Search PubMed⌕ Search

Biomedical subjects

R Kasukawa

Publications and source records attributed to R Kasukawa.

At least 109 records · Page 6Linked to original sources
PubMed1996

[CpG motif in DNA from immune complexes of SLE patients augments expression of intercellular adhesion molecule-1 on endothelial cells].

The sequence of 9 DNA clones obtained from DNA-anti-DNA antibody immune complexes (IC) in 11 SLE patients was analyzed and the possible pathogenic role of the circulating DNA in SLE patients was discussed. Nucleic acid length of 9 cloned DNAs ranged from 87 to 312 base pairs(bp), with a mean length of 177 +/- 62bp, which were rich in guanine (G) + cytosine(C), CpG dinucleotide and palindromic sequences. Oligonucleotide TTTTCAATTCGAAGATGATT which contain the CpG motif in hexamer palindromic sequence segments in cloned DNA augmented the expression of ICAM-1 on the endothelial cells detected by FACS analysis and also augmented the gene expression of several cytokines such as interleukin-2, interleukin-6, interleukin-8 and tumor necrosis factor alpha. These data suggest that DNA in IC of SLE patients will augment expression of ICAM-1 on endothelial cells, resulting in exacerbation of vasculitis.

Antigen-Antibody Complex↗
PubMed1996

[Clinical evaluation of immuno-serological laboratory data].

Clinical evaluations of various laboratory data from immuno-serological tests such as rheumatoid factor, anti-nuclear antibody, and other auto antibodies were reviewed. Rheumatoid factors (RF) were discussed in relation to positivity in various diseases, immunoglobulin class of RF, and correlation between titers of RF and circulating immune complex (IC). As a result, higher frequency and higher titers of IgA-RF were found in Sjögren syndrome patients. Titers of RF did not show disease activity of RA, but those of ESR and CRP did. Anti-nuclear antibodies (ANA) were discussed in relation to positivity in healthy subjects, specific antibodies and corresponding specific disease, correlation among titers of anti-dsDNA antibody, CH50 and circulating immune complex. As a result, an ANA frequency of 40% was found in healthy young women. Values of CH50 were much better than ANA titers for evaluating clinical activity in SLE patients. Findings of anti-cardiolipin antibody in thrombosis patients with connective tissue vascular disease (CVD), anti-centromere antibody in various CVD patients as well as CREST patients and primary biliary cirrhosis patients and anti-neutrophil cytoplasmic antibodies in various vascular diseases along with inflammatory bowel disease patients were presented. Finally, useful laboratory data at different clinical steps such as diagnosis, evaluation of disease activity and estimation of prognosis were demonstrated in CVD.

Adult↗
PubMed1996

A case of idiopathic portal hypertension complicated with narrowing of intrahepatic bile ducts.

A 37-year-old woman who had portal hypertension followed by splenomegaly, developed collateral blood flow of spleno-renal shunt and paraesophageal veins, esophageal varices and further with narrowing of intrahepatic bile ducts shown by endoscopic retrograde cholangiography was described. Liver function was almost normal except the slight elevation of serum alkaline phosphatase and gamma-glutamyl transpeptidase levels. However, endoscopic retrograde cholangiography revealed the narrowing of the intrahepatic bile ducts. The histological examination of biopsied specimen showed no prominent change in portal tracts and bile ducts without cell infiltration or fibrosis in the portal area. This case will be considered as idiopathic portal hypertension complicated by narrowing of the intrahepatic bile ducts.

Adult↗
PubMed1996

Periarticular ectopic calcinosis probably due to 1 alpha-OH-vitamin D3 therapy, and successful treatment with bisphosphonate compound in a patient with systemic lupus erythematosus.

We describe the case of a 25-year-old woman who developed soft tissue ectopic nephritis. Ectopic calcinosis rarely occurs in systemic lupus erythematosus (SLE) patients. This is the first detailed case report of metastatic ectopic calcinosis, one of two categories of ectopic calcinosis, probably due to 1 alpha-OH-vitamin D3 therapy. We administered disodium 3-amino-1-hydroxypropylidene-1, 1-bisphosphonate pentahydrate, a second-generation bisphosphonate, to decrease the patient's serum calcium level, and subsequently observed a dramatic decrease in severity of the ectopic calcinosis along with decreases in both the serum calcium level and the (serum calcium level)x(serum phosphate level) index. We suggest that 1 alpha-OH vitamin D3 should be used in cases of lupus nephritis with great caution.

