite derivatives.

Phosphoramidite reagents can phosphitylate guanine bases at the O6-position during solid phase synthesis and serious chain cleavage occurs if the base phosphitylation is not eliminated before the iodine/water oxidation step. This can be accomplished by blocking the O6-position with a 2-cyanoethyl protecting group for deoxyribonucleotides or with a p-nitrophenylethyl group for ribonucleotides, regenerating the guanine base with water or acetate ions, or using N-methylanilinium trifluoroacetate (TAMA) as the phosphoramidite activator. The effectiveness of these methods was demonstrated by both 31P NMR studies and by the synthesis of d(Gp)23G, (Gp)14G, and d-(Gp)13rG sequences.

Amides↗
PubMed1985

Modification of guanine bases by nucleoside phosphoramidite reagents during the solid phase synthesis of oligonucleotides.

Nucleoside 3'-phosphoramidite and chlorophosphite reagents have been found to react with the lactam function of guanine. This reaction caused unsatisfactory results when oligodeoxyribonucleotides containing a large number of guanine bases were prepared in an automated solid phase synthesizer. The guanine modification is unstable, and leads to depurination and chain cleavage. This side reaction can be eliminated by protecting the O6-position. A new O6-p-nitrophenylethyldeoxyguanosine phosphoramidite derivative, 8, was used to prepare sequences containing up to 24 guanine bases with greatly improved results. A hexatriacontanucleotide, d(CGCGGGGTGGAGCAGCCTGGTAGCTCGTCGGGCTCA), was also prepared using O6-protected deoxyguanosine nucleosides.

Chromatography, Thin Layer↗
PubMed1980

The chemical synthesis of oligoribonucleotides VII. A comparison of condensing agents in the coupling of silylated ribonucleosides.

The t-butyldimethylsilyl group is shown to be an ideal protecting group for the 2T-hydroxyl function of ribonucleosides during the synthesis of ribonucleotides using any of nine commonly used condensing agents. The phosphite coupling procedure compares favorably with all of the widely used condensing agents and provides a most convenient route to the key intermediates in the "modified" triester strategy.

Methods↗
PubMedDate not supplied

Solution structure studies of the cobalt complex of a bleomycin functional model bound to d(CGCAATTGCG)2 by two-dimensional nuclear magnetic resonance methods and restrained molecular dynamics simulation.

The interaction between the cobalt(III) complex of a bleomycin functional model (AMPHIS-NET) and the oligonucleotide d(CGCAATTGCG)2 and the structural features of the 1:1 ligand-DNA complex have been determined by high-resolution two-dimensional nuclear magnetic resonance methods and restrained molecular dynamics calculations. The intermolecular nuclear Overhauser effect (NOE) cross-peaks between ligand protons and the DNA minor groove protons suggest that the cobalt(III) complex of AMPHIS-NET binds in the minor groove of DNA at the central AATT site. The NOE connectivities also clearly indicate that the H8 pyridine proton and the H2 imidazole proton in the metal-binding domain interact with the H4' sugar proton of C19 and the H4' sugar proton of A5, respectively, which defines a structure where the metal binding moiety of Co(III).AMPHIS-NET participates in binding to the DNA and extends into the region two base pairs beyond the central AATT site in the minor groove. This binding model is in accord with the consistently observed nondiffusion DNA cleavage in locations two to three residues beyond the end of AT-rich binding sites induced by the corresponding iron(II) complexes of AMPHIS-NET and other AMPHIS-lexitropsin hybrids of the bleomycin functional model compounds.

Antiviral Agents↗
PubMedDate not supplied

Rapid esterification of nucleosides to solid-phase supports for oligonucleotide synthesis using uronium and phosphonium coupling reagents.

Nucleosides can be esterified to solid-phase supports using uronium or phosphonium coupling reagents and a coupling additive, such as 1-hydroxybenzotriazole (HOBT), 7-aza-1-hydroxybenzotriazole (HOAT), N-methylimidazole (NMI), or 4-(dimethylamino)pyridine (DMAP). However, DMAP was far superior to other additives and high nucleoside loadings (up to 60 micromol/g) and rapid coupling reactions (< or = 10 min) were possible. Hydroxyl-derivatized CPG was attached to nucleosides with 3'-succinyl or 3'-hydroquinone-O, O'-diacetic acid (HQDA or Q-Linker) carboxyl groups through a primary ester linkage. Alternatively, supports derivatized with succinic acid or the Q-Linker were attached directly to the 3'-OH group of nucleosides through a secondary ester linkage. Uronium reagents (HATU or HBTU) gave the best results with the HQDA linker arm, while the bromophosphonium (BrOP or PyBrOP) reagents were best with the succinyl linker arm. In all cases, the coupling reactions were much faster than previous methods using carbodiimide coupling reagents. The ease and speed of the reaction make this support derivatization procedure suitable for automated in situ couplings on DNA synthesizers.

4-Aminopyridine↗
PubMedDate not supplied

Solid-phase oligonucleotide synthesis and flow cytometric analysis with microspheres encoded with covalently attached fluorophores.

A novel combinatorial approach to synthesize oligonucleotides on fluorescently encoded microspheres based on flow sorting and segmental solid-phase synthesis is described. BODIPY dyes were covalently attached to polystyrene (8.8 microm, 55% DVB) microsphere particles to generate four fluorescently encoded sets. 20-mer oligonucleotide sequences can be synthesized on these microspheres with yields comparable to conventional CPG supports (80% overall yield, average stepwise yield = 99%). The concept of segmental solid-phase synthesis by flow sorting was demonstrated by synthesizing unique 20-mer oligonucleotide sequences on each of four fluorescently encoded microsphere sets by including a flow sorting step (after first eight base additions) and flow cytometric detection of sequences synthesized on each microsphere set by hybridization with fluorescently labeled complementary sequence.

Boron Compounds↗