Search PubMed⌕ Search

Biomedical subjects

R Kawai

Publications and source records attributed to R Kawai.

At least 19 recordsLinked to original sources
PubMed2001

Acid/azole complexes as highly effective promoters in the synthesis of DNA and RNA oligomers via the phosphoramidite method.

The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3'-(allyl N,N-diisopropylphosphoramidite)s or 3'-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3'-O-(tert-butyldimethylsilyl)ribonucleoside 2'-(N,N-diisopropylphosphoramidite)s or 2'-O-(tert-butyldimethylsilyl)ribonucleoside 3'-(N,N-diisopropylphosphoramidite)s used for the formation of 2'-5' and 3'-5' internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5'-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, (5')CGACACCCAATTCTGAAAAT(3') (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3'-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3'-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as (5')AGCUACGUGACUACUACUUU(3') (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5'-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2'-5')adenylyl(2'-5')adenosine (2-5A core).

DNA↗
PubMed2001

Nucleotide synthesis via methods without nucleoside-base protection.

Oligonucleotide synthesis via methods without nucleobase protection (N-unprotected methods) is briefly reviewed. The N-unprotected methods are advantageous in the following respects over conventional approaches that use protectors, generally, acyl protectors for the nucleobase (N-protected method). Two steps, introduction and removal of the protecting groups, are eliminated, and consequently use of undesirable reagents involved in these steps are avoided. In the synthesis of DNA oligomers, the risk of depurination of deoxyadenosine and deoxyguanosine derivatives, which is a serious problem in the N-protected methods, is considerably reduced. The range of synthesizable artificial analogues bearing base-labile functions is extended because harsh base treatment for the deprotection is eliminated.

Nucleosides↗
PubMed2000

Extramitochondrial localization of mortalin/mthsp70/PBP74/GRP75.

Subcellular fractionation and immunofluorescence microscopy were used to identify the specific sites of intracellular residence of mortalin, also called a mitochondrial homologue of the hsp70 family, in immortal human cell lines previously assigned to four distinct complementation groups (A-D) for indefinite cell division. In addition to the mitochondria it was seen in the endoplasmic reticulum (ER) fractions of all the cell lines analyzed. Interestingly, three of the group A cells lines (EJ, GM639, and HT1080), in addition to the mitochondria and ER, exhibited cytosolically (extra-organelle) localized pool of mortalin. These findings demonstrate that mortalin is not present exclusively in mitochondria. Its residence in different organelles may be the basis of differential distribution observed previously in different human cell lines.

Biomarkers↗
PubMed2000

Synchronization of mutually coupled self-mixing modulated lasers

Synchronization of mutually coupled chaotic lasers has been demonstrated in a microchip LiNdP4O12 laser array with self-mixing feedback modulation. An abrupt transition to synchronized chaos by way of "phase squeezing" was observed when coupling between the two lasers was increased. This phenomenon is well reproduced by numerical calculations using model equations. It is also shown that low energy variation as well as high disorder are concurrently established in synchronized chaos.

Journal Article↗
PubMed2000

Modeling the kinetics of release of octreotide from long-acting formulations injected intramuscularly in rabbits.

Long-acting repeatable formulations (LAR) based on polymeric microspheres were manufactured to deliver octreotide, an octapeptide analogue used in acromegaly. We developed a model to describe the complex triphasic concentration versus time profile observed in rabbits after intramuscular (i.m.) injection of these LAR formulations. A 5-mg x kg(-1) dose of octreotide in a reference LAR formulation was given im to eight rabbits; two groups of four rabbits each received a different formulation. In each animal, 26 blood samples were taken over 49 days. Concentrations of octreotide were assayed by radioimmunoassay. A model describing the concentration profile was developed. Octreotide release was described using the succession of an exponential model, a semiempirical non-Fickian model, and a delayed Weibull model. Parameters were estimated using nonlinear regression, first for the eight rabbits that received the reference formulation and then for the other eight animals. The model provides an adequate description of the concentration versus time profile for the three formulations. For the reference phase, erosion accounted for 87% of total drug release. The formulation encapsulating an octreotide-acetate complex showed a prolonged diffusion phase.

Absorption↗
PubMed2000

The secondary endosymbiotic bacterium of the pea aphid Acyrthosiphon pisum (Insecta: homoptera).