Adult↗
PubMed1995

Analysis of C5a receptor by monoclonal antibody.

We prepared a mouse monoclonal antibody (mAb), termed 4C8, to the human C5a receptor (C5aR, CD88) by fusing spleen cells from mice immunized with mouse Ltk- cells transfected with cDNA of human C5aR (Ltk-/C5aR) to the mouse myeloma cell line P3U1. This mAb belonging to the IgM kappa subclass, detected a 43 kDa band on cell lysates of Ltk-/C5aR by immunoblotting analysis. Flow cytometry revealed that 4C8 specifically bound to Ltk-/C5aR, suggesting that this antibody is specific for C5aR. Furthermore, 4C8 was found to partially block both intracellular Ca2+ increase in PMN stimulated by C5a and 125I-C5a binding to C5aR on PMN. When cross-linked by anti-mouse IgM, 4C8 completely inhibited the binding of C5a to C5aR on PMN and Ltk-/C5aR. Therefore, it seems likely that this mAb does not recognize the C5aR active site but sterically inhibits the binding of C5a to its receptor. Using this mAb, we detected a 50 kDa band of C5aR on cell lysates of PMN, monocytes and platelets by immunoblotting. C5aR was expressed on PMN and monocytes as determined by flow cytometry, whereas it was not demonstrated on the surface of platelets. Based on these results, this mAb should be useful for analysis of C5aR expression in various immunological conditions and inflammatory diseases.

Animals↗
PubMed1995

Complement-activating properties of IgM rheumatoid factors reacting with IgG subclasses.

To estimate the complement-activating property (CAP) of IgM rheumatoid factor (RF), which was purified from synovial fluids of patients with rheumatoid arthritis, in a reaction with each IgG subclass, the activation and binding of C4 in the classical pathway of complement by IgM RF was measured in an enzyme-linked immunosorbent assay using biotinylated F(ab')2 antibody to human C4. The CAP of IgM RF reacting with IgG3 was significantly higher than that of IgM RFs bound to the other IgG subclasses (P < 0.01). These results suggest that IgM RF reacting with IgG3 in synovial fluid could induce a greater degree of complement-dependent inflammation in RA synovium than IgM RF reacting with other IgG subclasses.

Arthritis, Rheumatoid↗
PubMed1995

Detection of antibodies to 65 KD heat shock protein and to human superoxide dismutase in autoimmune hepatitis-molecular mimicry between 65 KD heat shock protein and superoxide dismutase.

The antibody to 65 KD mycobacterial heat shock protein (HSP65) and antibody to human superoxide dismutase (H-SOD) were measured by ELISA in patients with autoimmune hepatitis (AIH), and results were compared with those of patients with chronic active hepatitis C (CAH-C) or systemic lupus erythematosus (SLE) and normal subjects (NS). Patients with AIH had significantly higher OD values of anti-HSP65 antibody and anti-H-SOD antibody compared with those of patients with CAH-C or SLE and NS. OD values of anti-HSP65 antibody were correlated with those of anti-SOD antibody. Affinity-purified anti-SOD antibody reacted with HSP65. Analysis of the amino acid sequence of human SOD showed that 7 segments, corresponding to r to 25 amino acid residues, exhibited 50 to 71% homology with that of my mycobacterial HSP65.

Amino Acid Sequence↗
PubMed1995

A case of Werner's syndrome associated with systemic lupus erythematosus.

The case of a 40-year-old woman with Werner's syndrome associated with systemic lupus erythematosus (SLE) is reported. The patient exhibited short stature, slender extremities, thinned hair, high-pitched voice, cataracts, ulceration of the fingers, and mental retardation. Malar erythema, photosensitivity, and proteinuria had been noted since age 34. The serum contained high titers of antibodies to dsDNA, Sm, nRNP, and SS-A/Ro. The simultaneous presence of Werner's syndrome and SLE could be a coincidental occurrence of the two diseases, although it might be due to an abnormality in replication or degeneration of DNA leading to the development of both diseases.

Adult↗
PubMed1995

Primary sclerosing cholangitis with marked eosinophilic infiltration in the liver.

A 16-year-old boy was diagnosed as having primary sclerosing cholangitis (PSC), based on retrograde cholangiography showing mixed features of narrowing and dilatation of the common hepatic and intrahepatic bile ducts. However, periductal fibrosis was not observed in the needle biopsy liver specimen. The liver biopsy specimen obtained 11 years previously, at the onset of the disease had disclosed a marked infiltration of eosinophils in the portal tract with eosinophilic catinonic protein immunostaining, with marked eosinophilia (54%) being noted. In Japanese reports, eosinophilia of more than 7% was reported in 13 of 32 (40.6%) PSC patients. However, the early stage of PSC, with marked eosinophilia and eosinophilic infiltration in the liver, such as in the present case, has rarely been reported. The findings in this case suggest that eosinocytes are related to the pathogenesis of PSC.

Adolescent↗
PubMed1995

Gold sodium thiomalate selectivity inhibits interleukin-5-mediated eosinophil survival.

Gold sodium thiomalate (GST) has been used for treatment of patients with bronchial asthma. In this study we investigated the effects of GST on interleukin (IL)-5-mediated eosinophil survival in vitro. Blood cells were obtained from patients with bronchial asthma (n = 18). Eosinophils were purified from the blood samples by a Percoll discontinuous method and negative selection of neutrophils. Eosinophils (10(6) cells/ml) were incubated for 96 hours in 10% fetal bovine serum-RPMI 1640 (Nissui Pharmaceutical Co. Ltd., Tokyo, Japan) with various concentrations of recombinant human IL-5 (2 x 10(-9) to 2 x 10(-5) mmol/L) and with GST (0.01 to 100 mumol/L) in 96-well, flat-bottomed microtiter plates at 37 degrees C in a humidified 5% carbon dioxide atmosphere. Eosinophil viability was determined by trypan blue exclusion. IL-5 enhanced eosinophil survival in a dose-dependent manner. Higher concentrations of GST inhibited IL-5-mediated eosinophil survival. Moreover, GST induced apoptosis of eosinophils by antagonizing the effects of IL-5. However, GST did not inhibit IL-3- or granulocyte-macrophage colony stimulating factor-mediated eosinophil survival, suggesting that GST selectivity inhibits IL-5-mediated eosinophil survival. These results suggest that IL-5-mediated eosinophil survival is inhibited by GST and that GST blocks eosinophil apoptosis by IL-5. It is possible that GST may be capable of controlling eosinophil functions regulated by IL-5 in patients with bronchial asthma.

Apoptosis↗
PubMed1995

Expression of immunoreactivities to 75 kDa nerve growth factor receptor, trk gene product and phosphotyrosine in granular cell tumors.

Nineteen granular cell tumors (GCT) of adults, two congenital granular cell epulides and five epulides fibrosae were immunohistochemically examined to detect the expression of 75 kDa nerve growth factor receptor (NGFR), trk gene product, phosphotyrosine (PT), protein gene product 9.5 (PGP9.5) and S-100 protein. The NGFR-immunoreactivity (IR) and trk gene product-IR were expressed on almost all granular cells of GCT. PT-IR was also demonstrated on granular cells of all GCT examined, although the frequency of positive cells was low. Congenital granular cell epulides and epulides fibrosae were negative for NGFR-IR, trk gene product-IR and PT-IR. S-100 protein was localized in granular cells of adult GCT but not in the granular cells of congenital epulis. On the other hand, PGP9.5 was detected in granular cells of both conditions and in fibroblastic cells of epulis fibrosa. The present results further indicate that GCT is of peripheral nerve Schwann cell origin, while the congenital granular cell epulides are not of neural origin. NGFR and trk gene product expressed on GCT seems to be functional in terms of phosphorylation of the tyrosine residue in the receptor or downstream protein in signal transduction.

Adult↗
PubMed1995

Association of primary sclerosing cholangitis, thymoma and hypogammaglobulinemia.

A 64-year-old Japanese woman with thymoma has been suffering from diarrhea and increased alkaline phosphatase levels without jaundice. Her serum immunoglobulin levels of IgM and IgG were less than half of the normal levels, with an increase in CD8 (suppressor/cytotoxic) T cell percentage and a decrease in CD4 (helper) T cell percentage, resulting in a lower CD4/CD8 ratio of 0.31. These immunological features are in accordance with those of hypogammaglobulinemia complicating thymoma. Cholangiography and a liver biopsy specimen disclosed the presence of primary sclerosing cholangitis (PSC). PSC has been recognized in various immunodeficiency syndromes and this case shows that thymoma complicated by hypogammaglobulinemia is associated with PSC.

Agammaglobulinemia↗
PubMed1995

Pulmonary hypertension in rats. 1. Role of bromodeoxyuridine-positive mononuclear cells and alveolar macrophages.