The secondary intracellular symbiotic bacterium (S-symbiont) of the pea aphid Acyrthosiphon pisum was investigated to determine its prevalence among strains, its phylogenetic position, its localization in the host insect, its ultrastructure, and the cytology of the endosymbiotic system. A total of 14 aphid strains were examined, and the S-symbiont was detected in 4 Japanese strains by diagnostic PCR. Two types of eubacterial 16S ribosomal DNA sequences were identified in disymbiotic strains; one of these types was obtained from the primary symbiont Buchnera sp., and the other was obtained from the S-symbiont. In situ hybridization and electron microscopy revealed that the S-symbiont was localized not only in the sheath cells but also in a novel type of cells, the secondary mycetocytes (S-mycetocytes), which have not been found previously in A. pisum. The size and shape of the S-symbiont cells were different when we compared the symbionts in the sheath cells and the symbionts in the S-mycetocytes, indicating that the S-symbiont is pleomorphic under different endosymbiotic conditions. Light microscopy, electron microscopy, and diagnostic PCR revealed unequivocally that the hemocoel is also a normal location for the S-symbiont. Occasional disordered localization of S-symbionts was also observed in adult aphids, suggesting that there has been imperfect host-symbiont coadaptation over the short history of coevolution of these organisms.

Animals↗
PubMed2000

Dose-dependent pharmacokinetics of cyclosporin A in rats: events in tissues.

Cyclosporin A (CyA) tissue distribution kinetics was extensively studied after single 1.2-, 6-, and 30-mg/kg CyA doses (via 2-min i.v. infusion) to rats. Drug concentrations in blood and various tissues were measured using a specific radioimmunoassay. Based on total blood concentration data alone, CyA systemic pharmacokinetics appeared essentially linear. However, after taking the saturable, nonlinear blood cell binding into account, multiple nonlinear factors were identified. Intrinsic clearance at 30 mg/kg was about half the value at the two lower doses. Tissue distribution was also dose-dependent, with evidence of saturable binding in many tissues. In general, blood binding saturation (dissociation constant K(D) = 0. 18 microg/ml) occurred at a lower dose (concentration) than saturation of tissue binding (K(D), 0.005-0.77 microg/g), such that the volume of distribution at steady state first increased as the dose increased from 1.2 to 6 mg/kg, and then decreased as the dose increased to 30 mg/kg. Tissue binding was further investigated by various graphical analyses. Some organs showed a monophasic (single site) Scatchard plot of the tissue data at steady state, with high K(D) values. In other organs, biphasic binding characteristics were observed with the K(D) values of the high-affinity site in the same range as the K(D) reported for the binding of CyA with cyclophilin, the putative target. Saturable tissue binding may therefore influence not only the pharmacokinetics but also the efficacy of CyA.

Algorithms↗
PubMed1999

Identification of a 55-kDa ezrin-related protein that induces cytoskeletal changes and localizes to the nucleolus.

Normal and transformed human cells when stained for ezrin, an F-actin-binding ERM (ezrin/radixin/moesin) family protein, revealed a faint and intense immunofluorescence, respectively. Surprisingly, nuclear staining that was assigned to the nucleolus by confocal laser and immunoelectron microscopy was detected in both cell types and was more prominent in normal cells due to the absence of glistering cytoplasmic fluorescence. By Western analysis the nuclear fraction was seen to have a 55-kDa ezrin-reactive protein that did not react to the antibodies raised against the C-terminus of the protein, suggesting that it may correspond to an endogenously cleaved N-terminus of the protein. Transfections of cells with a cDNA encoding full-length ezrin tagged with green fluorescent protein (GFP) at its N-terminus indeed resulted in two GFP-tagged products corresponding to full-length and 55-kDa endogenously cleaved forms. Transfection with a cDNA encoding approximately 55 kDa of the ezrin N-terminus (N-ezrin) showed that it can translocate to the nucleus. N-ezrin transfected cells exhibited irregular cell edges and collapse of actin fibers. Similar changes were seen following microinjection of anti-p81/ezrin antibody, suggesting that N-ezrin may function as a dominant negative competitor of ezrin. These data demonstrate the existence of an N-terminal cleavage form of ezrin that localizes to the nucleolus and that its overexpression induces cytoskeletal changes.

Amino Acid Sequence↗
PubMed1999

Nonparametric analysis of the absorption profile of octreotide in rabbits from long-acting release formulation OncoLAR.