The role of activated cells determined by staining with bromodeoxyuridine (BrdU) and the role of alveolar macrophages as a source of cytokines were investigated in monocrotaline (MCT)-induced pulmonary hypertension (PH) in rats. BrdU was mainly incorporated by mononuclear cells; their number increased strikingly prior to the development of PH. Cytokines such as interleukin (IL)-1, IL-6 and tumor necrosis factor were produced during the development of PH. The amount of IL-6 showed significant correlation (p < 0.05) with the number of BrdU-positive cells, which, in turn, correlated with the extent of PH. These results indicate that BrdU-positive cells and cytokines produced by alveolar macrophages may play an important role in the pathogenesis of MCT-induced PH in rats.

Animals↗
PubMed1995

Pulmonary hypertension in rats. 2. Role of interleukin-6.

We administered human interleukin (IL)-6 to rats to examine whether it is implicated in the development of pulmonary hypertension (PH). The rats injected with IL-6 developed PH as determined by the weight ratio of the right ventricle to the left ventricle+septum. This ratio decreased with the appearance of IgG anti-human IL-6 antibody. Histologically we observed in the lungs, luminal occlusion of small muscular arteries, capillaries filled with fibrin thrombi, and localized hemorrhage. IL-6 increased the number of platelets, and the number of platelets correlated with the extent of PH. Thus, it seems likely that (IL-6) is involved in the formation of PH in this model.

Animals↗
PubMed1995

Streptococcus-mutans-induced nephritis in rabbits: rheumatoid factors and nephritogenicity.

The pathogenesis of streptococcus-induced nephritides (SIN) involves immune complex-mediated inflammation; however, specific mechanisms are still poorly understood. Using preparations of two strains of Streptococcus mutans (SM) in attempts to induce SIN in rabbits, one preparation was strongly and the other virtually not nephritogenic. The non-nephritogenic preparation provided a negative control for our studies. Streptococcal components were present in circulating immune complexes (CIC) as well as in tissue-bound immune complexes (TIC), especially early in the disease. CIC and TIC also contained rheumatoid factors (RF), which tended to predominate in late stages of the disease. The nephritogenic and the non-nephritogenic preparations of SM shared the same major tissue-binding components and induced similar titers of antimicrobial antibodies, but differed significantly in their ability to induce CIC and RF. It is proposed that kidney-binding microbial components, antimicrobial antibodies and high serum concentration of RF are necessary and sufficient determinants for the pathogenesis of SIN in this rabbit model.

Animals↗
PubMed1995

Leukocyte adhesion molecules in the liver and plasma cytokine levels in endotoxin-induced rat liver injury.

BACKGROUND: The interactions between polymorphonuclear neutrophils (PMNs) and sinusoidal endothelial cells (SECs) have been known to be involved in the pathogenesis of acute liver injury. It has been also reported that tumor necrosis factor-alpha (TNF-alpha) up-regulates ICAM-1 expression on SECs and that interleukin-8 (IL-8) provokes rapid activation of CD11/CD18 on PMNs. These findings expand into the relationship between the expression of leukocyte adhesion molecules (ICAM-1, CD11a/CD18 and CD11b/CD18) in liver tissues and plasma TNF and IL-8 levels after lipopolysaccharide (LPS)-induced liver injury in rats. METHODS: Male Wistar rats weighing 200-250 g were treated with 2 mg LPS/kg intravenously in a 0.2- to 0.25-ml volume. Liver and blood samples were obtained at 1, 3, 8, and 12 h after LPS exposure. Plasma TNF and IL-8 levels were measured using bioassay and specific enzyme-linked immunosorbent assay, respectively. Liver samples were fixed and studied by immunohistochemistry using specific monoclonal antibodies against ICAM-1, CD11a, and CD11b. RESULTS: The TNF level showed a peak at 1 h (23.3 +/- 11.4 IU/ml), and the IL-8 level showed a peak at 3 h (343.1 +/- 110.5 ng/ml) after LPS exposure. An increase in the number of PMNs in the liver was observed as early as 1 h and continued until 12 h after LPS exposure. PMNs adhered to degenerated SECs and hepatocytes. ICAM-1 on SECs was diffusely and strongly expressed at 8 h, and PMNs adhered to SECs expressed both CD11a and CD11b. ICAM-1 was also observed on hepatocytes. CONCLUSION: These data suggest that PMN-SEC and PMN-hepatocyte interactions via leukocyte adhesion molecules, related to inflammatory cytokines such as TNF and IL-8, exist and play an important role in the pathogenesis of acute liver injury.

Animals↗