Octreotide (octreotide-acetate, Sandostatin(R)) is a somatostatin analogue, used in long-term treatment of acromegaly. The present study describes the absorption profile in rabbits of octreotide after release from the long-acting formulation OncoLAR (denoted as octreotide-LAR). In a first experiment, the disposition kinetics of octreotide was studied for 24 h in six rabbits after intravenous (i. v.) injection of 0.025 mg of a solution of octreotide. In a second experiment, release kinetics was studied in eight rabbits for 49 days after an i.m. injection of 5 mg/kg of octreotide-LAR. Concentrations were determined by radioimmunoassay. After i.v. injection of octreotide, one- and two-compartment models were compared for each rabbit. A typical disposition profile was computed using the mean parameters. After i.m. injection of octreotide-LAR, deconvolution was performed using the point-area method. Individual absorption profiles were characterised using natural splines. The number of breakpoints was selected using the generalised cross-validation criterion. The two compartment model was selected based on the i.v. study. After i.m. administration, octreotide exhibited a triphasic absorption profile, with large interindividual variability. A transient peak followed the initial burst phase. The third phase covered 85% of total drug released. The approach allows a model-independent description of the in vivo absorption profile of octreotide-LAR.

Absorption↗
PubMed1999

Physiologically based pharmacokinetics of cyclosporine A: reevaluation of dose-nonlinear kinetics in rats.

The disposition kinetics of Cyclosporine A (CyA) in rat, based on measurement in arterial blood, appeared dose-linear over a wide i.v. dose range (1.2-30 mg/kg). Physiologically based pharmacokinetic (PBPK) analysis, however, demonstrated that this was an apparent observation resulting from counterbalancing nonlinear factors, such as saturable blood and tissue distribution, as well as clearance (CLb). A PBPK model was successfully developed taking into account these multiple nonlinear factors. Tissue distribution was distinctly different among various organs, being best described by either a linear model (muscle, fat; Model 1), one involving instantaneous saturation (lung, heart, bone, skin, thymus; Model 2), noninstantaneous saturation (kidney, spleen, liver, gut; Model 3), or one with saturable efflux (brain; Model 4). Overall, the whole body volume of distribution at steady state for unbound CyA (Vuss) decreased with increasing dose, due at least in part to saturation of tissue-cellular cyclophilin binding. Clearance, essentially hepatic, and described by the well-stirred model, was also adequately characterized by Michaelis-Menten kinetics, Km 0.60 microgram/ml. In model-based simulations, both volume of distribution at steady state (Vss,b) and CLb varied in a similar manner with dose, such that terminal t1/2 remained apparently unchanged; these dose responses were attenuated by saturable blood binding. CyA concentration measured in arterial blood was not always directly proportional to the true exposure, i.e., unbound or target tissue concentrations. The PBPK model not only described comprehensively such complicated PK relationships but also permitted assessment of the sensitivity of individual parameters to variation in local nonlinear kinetics. Using this approach, dose-dependent CyA uptake into brain was shown to be sensitive to both active and passive transport processes, and not merely the affinity of the active (efflux) transporter at the level of the blood-brain barrier.

Animals↗
PubMed1999

Direct evidence for the intracellular localization of Hsp104 in Saccharomyces cerevisiae by immunoelectron microscopy.

To reveal the intracellular localization of Hsp104 in the yeast Saccharomyces cerevisiae before and after heat-shock, we performed immunoelectron microscopy after immunogold labeling with anti-Hsp104 antibody. At normal temperature (25 degrees C), a small amount of Hsp104 was located in the cytoplasm and nucleus. On exposure to mild heat-shock at 40 degrees C, protein aggregates appeared in the cytoplasm and nucleus, and Hsp104 increased around the aggregates with increasing time of the mild heat-shock treatment. Moreover, at lethal heat-shock temperature (51 degrees C) for 20 min after mild heat treatment at 40 degrees C, the intracellular localization of Hsp104 and intracellular structures were similar to those of the mild heat-shocked cells. However, in the lethally heat-shocked cells, certain intracellular structures were destroyed, and Hsp104 was not expressed. In the hsp104 null mutant strain Deltahsp104 which was treated at 40 degrees C, Hsp104 was not localized around the aggregates. Additionally, in the Deltahsp104 strain, even mild heat-shocked cells at 37 degrees C or 40 degrees C, showed destruction of intracellular structure compared to the wild-type strain. Our data suggest the following: (1) Hsp104 is associated closely with protein aggregates during heat-shock treatment, (2) Hsp104 is important for maintenance of the intracellular structure under lethal heat-shock conditions, (3) acquisition of thermotolerance depends on the amount of Hsp104 produced during mild heat-shock treatment.

Cell Nucleus↗
PubMed1999

A facile synthesis of DNA oligomers with modified backbones via the phosphoramidite method without nucleoside base protection.

A convenient synthesis of DNA oligomers with modified back bones including phosphorothioates and phosphotriesters has been developed on the basis of the phosphoramidite strategy without nucleoside base protection. In this synthesis, a new, convenient method for the preparation of N-free-5'-O-dimethoxytrityl-2'-deoxyribonucleoside by the direct O-selective dimethoxytritylation of the parent nucleosides has also been disclosed.

Amides↗
PubMed1999

Effect of PSC 833, a P-glycoprotein modulator, on the disposition of vincristine and digoxin in rats.

PSC 833 has been used to overcome the phenomenon of multidrug resistance by inhibiting the P-glycoprotein (P-gp)-mediated efflux of antitumor drugs from tumor cells. Because P-gp expressed in several normal tissues may affect the disposition of its substrates, we examined the dose-dependent effect of PSC 833 on the disposition of vincristine (VCR) and digoxin (DGX) in rats. One-tenth milligram per kilogram PSC 833 was sufficient to significantly reduce the biliary excretion clearance of DGX from 3.0 ml/min/kg to 0.5 ml/min/kg, whereas 3 mg/kg PSC 833 was needed to significantly reduce the biliary excretion clearance of VCR from 36 ml/min/kg to 9 ml/min/kg. Three milligrams per kilogram PSC 833 significantly reduced the renal clearance of VCR by 30% but did not affect that of DGX significantly. The tissue-to-plasma DGX concentration ratio in the brain at 6 h after administration (0.34 versus 1.64), but not that of VCR at 2 h (1.07 versus 1.37), was significantly increased by PSC 833, 3 mg/kg. The differential effect of PSC 833 on the disposition of VCR and DGX may be ascribed to the different degree of contribution of P-gp to the disposition of these ligands.

ATP Binding Cassette Transporter, Subfamily B, Mem↗
PubMed1999

Successful treatment of cytomegalovirus retinitis in a patient with malignant lymphoma: a case report and review of the literature.

A 52-year-old Japanese woman was diagnosed as having angioimmunoblastic T-cell lymphoma (stage IV-B). She received 6 courses of chemotherapy including cyclophosphamide, doxorubicin, vincristine, and prednisolone every two weeks (biweekly CHOP), and was considered to be in partial remission. She complained of loss of visual acuity in her right eye during her last cycle of chemotherapy. Cytomegalovirus (CMV) retinitis was suspected from the characteristic ophthalmoscopic appearance. This diagnosis was further supported by the detection of CMV DNA in blood and antigens in polymorphonuclear leukocytes, a sign of CMV reactivation. Although DNAemia and antigenemia became negative, retinitis remained slightly active despite a 4-week systemic treatment of ganciclovir. Intraocular injection of ganciclovir was started and continued until the retinitis became inactive ophthalmoscopically. The patient received high-dose chemotherapy with peripheral blood stem cell transplantation and achieved complete remission. During the after this therapy no recurrence of CMV infections was observed. This case shows that 1) a quick and accurate diagnosis of CMV retinitis was possible by applying DNAemia and antigenemia and 2) intensive treatment for the CMV infection enabled the accomplishment of cure-oriented chemotherapy of the lymphoma without the recurrence of CMV retinitis.

Cytomegalovirus Retinitis↗
PubMed1998

Sensory preconditioning for feeding response in the pond snail, Lymnaea stagnalis.

We demonstrated a sensory preconditioning in the pond snail, Lymnaea stagnalis. An appetitive sucrose solution (a conditioned stimulus: CS1) and weak vibration (another conditioned stimulus: CS2) were first associated, and then the CS2 and an aversive KCl solution (an unconditioned stimulus: UCS) were done. To build the conditioning, two different training procedures, spaced and massed, were examined. After the both training, the sensory preconditioning was built: significantly fewer feeding response to the CS1 became elicited; slower latency to the first bite to the CS1 was induced. No significant differences on the memory retention between these training procedures were found in the sensory preconditioning.

Animals↗
PubMed1998

Evidence supporting the activity of 2'-C-cyano-2'-deoxy-1-beta-D-arabino-pentafuranosylcytosine as a terminator in enzymatic DNA-chain elongation.

To investigate the stability of 2'-C-cyano-2'-deoxy-1-beta-D-arabino-pentafuranosylcytosine 3'-phosphoric acid, its thymidine ester was prepared via the phosphoramidite method using allyl protection for the phosphate function. This ester is stable under acidic conditions but extremely labile under basic conditions, decomposing with a cleavage of the internucleotide bond even at pH 7.3.

Antineoplastic Agents↗